MEGAResFrom MEG, the Microbial Ecology Group

VANHB

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanB operon and is a core resistance gene.

References

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>Gly|VanH-B|AF192329|27871-28842|972|Glycopeptides|VanB-type_resistance_protein|VANHB
ATGAGAAAAAGTATGGGCATTACTGTTTTTGGATGCGAACAGGATGAGGCAAATGCTTTCCGCGCTTTATCGCCAGATTT
TCATATTATCCCTACGCTGATTAGCGATGCGATATCGGCAGACAACGCAAAATTGGCCGCTGGCAATCAATGCGTTAGCG
AAGGCCATAAGTCCGAGGTTTCCGAGGCGACAATTCTTGCGCTGAGAAAGGTCGGGGTAAAATACATTTCTACCCGCAGC
ATCGGCTGCGATCACATTGATACGACTGCCGCCGAGAGAATGGGAATCTCGGTTGGCACGGTTGCGTATTCGCCGGACAG
CGTTGCGGATTATGCTTTGATGCTGATGCTGATGGCCATACGGGGTGCAAAACCCACCATGCACGCCGTGGCGCAACAAG
ATTTCAGATTGGATCGTATCCGGGGGAAAGAACTGGGGGATATGACTGTGCGAGTTATTGGAACCGGCCATATCGGGCAA
GCGGTCGTCAAAAGGCTGCGGGGATTTGGATGCCATGTGCTGGCCTATGATAACAGCCGAAAAATGGATGCAGATTATGT
CCAGCTTGATGAGCTTCTAAAAAACAGCGGTATTGTTACGCTCCATGTGCCGCTTTGTGCGGATACCCGCCATCTGATCG
GTCAGAAGCAAATTGGAGAGATGAAGCAAGGCGCATTTTTAATCAACACCGGGCGCGGAGCGCTTGTCGATACCGGGGCG
CTGGTGGAGGCGTTGGAAAGCGGAAAGCTGGGTGGTGCGGCACTGGATGTGTTGGAGGGCGAGGATCAGTTTGTTTATAC
CGATTGCTCGCAGAAAGTGCTTGACCATCCCTTTTTGTCGCAGCTTTTAAGGATGCCGAATGTGATCATCACACCCCATA
CGGCGTACTACACTGAGCGTGTGCTGCAGGATACTACAGAAAAAACAATCAGGAATTGTCTCAATTTTGAAAGGAGTTTA
CAGCATGAATAG