MEGAResFrom MEG, the Microbial Ecology Group

VANVB

The function of the vanV genes is currently unknown. This gene is part of the VanB operon and is an accessory gene.

References

Other Groups in VanB-type accessory protein

Sequences

Download Sequences

>CARD|phgb|AE016830|2211932-2212277|ARO:3002916|vanV|Glycopeptides|VanB-type_accessory_protein|VANVB
TCAACGAAAACCCGAATCAAACAGTTCCGAGTGAATCAGCAGAGCAAGAACGACTTGTTTCTGCTGGTTCTCTTTTTGCT
CTGCCCGCAGCCGATTCACAATGCTTCGTTTTTCCAAATTCTTAAAGCAGAGATACGGAATGAGAATTGCAAAGCCAATT
AAGATAGGTGTACAAATCACGAGGGGCATACACAAAAACAAAAGCAATTCCTGAACTTTCAGCTTAAAATAAGGCTTTTG
CAGGCAATTCGGTACAGAGTAAAGTTCTGAAAAAATATGGTCAATTTCATTTTTCGCCCGCATAATAAAGCAGATTCCAT
CAGCGCAGAATTTTTCTGTAAACAAG