Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANHB

The vanH gene encodes a D-Lac dehydrogenase. This gene is part of the VanB operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>>MEG_7413|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
atgagaaaaagtgtgggcattactgtttttggatgcgaacaggatgaggcaaatgctttccgcgctttatcgccggattt
tcatattatccctacgctgattagcgatgcgatatcggcagacaacgcaaaattggccgctggcaatcaatgcgttagcg
taagccataagtccgaggtttccgaggcgacaattcttgcgctgagaaaggtcggggtaaaatacatttctacccgcagc
atcggctgcgatcacattgatacgactgccgccgagagaatgggaatctcggttggcacggttgcgtattcgccggacag
cgttgcggattatgctttgatgctgatgctgatggccatacggggtgcaaaacccaccatgcacgccgtggcgcaacaag
atttcagattggatcgtatccgggggaaagaactgggggatatgactgtgggagttattggaaccggccatatcgggcaa
gcggtcgtcaaaaggctgcggggatttggatgccatgtgctggcctatgataacagccgaaaaatggatgcagattatgt
ccagcttgatgagcttctaaaaaacagcgatattgttacgctccatgtgccgctttgtgcggatacccgccatctgatcg
gtcagaagcaaattggagagatgaagcaaggcgcatttttaatcaacaccgggcgcggagcgcttgtcgataccggggcg
ctggtggaggcgttggaaagcggaaagctgggtggtgcggcactggatgtgttggagggcgaggatcagtttgtttatac
cgattgctcgcagaaagtgcttgaccatccctttttgtcgcagcttttaaggatgccgaatgtgatcatcacaccccata
cggcgtactacactgagcgtgtgctgcaggatactacagaaaaaacaatcaggaattgtctcaattttgaaaggagttta
cagcatgaatag

>>MEG_7414|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
atgagaaaaagtgtgggcattactgtttttggatgcgaacaggatgaggcaaatgctttccgcgctttatcgccggattt
tcatattatccctacgctgattagcgatgcgatatcggcagacaacgcaaaattggccgctggcaatcaatgcgttagcg
taggccataagtccgaggtttccgaggcgacaattcttgcgctgagaaaggtcggggtaaaatacatttctacccgcagc
atcggctgcgatcacattgatacgactgccgccgagagaatgggaatctcggttggcacggttgcgtattcgccggacag
cgttgcggattatgctttgatgctgatgctgatggccatacggggtgcaaaacccaccatgcacgccgtggcgcaacaag
atttcagattggatcgtatccgggggaaagaactgggggatatgactgtgggagttattggaaccggccatatcgggcaa
gcggtcgtcaaaaggctgcggggatttggatgccatgtgctggcctatgataacagccgaaaaatggatgcagattatgt
ccagcttgatgagcttctaaaaaacagcgatattgttacgctccatgtgccgctttgtgcggatacccgccatctgatcg
gtcagaagcaaattggagagatgaagcaaggcgcatttttaatcaacaccgcgcgcggagcgcttgtcgataccggggcg
ctggtggaggcgttggaaagcggaaagctgggtggtgcggcactggatgtgttggagggcgaggatcagtttgtttatac
cgattgctcgcagaaagtgcttgaccatccctttttgtcgcagcttttaaggatgccgaatgtgatcatcacaccccata
cggcgtactacactgagcgtgtgctgcaggatactacagaaaaaacaatcaggaattgtctcaattttgaaaggagttta
cagcatgaatag

>>MEG_7415|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
atgagaaaaagtgtgggcattactgtttttggatgcgaacaggatgaggcaaatgctttccgcgctttatcgccggattt
tcatattatccctacgctgattagcgatgcgatatcggcagacaacgcaaaattggccgctggcaatcaatgcgttagcg
taggccataagtccgaggtttccgaggcgacaattcttgcgctgagaaaggtcggggtaaaatacatttctacccgcagc
atcggctgcgatcacattgatacgactgccgccgagagaatgggaatctcggttggcacggttgcgtattcgccggacag
cgttgcggattatgctttgatgctgatgctgatggccatacggggtgcaaaacccaccatgcacgccgtggcgcaacaag
atttcagattggatcgtatccgggggaaagaactgggggatatgactgtgggagttattggaaccggccatatcgggcaa
gcggtcgtcaaaaggctgcggggatttggatgccatgtgctggcctatgataacagccgaaaaatggatgcagattatgt
ccagcttgatgagcttctaaaaaacagcgatattgttacgctccatgtgccgctttgtgcggatacccgccatctgatcg
gtcagaagcaaattggagagatgaagcaaggcgcatttttaatcaacaccgggcgcggagcgcttgtcgataccggggcg
ctggtggaggcgttggaaagcggaaagctgggtggtgcggcactggatgtgttggagggcgaggatcagtttgtttatac
cgattgctcgcagaaagtgcttgaccatccctttttgtcgcagcttttaaggatgccgaatgtgatcatcacaccccata
cggcgtactacactgagcgtgtgctgcaggatactacagaaaaaacaatcaggaattgtctcaattttgaaaggagttta
cagcatgaatag

>>MEG_7416|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
ATGAGAAAAAGTATGGGCATTACTGTTTTTGGATGCGAACAGGATGAGGCAAATGCTTTCCGCGCTTTATCGCCAGATTT
TCATATTATCCCTACGCTGATTAGCGATGCGATATCGGCAGACAACGCAAAATTGGCCGCTGGCAATCAATGCGTTAGCG
AAGGCCATAAGTCCGAGGTTTCCGAGGCGACAATTCTTGCGCTGAGAAAGGTCGGGGTAAAATACATTTCTACCCGCAGC
ATCGGCTGCGATCACATTGATACGACTGCCGCCGAGAGAATGGGAATCTCGGTTGGCACGGTTGCGTATTCGCCGGACAG
CGTTGCGGATTATGCTTTGATGCTGATGCTGATGGCCATACGGGGTGCAAAACCCACCATGCACGCCGTGGCGCAACAAG
ATTTCAGATTGGATCGTATCCGGGGGAAAGAACTGGGGGATATGACTGTGCGAGTTATTGGAACCGGCCATATCGGGCAA
GCGGTCGTCAAAAGGCTGCGGGGATTTGGATGCCATGTGCTGGCCTATGATAACAGCCGAAAAATGGATGCAGATTATGT
CCAGCTTGATGAGCTTCTAAAAAACAGCGGTATTGTTACGCTCCATGTGCCGCTTTGTGCGGATACCCGCCATCTGATCG
GTCAGAAGCAAATTGGAGAGATGAAGCAAGGCGCATTTTTAATCAACACCGGGCGCGGAGCGCTTGTCGATACCGGGGCG
CTGGTGGAGGCGTTGGAAAGCGGAAAGCTGGGTGGTGCGGCACTGGATGTGTTGGAGGGCGAGGATCAGTTTGTTTATAC
CGATTGCTCGCAGAAAGTGCTTGACCATCCCTTTTTGTCGCAGCTTTTAAGGATGCCGAATGTGATCATCACACCCCATA
CGGCGTACTACACTGAGCGTGTGCTGCAGGATACTACAGAAAAAACAATCAGGAATTGTCTCAATTTTGAAAGGAGTTTA
CAGCATGAATAG

>>MEG_7417|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
ATGAGAAAAAGTATGGGCATTACTGTTTTTGGATGCGAACAGGATGAGGCAAATGCTTTCCGCGCTTTATCGCCAGATTT
TCATATTATCCCTACGCTGATTAGCGATGCGATATCGGCAGACAACGCAAAATTGGCCGCTGGCAATCAATGCGTTAGCG
AAGGCCATAAGTCCGAGGTTTCCGAGGCGACAATTCTTGCGCTGAGAAAGGTCGGGGTAAAATACATTTCTACCCGCAGC
ATCGGCTGCGATCACATTGATACGACTGCCGCCGAGAGAATGGGAATCTCGGTTGGCACGGTTGCGTATTCGCCGGACAG
CGTTGCGGATTATGCTTTGATGCTGATGCTGATGGCCATACGGGGTGCAAAACCCACCATGCACGCCGTGGCGCAACAAG
