MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANXB

The vanX gene encodes a dipeptidase. This gene is part of the VanB operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>>MEG_7558|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
atggaaaatggttttttgtttttagatgaaatgttgcatggcgtccgttgggatgccaagtacgccacatgggataactt
cacaggaaaaccggtggatgggtatgaggtgaatcgcatcatcggcacaaaggccgtggcgtttgctctgcgcgaggcac
aaatccatgcggcacgccttggctatggcttgcttttatgggatggatatcggccaaaatctgcggtggactgtttcctg
cgttgggcggcgcagccggaggacaacctcacaaaagaaaaatattaccccaatattgagcgagccgagttgattacaaa
gggctatgtggcctcacaatccagccatagccgtggaagcacaattgatcttacgctctaccacttggatacaggggaac
ttgtttcaatgggaagcaacttcgattttatggacgaacggtcgcaccatacagcaaaagggatagggaatgcagaggca
caaaatcgaagatgcttgcgtaaaatcatggaaagcagcggatttcagtcctatcgctttgaatggtggcactataagtt
gattgatgagccataccccgatacctattttaattttgccgtttcataa

>>MEG_7559|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
atggaaaatggttttttgtttttagatgaaatgttgcatggcgtccgttgggatgccaagtacgccacatgggataactt
cacaggaaaaccggtggatgggtatgaggtgaatcgcatcatcggcacaaaggccgtggcgtttgctctgcgcgaggcac
aaatccatgcggctgcgcttggctatggcttgcttttatgggatggatatcggccaagaactgcggtggactgcttcctg
cgttgggcagcgcaaccggaggacaagctcacaaaagaaaaattttaccccaatatagagcgagccgagttgattacaaa
gggttatgtggcctcacaatccagccatagccgtggaagcgcaattgatcttacgctctaccacctggatacaggggaac
ttgtttcaatgggaagtaacttcgattttatggacgaacggtcgcatcatacagcaaaagggataggggatgcagaggca
caaaatcgaagatgcttgcgtaaaatcatggaaagcagcggatttcagtcttatcgctttgaatggtggcactataagtt
gattgatgagccataccccgatacctattttaattttcccgtttcataa

>>MEG_7560|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
atggaaaatggttttttgtttttagatgaaatgttgcatggcgtccgttgggatgccaagtacgccacatgggataactt
cacaggaaaaccggtggatgggtatgaggtgaatcgcatcatcggcacaaaggccgtggcgtttgctctgcgcgaggcac
aaatccatgcggctgcgcttggctatggcttgcttttatgggatggatatcggccaagaactgcggtggactgcttcctg
cgttgggcagcgcaaccggaggacaagctcacaaaagaaaaattttaccccaatatagagcgagccgagttgattacaaa
gggttatgtggcctcacaatccagccatagccgtggaagcgcaattgatcttacgctctaccacctggatacaggggaac
ttgtttcaatgggaagtaacttcgattttatggacgaacggtcgcatcatacagcaaaagggataggggatgcagaggca
caaaatcgaagatgcttgcgtaaaatcatggaaagcagcggatttcagtcttatcgctttgaatggtggcactataagtt
