MEGAResFrom MEG, the Microbial Ecology Group

VANWB

The function of the vanW genes is currently unknown. This gene is part of the VanB operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Sequences

Download Sequences

>>MEG_7538|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
atggacagaaaaagattgacacagcgtttcccgttcctgcttccaatgagacgggcgcagagaaaaatgtgcttttatgc
gggaatgagatttgacggctgtcgctatgcgcagacgataggggaaaaatcgctttcccatttgctctttgaaacggatt
gcgcattatacaaccacaataccggatttgacatgatataccaggaaaacaaggtgttcaacttaaagctggcagcaaag
accttaaacggcttattgataagaccgggggaaaccttttctttctggtggctggtacgccatgcggacaaagatacccc
ctataaagacggccttacggtgaccaatggtaaactcaccaccatgtcgggcggcggtatgtgccagatgagcaatttac
tattttggatgttcctgcatacgccatcgacaattatccagcgcagaggtcacgaagtaaaggagtttccagagccaaac
agtgacgagattaaaggggtggatgcaaccatttcagagggctggattgatttaaaagtgcgaaacgataccgactgcac
ctaccaaatatgggtgaccttagatgatgagaaaatcatcggtcaggtgtccgccgacaaagagccccaagcattataca
aaattacaaatggcagtatccagtatgtccgtgaaagtggcgggatttatgaatatgcccaggttaaacggatgcaagtt
gccttaggtaccggggaaataatagattgcaagctgctttatacaaacaaatgcaaaatctgttatcccctcccggaaag
tgtggatattcaggaggagaaccaatga

>>MEG_7539|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
atggacagaaaaagattgacacagcgtttcccgttcctgcttccaatgagacgggcgcagagaaaaatgtgcttttatgc
gggaatgagatttgacggctgtcgctatgcgcagacgataggggaaaaatcgctttcccatttgctctttgaaacggatt
gcgcattatacaaccacaataccggatttgacatgatataccaggaaaacaaggtgttcaacttaaagctggcagcaaag
accttaaacggcttattgataagaccgggggaaaccttttctttctggtggctggtacgccatgcggacaaagatacccc
ctataaagacggccttacggtgaccaatggtaaactcaccaccatgtcgggcggcggtatgtgccagatgatcaatttac
tattttggatgttcctgcatacgccattgacaattatccagcgcagaggtcacgaagtaaaggagtttccagagccaaac
agtgacgagattaaaggggtggatgcaaccatttcagagggctggattgatttaaaagtgcgaaacgataccgactgcac
ctaccaaatatgggtgaccttagatgatgagaaaatcatcggtcaggtgtccgccgacaaagagccccaagcattataca
aaattacaaatggcagtatccagtatgtccgtgaaagtggcgggatttatgaatatgcccaggttaaacggatgcaagtt
gccttaggtaccggggaaataatagattgcaagctgctttatacaaacaaatgcaaaatctgttatcccctcccggaaag
tgtggatattcaggaggagaaccaatga

>>MEG_7540|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTACGCCATGCGGACAAAGATACCCC
CTATAAAGACGGCCTTACGGTGACCAATGGTAAACTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTAC
TATTTTGGATGTTCCTGCATACGCCATTGACAATTATCCAGCGCAGAGGTCACGAAGTAAAGGAGTTTCCAGAGCCAAAC
AGTGACGAGATTAAAGGGGTGGATGCAACCATTTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCAC
CTACCAAATATGGGTGACCTTAGATGATGAGAAAATCATCGGTCAGGTGTCCGCCGACAAAGAGCCCCAAGCATTATACA
AAATTACAAATGGCAGTATCCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCCAGGTTAAACGGATGCAAGTT
GCCTTAGGTACCGGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGTTATCCCCTCCCGGAAAG
TGTGGATATTCAGGAGGAGAACCAATGA

>>MEG_7541|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTACGCCATGCGGCCTATAAAGACGG
CCTTACGGTGACCAATGGTAAACTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTACTATTTTGGATGT
TCCTGCATACGCCATTGACAATTATCCAGCGCAGAGGTCACGAAGTAAAGGAGTTTCCAGAGCCAAACAGTGACGAGATT
AAAGGGGTGGATGCAACCATTTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCACCTACCAAATATG
GGTGACCTTAGATGATGAGAAAATCATCGGTCAGGTGTCCGCCGACAAAGAGCCCCAAGCATTATACAAAATTACAAATG
GCAGTATCCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCCAGGTTAAACGGATGCAAGTTGCCTTAGGTACC
GGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGTTATCCCCTCCCGGAAAGTGTGGATATTCA
GGAGGAGAACCAATGA

>>MEG_7542|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTTCGCCATGCGGACAAAGATACCCC
CTATAAAGACGGCCTTACGGTGGCCAATGGTAAGCTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTAC
TATTTTGGGTGTTCCTGCATACGCCATTGACAATTATCCAGCGCAGCGGTCACGTAGTAAAGGAGTTTCCAGAGCCAAAC
AGTGACGAGATCAAAGGGGTGGATGCAACCATCTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCAC
CTACCAAATATGGGTGACCCTAGATGATGAGAAAATCATCGGTCAGGTGTTCGCCGACAAACAGCCTCAAGCATTATACA
AAATTGCAAACGGCAGTATTCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCAAGGTTGAACGGATGCAAGTT
GCCTTAGGTACCGGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGCTATCCCCTCCCGGAAAG
TGTGGATATTCAGGAGGCGAACCAATGA