ATTTCAGATTGGATCGTATCCGGGGGAAAGAACTGGGGGATATGACTGTGCGAGTTATTGGAACCGGCCATATCGGGCAA
GCGGTCGTCAAAAGGCTGCGGGGATTTGGATGCCATGTGCTGGCCTATGATAACAGCCGAAAAATGGATGCAGATTATGT
CCAGCTTGATGAGCTTCTAAAAAACAGCGGTATTGTTACGCTCCATGTGCCGCTTTGTGCGGATACCCGCCATCTGATCG
GTCAGAAGCAAATTGGAGAGATGAAGCAAGGCGCATTTTTAATCAACACCGGGCGCGGAGCGCTTGTCGATACCGGGGCG
CTGGTGGAGGCGTTGGAAAGCGGAAAGCTGGGTGGTGCGGCACTGGATGTGTTGGAGGGCGAGGATCAGTTTGTTTATAC
CGATTGCTCGCAGAAAGTGCTTGACCATCCCTTTTTGTCGCAGCTTTTAAGGATGCCGAATGTGATCATCACACCCCATA
CGGCGTACTACACTGAGCGTGTGCTGCAGGATACTACAGAAAAAACAATCAGGAATTGTCTCAATTTTGAAAGGAGTTTA
CAGCATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAG
AAATTGCTGCGAACATTAATACTGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGCGTATGGAAGCTATGC
AAGAAGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGT
CATGAAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTG
CGATACAGGGTCTGTTTGAATTGTCTGGTATCCCCTATGTAGGCTGCGATATTCAAAGCTCCGCAGCTTGCATGGACAAA
TCACTGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGA
GGCGGGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTA
CGGAAGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGT
GAGGTCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTAT
CTTCCGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCG
AGGAACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTT
TTTTTGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCTGGTTTTACATCGTACAGCCGCTACCCACG
TATGGTGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGACCCGTAT
GGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATTGCGTCCGTTGGGATGCCAAGTACGCCACATGGGATAACTTCA
CAGGAAAACCGGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGTTTGCTCTGCGCGAGGCACAA
ATCCATGCGGCACGCCTTGGCTATGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTGCG
TTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAAGG
GCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAACTT
GTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCACA
AAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTTGA
TTGATGAGCCATACCCCGATACCTATTTTAATTTTGCCGTTTCATAA

>>MEG_7418|Drugs|Glycopeptides|VanB-type_resistance_protein|VANHB
ATGAGAAAAAGTATGGGCATTACTGTTTTTGGATGCGAGCAGGATGAGGCAAATGCTTTCCGCACCTTATCACCAGATTT
TCATATTATCCCTACGCTGATCAGTGATGCGATATCGGCAGACAACGCAAAATTGGCCGCTGGCAATCAATGCATTAGCG
TAGGCCATAAGTCCGAGGTTTCCGAGGCGACAATTCTTGCGCTGAGAAAGGTCGGGGTAAAATACATTTCTACCCGCAGC
ATCGGCTGCAATCACATTGATACGACTGCCGCCGAGAGAATGGGGATCTCGGTTGGCACAGTTGCGTATTCGCCGGACAG
CGTTGCGGATTATGCTTTGATGCTGATGCTGATGGCCATACGGGGTGCAAAGTCCACCATACACGCCGTGGCGCAACAAA
ATTTCAGACTGGATTGTGTCCGGGGGAAAGAGCTGCGGGATATGACTGTGGGAGTTATTGGAACCGGCCATATAGGGCAA
GCGGTCGTCAAAAGGCTGCGGGGATTTGGATGCCGTGTGCTAGCCTATGATAACAGCCGAAAAATTGAGGCAGATTATGT
CCAGCTTGATGAGCTTCTAAAAAACAGCGATATTGTTACGCTCCATGTGCCGCTTTGTGCGGATACCCGCCATCTGATCG
GCCAGAGCGAAATCGGAGAGATGAAGCAAGGCGCATTTTTAATCAACACTGGGCGCGGGGCGCTTGTCGATACCGGGTCG
CTGGTGGAGGCACTGGGAAGCGGAAAGCTGGGCGGTGCGGCACTGGATGTGTTGGAGGGCGAGGATCAGTTTGTTTATAC
CGACTGCTCGCAGAAAGTGCTTGACCATCCCTTTTTGTCGCAGCTCCTAAGGATGCCAAATGTGATCATCACACCCCATA
CGGCGTACTACACCGAGCGTGTGCTGCGAGATACCACAGAAAAAACAATCAGGAATTGTCTTAACTTTGAAAGGAGTTTA
CAGCATGAATAAAATAAAAGTCGCAATTATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAG
AAATTGCTGCGAACATTAATACTGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGCGTATGGAAGCTATGC
AAGAAGCCATGTACGGAATGGGAAGCCGATAGTCTCCCCGCCATATTCTCCCCGGATAGGAAAACGCATGGTCTGCTTGT
CATGAAAGAAAGAGAATACGAAACTCGGCGTATTGACGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTG
CGATACAGGGTCTGTTTGAATTGTCTGGTATCCCCTATGTAGGCTGCGATATTCAAAGCTCCGCAGCTTGCATGGACAAA
TCACTGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTCCCCGAATTTCAAATGATTGAAAAAGGTGACAAACCGGA
GGCGAGGACGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACAGTA
CGGAAGAACTAAACGCTGCGATAGAAGCAGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGT
GAGGTCGGCTGCGCGGTCATGGGAAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGTTGAGCCACGGTAT
CTTCCGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAGAATGCGATGATTATCGTTCCAGCAGACATTCCGGTCG
AGGAACGAAATCGGGTGCAAGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCTCGTGTTGATCTT
TTTTTGCAGGAGGATGGCGGCATCGTTCTAAACGAGGTCAATACCCTGCCCGGTTTTACATCGTACAGCCGCTATCCACG
CATGGCGGCTGCCGCAGGAATCACGCTTCCCGCACTAATTGACAGCCTGATTACATTGGCGATAGAGAGGTGACCCGTAT
GGAAAATGGTTTTTTGTTTTTAGATGAAATGTTGCATGGTGTTCGTTGGGATGCCAAGTACGCTACATGGGATAACTTCA
CGGGAAAACCAGTGGATGGGTATGAGGTGAATCGCATCATCGGCACAAAGGCCGTGGCGCTTGCTCTGCGCGAAGCACAA
ATCCATGCGGCACGCCTTGGCTACGGCTTGCTTTTATGGGATGGATATCGGCCAAAATCTGCGGTGGACTGTTTCCTGCG
TTGGGCGGCGCAGCCGGAGGACAACCTCACAAAAGAAAAATATTACCCCAATATTGAGCGAGCCGAGTTGATTACAAAGG
GCTATGTGGCCTCACAATCCAGCCATAGCCGTGGAAGCACAATTGATCTTACGCTCTACCACTTGGATACAGGGGAACTT
GTTTCAATGGGAAGCAACTTCGATTTTATGGACGAACGGTCGCACCATACAGCAAAAGGGATAGGGAATGCAGAGGCACA
AAATCGAAGATGCTTGCGTAAAATCATGGAAAGCAGCGGATTTCAGTCCTATCGCTTTGAATGGTGGCACTATAAGTTGA
TTGATGAGCCATACCCCGATACCTATTTTAATTTTGCTGTTTCATAA