gattgatgagccataccccgatacctattttaattttgccgtttcataa

>>MEG_7561|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATGGCGTCCGTTGGGATGCCAAGTACGCCACATGGGATAACTT
CACAGGAAAACCGGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGTTTGCTCTGCGCGAGGCAC
AAATCCATGCGGCTGCGCTTGGCTATGGCTTGCTTTTATGGGATGGATATCGGCCAAGAACTGCGGTGGACTGCTTCCTG
CGTTGGGCAGCGCAACCGGAGGACAATCTCACAAAAGAAAAATTTTACCCCAATATAGAGCGAGCCGAGTTGATTACAAA
GGGTTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCGCAATTGATCTTACGCTCTACCACCTGGATACAGGGGAAC
TTGTTTCAATGGGAAGTAACTTCGATTTTATGGACGAACGGTCGCATCATACAGCAAAAGGGATAGGGGATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCTTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCCGTTTCATAA

>>MEG_7562|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATTGCGTCCGTTGGGATGCCAAGTACGCCACATGGGATAACTT
CACAGGAAAACCGGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGTTTGCTCTGCGCGAGGCAC
AAATCCATGCGGCACGCCTTGGCTATGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTG
CGTTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAA
GGGCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAAC
TTGTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCA
CAAAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTT
GATTGATGAGCCATACCCCGATACCTATTTTAATTTTGCCGTTTCATAA

>>MEG_7563|Drugs|Glycopeptides|VanB-type_resistance_protein|VANXB
ATGAAACATGATTTTGTCTTTGTAGACGAGTTTGTATCAGGAATACGCTGGGACGCTAAATACGCCACATGGGATAATTT
TATCGGCAAACCGGTGGACGGATATGCAGCCAATCGAATTGTCGGTACGAGAGCTTTGTGCTTAAGTCTGGAAAAAGCAC
GAGAAAAAGCCTCATCCTTTGGCTTTGGCTTGCTTCTTTGGGATGGTTATCGCCCTCAAAGTGCCGTAGATTGTTTTCTG
CGCTGGTCAAAACAGCCGGAAGACGGCCGGACGAAACTGAAACACTATCCTAATATTGACCGATCCGAGATAGTAGCAAA
AGGATATGTGGCCGCTAAGTCGGGTCACAGCCGGGGCAGCGCAATTGACTTAACACTTTATCATTTAGCTTCCGGAATAC
TTGTGCCAATGGGCGGCGGCTTTGATTTAATGGATTCGGTCTCACATCATGGAGCAAAAGGAATCACACAAGCCGAAGCA
AGAAACCGTCAATACCTTTGTTCTATCATGGAGGCCAGCGGTTTTGTTTCCTACGATTGCGAATGGTGGCATTACACACT
GAAACACGAACCATATCCAAATACTTATTTTGATTTTCTCATCGCCTAGTTGAGCCGGAAAACTGTGAGGTGCTTGTTTA
CAATGGAAATGACGGTACAGAAAATCGTCGCCGCGTGCGGCGGAAAATTACTCTGCGGGAACCCGGATACGCTGGTGACC
TCGGTGGTGACCGACAGCAGGGAGGTGGCCGGCGGTTCCCTGTTTGTCCCCCTCAAAGGAGAAAAGACGGACGCCCACAC
CTTTCTGCACGCCGCATTCGCCTCGGGCGCGGCCACGGTGTTGACCCAGGAGCATACGCAGACGGAGGCGGAAGAAGCCT
