MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANB

The vanB gene encodes a D-ala-D-lac ligase. This gene is part of the VanB operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>>MEG_7345|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaactatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaatgattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtccgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatgggaaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaagagacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccatgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7346|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgaattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaatgattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccctgcccggttttacatcgtacagccgctacccacgtatg
atggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7347|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaatgattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccatgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7348|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaattattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcggtctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccatgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7349|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagtttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaatgattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccctgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggggataa

>>MEG_7350|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagtttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaatgattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccctgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7351|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgacagtctccccgccatactctcccyggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgttcccgaatttcaaattattgataaaggtgacaagccggaggcg
ggtgcgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacggtacgga
agaacttaacgctgcgatagaagcggcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcgggtgtgcggtcatggggaacgaggatgatttgattgtcggcgaagtggatcaaatccggctgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagaaaatgcgatgattacagttcccgcagacattccggtcgagga
acgaaatcgggtgcaggaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgcccgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaatgaggtcaataccatgcccggttttacatcgtacagccgctacccacgtatg
gtggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7352|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
atgaatagaataaaagtcgcaatcatcttcggcggttgctcggaggaacatgatgtgtcggtaaaatccgcaatagaaat
tgctgcgaacattgatacggaaaaattcgatccgcactacatcggaattacaaaaaacggtgtatggaagctatgcaaga
agccatgtacggaatgggaagccgatagtctccccgccatattctccccggataggaaaacgcatgggctgcttgtcatg
aaagaaagcgaatacgaaacacggcgtattgatgtggctttcccggttttgcatggcaaatgcggggaggatggtgcgat
acaggggctgtttgtattgtctggtatcccctatgtgggctgtgatattcaaagctccgcagcttgcatggacaaatcac
tggcctacattcttacaaaaaatgcgggcatcgccgtccccgaatttcaagtgattgaaaaaggtggcaaaccggaggcg
aggacgcttacctaccctgtctttgtgaagccggcacggtcaggttcgtcctttggcgtaaccaaagtaaacagtacgga
agaactaaacgctgcgatagaagcagcaggacaatatgatggaaaaatcttaattgagcaagcgatttcgggctgtgagg
tcggctgcgcggtcatgggaaacgaggatgatttgattgtcggcgaagtggatcaaatccggttgagccacggtatcttc
cgcatccatcaggaaaacgagccggaaaaaggctcagagaatgcgatgattatcgttccagcagacattccggtcgagga
acgaaatcgggtgcaagaaacggcaaagaaagtatatcgggtgcttggatgcagagggcttgctcgtgttgatctttttt
tgcaggaggatggcggcatcgttctaaacgaggtcaataccctccccggttttacatcgtacagccgctacccacgtatg
atggccgccgcaggaatcacgcttcctgcactgattgacagcctgattacattggcgttaaagaggtga

>>MEG_7353|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTAATACTGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGCGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGTCTGTTTGAATTGTCTGGTATCCCCTATGTAGGCTGCGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCTGGTTTTACATCGTACAGCCGCTACCCACGTATG
GTGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>>MEG_7354|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATTATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCATGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
GTGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>>MEG_7355|Drugs|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCCTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
ATGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA