Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

VANWB

The function of the vanW genes is currently unknown. This gene is part of the VanB operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Sequences

Download Sequences

>>MEG_7538|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
atggacagaaaaagattgacacagcgtttcccgttcctgcttccaatgagacgggcgcagagaaaaatgtgcttttatgc
gggaatgagatttgacggctgtcgctatgcgcagacgataggggaaaaatcgctttcccatttgctctttgaaacggatt
gcgcattatacaaccacaataccggatttgacatgatataccaggaaaacaaggtgttcaacttaaagctggcagcaaag
accttaaacggcttattgataagaccgggggaaaccttttctttctggtggctggtacgccatgcggacaaagatacccc
ctataaagacggccttacggtgaccaatggtaaactcaccaccatgtcgggcggcggtatgtgccagatgagcaatttac
tattttggatgttcctgcatacgccatcgacaattatccagcgcagaggtcacgaagtaaaggagtttccagagccaaac
agtgacgagattaaaggggtggatgcaaccatttcagagggctggattgatttaaaagtgcgaaacgataccgactgcac
ctaccaaatatgggtgaccttagatgatgagaaaatcatcggtcaggtgtccgccgacaaagagccccaagcattataca
aaattacaaatggcagtatccagtatgtccgtgaaagtggcgggatttatgaatatgcccaggttaaacggatgcaagtt
gccttaggtaccggggaaataatagattgcaagctgctttatacaaacaaatgcaaaatctgttatcccctcccggaaag
tgtggatattcaggaggagaaccaatga

>>MEG_7539|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
atggacagaaaaagattgacacagcgtttcccgttcctgcttccaatgagacgggcgcagagaaaaatgtgcttttatgc
gggaatgagatttgacggctgtcgctatgcgcagacgataggggaaaaatcgctttcccatttgctctttgaaacggatt
gcgcattatacaaccacaataccggatttgacatgatataccaggaaaacaaggtgttcaacttaaagctggcagcaaag
accttaaacggcttattgataagaccgggggaaaccttttctttctggtggctggtacgccatgcggacaaagatacccc
ctataaagacggccttacggtgaccaatggtaaactcaccaccatgtcgggcggcggtatgtgccagatgatcaatttac
tattttggatgttcctgcatacgccattgacaattatccagcgcagaggtcacgaagtaaaggagtttccagagccaaac
agtgacgagattaaaggggtggatgcaaccatttcagagggctggattgatttaaaagtgcgaaacgataccgactgcac
ctaccaaatatgggtgaccttagatgatgagaaaatcatcggtcaggtgtccgccgacaaagagccccaagcattataca
aaattacaaatggcagtatccagtatgtccgtgaaagtggcgggatttatgaatatgcccaggttaaacggatgcaagtt
gccttaggtaccggggaaataatagattgcaagctgctttatacaaacaaatgcaaaatctgttatcccctcccggaaag
tgtggatattcaggaggagaaccaatga

>>MEG_7540|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTACGCCATGCGGACAAAGATACCCC
CTATAAAGACGGCCTTACGGTGACCAATGGTAAACTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTAC
TATTTTGGATGTTCCTGCATACGCCATTGACAATTATCCAGCGCAGAGGTCACGAAGTAAAGGAGTTTCCAGAGCCAAAC
AGTGACGAGATTAAAGGGGTGGATGCAACCATTTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCAC
CTACCAAATATGGGTGACCTTAGATGATGAGAAAATCATCGGTCAGGTGTCCGCCGACAAAGAGCCCCAAGCATTATACA
AAATTACAAATGGCAGTATCCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCCAGGTTAAACGGATGCAAGTT
GCCTTAGGTACCGGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGTTATCCCCTCCCGGAAAG
TGTGGATATTCAGGAGGAGAACCAATGA

>>MEG_7541|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTACGCCATGCGGCCTATAAAGACGG
CCTTACGGTGACCAATGGTAAACTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTACTATTTTGGATGT
TCCTGCATACGCCATTGACAATTATCCAGCGCAGAGGTCACGAAGTAAAGGAGTTTCCAGAGCCAAACAGTGACGAGATT
AAAGGGGTGGATGCAACCATTTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCACCTACCAAATATG
GGTGACCTTAGATGATGAGAAAATCATCGGTCAGGTGTCCGCCGACAAAGAGCCCCAAGCATTATACAAAATTACAAATG
GCAGTATCCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCCAGGTTAAACGGATGCAAGTTGCCTTAGGTACC
GGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGTTATCCCCTCCCGGAAAGTGTGGATATTCA
GGAGGAGAACCAATGA

>>MEG_7542|Drugs|Glycopeptides|VanB-type_accessory_protein|VANWB
ATGGACAGAAAAAGATTGACACAGCGTTTCCCGTTCCTGCTTCCAATGAGACGGGCGCAGAGAAAAATGTGCTTTTATGC
GGGAATGAGATTTGACGGCTGTCGCTATGCGCAGACGATAGGGGAAAAATCGCTTTCCCATTTGCTCTTTGAAACGGATT
GCGCATTATACAACCACAATACCGGATTTGACATGATATACCAGGAAAACAAGGTGTTCAACTTAAAGCTGGCAGCAAAG
ACCTTAAACGGCTTATTGATAAGACCGGGGGAAACCTTTTCTTTCTGGTGGCTGGTTCGCCATGCGGACAAAGATACCCC
CTATAAAGACGGCCTTACGGTGGCCAATGGTAAGCTCACCACCATGTCGGGCGGCGGTATGTGCCAGATGAGCAATTTAC
TATTTTGGGTGTTCCTGCATACGCCATTGACAATTATCCAGCGCAGCGGTCACGTAGTAAAGGAGTTTCCAGAGCCAAAC
AGTGACGAGATCAAAGGGGTGGATGCAACCATCTCAGAGGGCTGGATTGATTTAAAAGTGCGAAACGATACCGACTGCAC
CTACCAAATATGGGTGACCCTAGATGATGAGAAAATCATCGGTCAGGTGTTCGCCGACAAACAGCCTCAAGCATTATACA
AAATTGCAAACGGCAGTATTCAGTATGTCCGTGAAAGTGGCGGGATTTATGAATATGCCAAGGTTGAACGGATGCAAGTT
GCCTTAGGTACCGGGGAAATAATAGATTGCAAGCTGCTTTATACAAACAAATGCAAAATCTGCTATCCCCTCCCGGAAAG
TGTGGATATTCAGGAGGCGAACCAATGA