GGATCGCGGTGGATTCGACTCAGCCGGCGCTCCAGAACATTGCCGCCGCCTATCGACAGAGATTTCCCATCCCTGTCGTT
GGGATCACGGGGAGCGTCGGGAAGACGACGACGAAAGAAATGGTTGCTCTGGCACTCGCCGCAAGATACAAGGTGATGAA
GACGAGGGGAAACCATAACAGCCAGATCGGACTGCCTCTGATGATGTTCGAGTTTTCCGGGGAACATGAAGCGGCGGTGG
TGGAGATGGGGATCAGCGATTTCGGCGAAATGGCTTGCCTGGCTCGGGTCGCCGAGCCGAAGTACGCCGTTATGACCAAC
ATCGGTATTACCCACATCGGCCAGCTCAAAACCCAGGAGAACATCCTGGGGGAGAAGCTGCACATCACCGATCGGTTCAC
ACAGGGTTCTGTTCTGTTTTTAAACGGGGATGACCCCATGCTCGCCGGCCTCCGCGGAAAGACAACCTATGAGACCGTCT
TTTACGGCAGGGCGCCCTGGTGCGATTTCCGCGCGGAGGGGATTACGGTTCAAAAGGAAACCACCACTTTCCGCTGCCTT
GCTCCGGGGAGAGAGTGTGTCGATGTGAACCTGCCGGTACTTGGTATGCACCATGTTCTGGATGCCCTCGCCGGTCTTGC
CGTGGCGGAGCGGCTGGGCGTACCCCTGGACCGGGCCGTCACCGCCCTTGGGGATTACCGCCCCCTGACCATGCGCCAGC
AGATTTACCATGTCAATGAGGTTACCGTCATCGACGATTCCTACAACTCCAGTCCCGACGCGGCCAAAAGCAGCCTGAGC
GTCCTTGCGGGGTTCCGGACCGGCCGCAGAGTAGCCGTGCTGGCGGATATGCTCGAACTGGGGGAGTATTCCCGGCAGGC
GCATTTTGAAGTCGGTGTCTGCGCCGCGGAAAAGGGAGTCGATATTTTACTCACCGTCGGTCCGGAGGCGAAAGCCGTGG
CCGAGGGCGCGCGCTCCGTCCGGTCCGGGATCGACTGCCGCGTTTTGGACAATAACGATCAGGCCGCAGCGGAGTTGAAA
TCCTTTCTGTCTTCCGGCGACGCGGTTCTGGTCAAAGGCTCCCGCGGCATGCATACGGACGAGATCGTCCGTGCCCTGCT
TTAGCTTCCCACATCTCTGAAACTGATTTCAAGTTTCTGAACATGCTGAGAAACAGAACTGGCAGTGCTCCGGAGAATAC
CATCGGCAACGCAGCAGGGCAACCAGGACAGTTCGTCCAGACAAAATGGAGTGTAATTTTCTTGATGTTAAAAGTAGATA
AAATAAGTGAAGAAATCTATTATTCCTTTATTTCTCAAGCAGATTTAGGCAATTTTATGCAGTATCCTTCCTGGGCCAAG
GTCAAAACCGAGTGGACCAGCGATTTATTGGGGTGGTTTACCCCGGATAAGAAATTGGTAGGGTGTGGTTTAGTTTTATA
CCGGAAAATGCCCTGCCTTAACCGGTACCTGGCTTATTGTCCCCGCGGCCCGATTATTGACTGGCAGAGCTCCAACCTCA
AGGAATGGTTTGAACCATTTCTTGCTTATTTGAAGAGCAAGCACGTTTTCAGTGTCAAAATCGACCCTCCGGTAGTACAG
GCAAAATGGTCTACTCCTATAATTAAGAAGTTTTTAGAGCAAGCTCGAGAACAGGGCAGCTCCGGTAAAGTTTTGCGTGA
TTTGCCACCTGATGAGGACTACGCAACGGCCCAACAGGTGCAGCAGCAATTACGGCAAATCGGTTGGCAGAAGCAGGGAG
GTGATACGGGTTTCGCCGCGACCCAACCCGAATATGTTTACCGCCTGCCCTTAAAGGGGCGCAGCTTGACTGAGATCTTC
GCCTGTTTTCATACCAACTGGAGGCGCAACGTTAAAAAGGCTGAGCGGTTAGGCGTCAAGGTCCGAGTCGGGACAGAACA
GGATTTACCGGCTTTCTACGAGCTGCTGAAGGTAACTTCAGAACGGGATCAATTCAAGGTGCGTACTTTCTCCTACTTTT
CCAACCTGTACCGGTCATTAAAGGCTGAAACAGCCGACCGTATTAATCTTTATCTGGCGGAAGACGAAGAGGAATTATTG
GCTGCAACCTTAGCTGTCCATTCCAACTTCCACTCATGGTATCTTTACGGGGCCAGCAGCAATGTGAAACGGGAGAAGGT
CCCTAATCATGCTATCCAGTGGCGTATGATTCAAGATGCTTATCAGCTTAAGGCCCACACCTATGATTTTCGAGGCATTA
GCCCTACCCTGGATGAATCTGACCACCTGTTTGGGTTGTTGCGATTTAAATTGGGCTTTGGAGGTGAGGCCTGTGAAATG
ATCAGTGCTTGGGACTACCCCCTGCAGCCTTTATTACACCGGGCTTTCCAGCTGTATTTAAAACGGCGGTAGGGTGGTGA
AACCATATTCCTGAAAAGGGGTCTCAGACATGAAACGAAAAAGAATGACTCAGATTTTTCCATTCATATTGCCGTTGCGC
AGGACACAAAGAAAATTATTCTTCTATGCTAAGATGTACTTTGACCGGAACCACTATGCAAAAGCAAAGGCTTCGGAGTT
TTTGCCTTTTTGCATTTATGAAACCAAGTCGAAGCTTCTCAATGAGAATACAGGCTTTGATATGAAATATCAGGAAAACA
AGGTGTTTAATCTGCGTCTTGCCGCGGAGACTATTAATGGCTTGGTCATACGCCCTGGTGAAACATTTTCATTTTGGCAG
CGTGTGAGATATGCCGAGAAAAAAGAGCGGTATAAGGACGGTTTGTGCGTGGTGAATGGCAAATTGGTCACGGTCCCGGG
AGGCGGTTCGTGTCATCTCAGCAATTTGCTGTTCTGGTTGTTTCTGCATACACCCCTCACTATTGCAGAACGGCATCCTC
ATCAGCTTAAGGATTTTCCTTCTCCTGATGAGGATGAACCGGATGGTGTGGACGCTACGGTCAGTGAAGGGTGGCTGGAT
TTAAAAGTCAAAAACAATACCAATCTTACCTTCCAAATTGAAATATCCATCAATAGGCCTAACTTATACGGCCGTATTTT
TGTGGATCAGGACAAAGGGTATTGTTACGAGGTCATTAATCGGGATAAGAGCTTTTTCAAAAAAGACGGGAAAATCTTTG
AGCAAGTTTCTGTTTGTCGGCAGGTGCTGGACAGCAAATCCCAACAGGTTGTTTCCGAAAGCCTGCTTTATACGGATGTA
TTTGAAATCGGGTATTCGCTTCCGGAAGGAACGGTTATCCAAGAAGAAAGGTAGTGATTCTCCACAGTGAGATACTGTTG
AAAATACTATTATAAATTGCTTGAAATTTGAAAGGAGAAAGCAGCATGGATAAGTTGAAAATCGCAATTATCTTCGGAGG
CTGTTCCGAAGAACATCTCATCTCCGTTAAATCTGCGCAAGAGGTCGCCAAAAACCTTGATCTCGAAAAGTATGAACCCT
TCTATATCGGGATTACAAAAGATGGTGTTTGGAAGCTTTGTCACTGTCCTGAGGCCAATTGGGAAAAGGGCAGTTGCCGT
CCGGCTATACTGTCACCGGACAGAAGTGTACACGGATTGCTTGTTCTGGTCAAGGACAATACAAAACGATTCGATTGGAT
ATGGTGTTTCCCGTTCTGCATGGTAAACTTGGCGAGGATGGTGCGATGCAAGGTTTGTTGGAGCTTTCCGGCATCCCCTA
TGTAGGCTGCGATGTGCAAAGTTCTGCTCTGTGTATGGACAAATCCCTTGCTTATATCGTCGCTGGAAAGGCGGGAATTG
GGACGCCAAATTTCCGGACTGTCACGGCAAAGGAGACTATTGATGCCGACGGACTTTCTTATCCCGTTTTTGTCAAGCCG
GCCCGTTCGGGTTCATCCTTCGGCGTCAGTAAGGTATGCCGAAAAGAAGAATTGCGGAGCGCGGTGGAAACCGCAAGACA
ATATGACTCGAAGGTGTTGATTGAAGAGGCTGTCGCCGGCAGCGAGGTAGGATGTGCCATATTAGGGAACGATCCGGAGT
TGATGGCAGGCGAGGTAGATCAAATTTCTCTGTCCCATGGTTTTTTCAGAATCCATCAGGAGAATGAGCCTGAAAAGGGT
TCCGAAAACTCAACATTCATCGTTCCCGCCGGCATTTCGGCAGAGGCGCGCTTGTTCGTTCAGGAGACAGCAAAAGCCGT
CTATCGCGCCTTGGGGTGCAGGGGACTTGCGCGGGTGGATATGTTTCTGAAGGAAGATGGAAAAGTAATCCTTAACGAGG
TTAATACGTTGCCCGGTATGACCTCATATAGCCGTTATCCGAGAATGGTGGCGGCCGCAGGGTTGACCTTTGCCGAAGTG
ATCGACCGGATTGTGGCATTGACATTGCAAGGAAAATAA