MEGAResFrom MEG, the Microbial Ecology Group

VANYB

The vanY gene encodes a D,D-carboxypeptidase that results in a tetrapeptide that is not recognized by glycopeptide antibiotics. This gene is part of the VanB operon and is an accessory gene.

References

Other Groups in VanB-type accessory protein

Sequences

Download Sequences

>CARD|phgb|U35369|2358-3165|ARO:3002956|vanYB|Glycopeptides|VanB-type_accessory_protein|VANYB
ATGGAAAAAAGCAACTATCATTCCAATGTGAATCATCACAAACGGCATATGAAACAATCTGGGGAAAAACGGGCTTTTCT
ATGGGCGTTCATTATCTCGTTCACAGTCTGCACGCTGTTTTTGGGGTGGAGATTGGTTTCCGTATTGGAGGCAACACAGC
TACCGCCCATCCCTGCAACTCATACAGGCAGCGGGACTGGTGTAGCGGAGAATCCAGAGGAAAACACTCTTGCCACCGCC
AAAGAACAGGGAGATGAACAGGAATGGAGCCTGATTTTAGTGAACAGGCAGAACCCCATCCCCGCCCAGTACGATGTGGA
ACTTGAGCAGCTGTCAAATGGTGAGCGGATAGACATTCGGATTTCTCCCTACCTCCAGGATTTGTTTGATGCCGCAAGAG
CTGATGGAGTTTACCCGATTGTCGCATCCGGATACCGGACAACAGAAAAACAGCAAGAAATCATGGATGAAAAAGTCGCC
GAATACAAGGCGAAAGGCTACACCTCTGCACAGGCTAAAGCGGAAGCAGAAACTTGGGTGGCCGTGCCGGGAACAAGCGA
GCATCAGCTTGGTCTTGCTGTGGATATCAATGCGGATGGAATTCATTCAACCGGCAACGAGGTTTACAGATGGCTGGATG
AAAACAGCTATCGCTTTGGTTTTATTCGCCGCTACCCGCCAGACAAGACAGAGATAACCGGTGTGAGCAACGAGCCGTGG
CATTACCGATATGTCGGCATCGAAGCTGCCACAAAGATATACCACCAAGGGCTTTGCCTTGAGGAATATTTAAACACAGA
AAAATGA