MEGAResFrom MEG, the Microbial Ecology Group

VANRB

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanB operon and is a regulator gene.

References

Other Groups in VanB-type regulator

Sequences

Download Sequences

>Gly|VanR-B_1_AF192329|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGTAATACAGTAAGGGGGTTTCTGGCTGAGGCAGGATA
TCAGGTGGATGCCTGCACAGATGGAAATGAGGCATACACCAAGTTTTACGAAAACACCTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAACGGGCATGAACTTTTGCGTGAATTTCGTGCGAAAAATGATACTCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCA
GATTTTACTAAAGCGGGTGGAAGCCCTGTTACGGCGCAGCGGTGCGCTGGCAAAGGAAATCCGTGTCGGCAGGCTGACAC
TTCTGCCGGAGGATTTCACGGTACTTTGTGACGGTACAGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACGCATGAAATCATTTTGTCACGTATATGGGGATATGACTTTGAGGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATTTGCGGGCCAAGCTGCCGGAAAATATCATCAAAACCATTCGCGGTGTAGGAT
ACCGATTGGAGGAATCATTATAA

>CARD|phgb|U35369|177-840|ARO:3002921|vanRB|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGCAATACAGTAAGGGCGTTTTTGGCTGAAGCAAGATA
TGAGGTGGATGCCTGCACAGATGGAAACGAAGCACACACCAAGTTCTATGAAAACACCTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAATGGGCATGAACTTCTACGTGAATTTCGGGCGCAAAATGATACCCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCG
GATTTTACTAAAGCGGGTGGAAGCCCTGTTACGGCGCAGCGGTGCGCTGGCAAAGGAATTTCGTGTGGGCAGGCTGACAC
TTCTGCCGGAGGATTTTAGGGTACTTTGTGACGGTACGGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACCCATGAAATCATTTTGTCCCGCATATGGGGATATGACTTTGACGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATCTGCGGGCGAAGCTGCCGGAAAATATCATCAAAACCATCCGCGGTGTAGGTT
ACCGATTGGAGGAATCATTATAA

>184|KF823969.1|KF823969|Glycopeptides|VanB-type_regulator|VANRB
ATGTCGATACGAATTCTACTTGTCGAGGATGATGATCATATCTGTAATACAGTAAGGGCGTTTCTGGCTGAGGCAGGATA
TCAGGTGGATGCCTGCACAGATGGAAATGAGGCATACACCAAGTTTTACGAAAACACTTATCAACTGGTTATTCTTGATA
TTATGCTGCCCGGTATGAACGGGCATGAACTTTTGCGTGAATTTCGTGCGAAAAATGATACTCCCATTCTGATGATGACA
GCCCTGTCGGATGACGAAAACCAAATCCGGGCGTTTGATGCAGAGGCAGACGACTATGTAACAAAGCCATTCAAGATGCA
GATTTTACTAAAGCGGGTGGAAGCCCTGCTGCGGCGCAGCGGTGCGCTGGCAAAGGAAATCCGTGTCGGCAGGCTGACAC
TTCTGCCGGAGGATTTCACGGTACTTTGTGACGGTACAGAGCTGCCCCTGACACGAAAAGAATTTGAAATCCTTTTGCTG
CTGGTGCAGAACAAAGGCAGAACCTTAACGCATGAAATCATTTTGTCACGTATATGGGGATATGACTTTGAGGGTGATGG
CAGCACAGTCCACACTCATATCAAAAATTTGCGGGCCAAGCTGCCGGAAAATATCATCAAAACCATTCGCGGTGTAGGAT
ACCGATTGGAGGAATCATAA