MEGAResFrom MEG, the Microbial Ecology Group

VANXB

The vanX gene encodes a dipeptidase. This gene is part of the VanB operon and is a core resistance gene.

References

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>458|AF310956.2|AF310956|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATGGCGTCCGTTGGGATGCCAAGTACGCCACATGGGATAACTT
CACAGGAAAACCGGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGTTTGCTCTGCGCGAGGCAC
AAATCCATGCGGCTGCGCTTGGCTATGGCTTGCTTTTATGGGATGGATATCGGCCAAGAACTGCGGTGGACTGCTTCCTG
CGTTGGGCAGCGCAACCGGAGGACAATCTCACAAAAGAAAAATTTTACCCCAATATAGAGCGAGCCGAGTTGATTACAAA
GGGTTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCGCAATTGATCTTACGCTCTACCACCTGGATACAGGGGAAC
TTGTTTCAATGGGAAGTAACTTCGATTTTATGGACGAACGGTCGCATCATACAGCAAAAGGGATAGGGGATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCTTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCCGTTTCATAA

>CARD|phgb|U35369|6004-6613|ARO:3002950|vanXB|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATGGTGTTCGTTGGGATGCCAAGTACGCTACATGGGATAACTT
CACGGGAAAACCAGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGCTTGCTCTGCGCGAAGCAC
AAATCCATGCGGCACGCCTTGGCTACGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTG
CGTTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAA
GGGCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAAC
TTGTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCTGTTTCATAA

>Gly|VanX-B_1_AF192329|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATTGCGTCCGTTGGGATGCCAAGTACGCCACATGGGATAACTT
CACAGGAAAACCGGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGTTTGCTCTGCGCGAGGCAC
AAATCCATGCGGCACGCCTTGGCTATGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTG
CGTTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAA
GGGCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAAC
TTGTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCCGTTTCATAA