MEGAResFrom MEG, the Microbial Ecology Group

VANSB

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanB operon and is a regulator gene.

References

Other Groups in VanB-type regulator

Sequences

Download Sequences

>CARD|phgb|U35369|839-2183|ARO:3002932|vanSB|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGTTACTGCTTGTCGGTGTAACGGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGCGATGGAAGCACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATGCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCGAATGCCGATACATCAAATAGTGTTAGGCCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGAAGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCACGACATGCATTCCATGTATATCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCCTCTCATGAGTTAAAAACGCCCATCGCG
GCTGTAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGACCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGACAGGCAGGGCAAAACCATTTCCGAAATACTGGAGCTTGTCAGCCTGAACGATGGGAGAATCGTACCCA
TAGCCGAACCGCTGGACATAGGGCGCACGGTTGCCGAGCTGCTACCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGACAAATTGTCCTGTCCGATCCGAAGCTGATCCAAAAGGCGCTATCCAATGTCAT
ATTGAATGCGGTTCAGAACACGCCCCAGGGAGGTGAGGTACGGATATGGAGTGAGCCTGGGGCTGAAAAATACCGTCTTT
CCGTTTTGAACATGGGCGTTCACATTGATGATACTGCACTTTCAAAGCTGTTCATCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTGGGGCTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAATATGC
GCTGGAAAACACCTCAGATGGCGTTTTGTTCTGGCTGGATTTACCGCCCACATCAACACTATAA

>582|AY655721.2|AY655721|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTAA

>Gly|VanS-B_1_AF192329|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGACAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGTGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTAA

>185|KF823969.1|KF823969|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGCTGGAGGATGAAATCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCAT
GAGCTAAAAACGCCCATCGCGGCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTC
TAAGTATCTGCGCGAATGCATCAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGA
ATGATGGGAGAATCGTACCCATAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACC
TTGGCAGAGGCAAACAACCAGCGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCA
AAAGGCACTATCCAATGTCATATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTG
GTGCTGAAAAATGCCGCCTTTTTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCA
TTCTATCGCATTGATCAGGCGCGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGA
TGCCATGAGCCTCCAGTATGCGCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACAT
TGTAA

>Gly|VanS-B|AY655721|731-2074|1344|Glycopeptides|VanB-type_regulator|VANSB
ATGGAAAGAAAAGGGATTTTCATTAAGGTTTTTTCCTATACGATCATTGTCCTGCTACTGCTTGTCGGTGTAACAGCAAC
ACTGTTTGCACAGCAATTTGTGTCTTATTTCAGAGTGATGGAATTACAGCAAACAGTAAAATCCTATCAGCCATTGGTGG
AACTGATTCAGAATAGCGATAGGCTTGATATTCAAGAGGTGGCAGGGCTGTTTCACTACAATAACCAATCCTTTGAGTTT
TATATTGAAGATAAAGAGGGAAGCGTACTCTATGCCACACCAAATGCCAATACATCAAATAGTTTTAGACCCGACTTTCT
TTATGTGGTACATAGAGATGATAATATTTCGATTGTTGCTCAAAGCAAGGCAGGTGTGGGATTGCTTTATCAAGGGCTGA
CAATTCGGGGAATTGTTATGATTGCGATAATGGTTGTATTCAGCCTTTTATGCGCGTATATCTTTGCGCGGCAAATGACA
ACGCCGATCAAAGCCTTAGCGGACAGTGCGAATAAAATGGCAAACCTGAAAGATGTACCGCCGCCGCTGGAGCGAAAGGA
TGAGCTTGGCGCACTGGCTCATGATATGCATTCCATGTATGTCAGGCTGAAAGAAACCATCGCAAGGCTGGAGGATGAAA
TCGCAAGGGAACATGAGTTGGAGGAAACACAGCGATATTTCTTTGCGGCAGCTTCTCATGAGCTAAAAACGCCCATCGCG
GCTACAAGCGTTCTGTTGGAGGGAATGCTTGAAAATATCGGTGACTACAAAGATCATTCTAAGTATCTGCGCGAATGCAT
CAAAATGATGGATAGGCAGGGCAAAATCATTTCCGAAATACTGGAGCTTGTCAGCCTGAATGATGGGAGAATCGTACCCA
TAGCTGAACCGTTGGACATAGGGCGCACGGTTGCCGAGTTGCTGCCCGATTTTCAAACCTTGGCAGAGGCAAACAACCAG
CGGTTCGTCACAGATATTCCAGCCGGGCAAATTGTCCTGTCCGATCCGAGGCTGCTCCAAAAGGCACTATCCAATGTCAT
ATTGAATGCAGTTCAGAACACGCCGCAGGGAGGCGAGGTACGGATATGGAGTGAGCCTGGTGCTGAAAAATGCCGCCTTT
TTGTTTTGAACATGGGCGTTCACATTGATGATACTGCGCTTCCAAGGCTGTTCACCCCATTCTATCGCATTGATCAGGCG
CGAAGCAGAAAAAGTGGGCGAAGCGGTTTAGGACTTGCCATCGTACAAAAAACGCTGGATGCCATGAGCCTCCAGTATGC
GCTGGAAAACACCTCGGATGGCGTTTTGTTCTGGCTGGATTTACCGCTCACATCAACATTGTA