MEGAResFrom MEG, the Microbial Ecology Group

VANB

The vanB gene encodes a D-ala-D-lac ligase. This gene is part of the VanB operon and is a core resistance gene.

References

Other Groups in VanB-type resistance protein

Sequences

Download Sequences

>Gly|VanB|AY655711|1-1029|1029|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATTATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCATGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
GTGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>457|AF310956.2|AF310956|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCCTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
ATGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>Gly|VanA-B|AF192329|28835-29863|1029|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTAATACTGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGCGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGTCTGTTTGAATTGTCTGGTATCCCCTATGTAGGCTGCGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCTGGTTTTACATCGTACAGCCGCTACCCACGTATG
GTGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA

>Gly|VanB|AY655710|1-1029|1029|Glycopeptides|VanB-type_resistance_protein|VANB
ATGAATAGAATAAAAGTCGCAATCATCTTCGGCGGTTGCTCGGAGGAACATGATGTGTCGGTAAAATCCGCAATAGAAAT
TGCTGCGAACATTGATACGGAAAAATTCGATCCGCACTACATCGGAATTACAAAAAACGGTGTATGGAAGCTATGCAAGA
AGCCATGTACGGAATGGGAAGCCGACAGTCTCCCCGCCATACTCTCCCCGGATAGGAAAACGCATGGGCTGCTTGTCATG
AAAGAAAGCGAATACGAAACACGGCGTATTGATGTGGCTTTCCCGGTTTTGCATGGCAAATGCGGGGAGGATGGTGCGAT
ACAGGGGCTGTTTGTATTGTCTGGTATCCCCTATGTGGGCTGTGATATTCAAAGCTCCGCAGCTTGCATGGACAAATCAC
TGGCCTACATTCTTACAAAAAATGCGGGCATCGCCGTTCCCGAATTTCAAATGATTGATAAAGGTGACAAGCCGGAGGCG
GGTGCGCTTACCTACCCTGTCTTTGTGAAGCCGGCACGGTCAGGTTCGTCCTTTGGCGTAACCAAAGTAAACGGTACGGA
AGAACTTAACGCTGCGATAGAAGCGGCAGGACAATATGATGGAAAAATCTTAATTGAGCAAGCGATTTCGGGCTGTGAGG
TCGGGTGTGCGGTCATGGGGAACGAGGATGATTTGATTGTCGGCGAAGTGGATCAAATCCGGCTGAGCCACGGTATCTTC
CGCATCCATCAGGAAAACGAGCCGGAAAAAGGCTCAGAAAATGCGATGATTACAGTTCCCGCAGACATTCCGGTCGAGGA
ACGAAATCGGGTGCAGGAAACGGCAAAGAAAGTATATCGGGTGCTTGGATGCAGAGGGCTTGCCCGTGTTGATCTTTTTT
TGCAGGAGGATGGCGGCATCGTTCTAAATGAGGTCAATACCCTGCCCGGTTTTACATCGTACAGCCGCTACCCACGTATG
ATGGCCGCCGCAGGAATCACGCTTCCTGCACTGATTGACAGCCTGATTACATTGGCGTTAAAGAGGTGA