MEGAResFrom MEG, the Microbial Ecology Group

VANXA

The vanX gene encodes a dipeptidase. This gene is part of the VanA operon and is a core resistance gene.

References

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>957|M97297.1|TRNVAN|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTT
CACCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAA
AAGAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATG
CAATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCG
CAAAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATT
AAGAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA

>Gly|VanX-Ac1|DQ246438|2221-2835|615|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAGACGATTTCGTCTTCGTAGACGAGGTTGTGCCCGGAATCCGCTGGGATGCCAAATACGCCACCTGGGACAACTT
CACCGGCAAACCGGTGGACGGATATCTGGTGAACCGCGTCGTCGGCACGCGGGCTTTCTGCGCGGCGTTGGAAAAGGCGC
GGGAGAAAGCCGAGTCTCTCGGCTTCGGCCTGCTCCTTTGGGACGTCTACCGTCCGCAGCGCGCCGTGGACTGCTTCATG
CGCTGGGCGGAACAGCCCGAAGACGGCCGCAAGAAGCTCAGGCACTACCCGAACATCGACCGGCCCCAGATGTTCGAAAA
GGGCTACGTGGCCACCAAGTCGGGCCACAGCCGGGGCAGCACGGTGGACCTGACGCTGTACCACTTGGACACCGGTGAAC
TCGCCGACATGGGTGGCGACCACGACGTGATGGACGTCGTTTCACACCACGGCGCGGCGGGAATCACGCCGGAACAGGAG
AAGAACCGTGAACACCTCTGCTCCATCATGGTGGACAGCGGGTTCGGCTCCTATGAGTTCGAGTGGTGGCATTACAACCT
GAAGAACGAACCTTATCCGGACACCTATTTCGACTTTCCCATCGCGGGCTCGTGA

>Gly|VanX-Ao1|AF060799|2604-3212|609|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAGGGATGATTTCGTCTTCGTCGACGAGGTCGTCTCCGGAATCCGCTGGGACGCCAAGTACGCCACGTGGGACAACTT
CACCGGCAAGCCGGTGGACGGCTACCTGGTGAACCGCGTCGTCGGAACACGTGCGTTCTGCGCGGCGCTGGAAAAGGCGC
GGGACAAGGCCGCGGAACTCGGCTTCGGGCTGCTTCTCTGGGACGTGTACCGCCCGCAGCGCGCGGTGGACCGCTTCATG
CGCTGGGCGGAAGAGCCCGAAGACGGCCGGAAGAAGGCCAGGCACTACCCGAACATCGAGCGGCCCCAGATGTTCGAACA
GGGCTACGTGGCCACCAAGTCCGGGCACAGCCGGGGCAGCACGGTGGACCTGACGCTCTACCGCCTGGACACCGGTGAGC
TCGCCGACATGGGCGGTGACCACGACCTGATGGACGTCGTCTCGCACCACGGTGCCGACGGGGTGCCGGAAGAGGCCGCG
AAGAACCGCGCGCACCTGTGCGCGATCATGGAAGGTTCCGGCTTCAGCTCCTACGAGTGCGAGTGGTGGCACTACAACCT
GAAGGACGAGCCTTACCCGGACACTTATTTGGATTTTCCCATCGAGTAG

>1420|DQ018710.1|DQ018710|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAATAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCCACATGGGACAATTT
CACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGTAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAA
AAGAACTGGCTGCTACTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAACTGTTTTTTG
CAATGGGCTGCACAGCCGGAAGATGACCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TGGTACCAATGGGGAGCGGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCG
CAAAATCGCAGACGTTTGCGTTCCATCATGGAAGACAGTGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAACCATACCCCAACAGCTATTTTGATTTCCCCGTTAAATAA

>977|DQ018711.1|DQ018711|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGGAAAAGGGATTTGTTTTTTTAGATGAAATATTGCACGGTGTTCGCTGGGACGCCAAATATGCCACATGGGACAATTT
CACAGGGAAACCAGTAGACGGATATGAGGTCAATCGCATAGTGGGAACACATGCCTTAGCCCTTGCGCTGCTGAAGGCGC
AGAAGCAAGCGGCGGCTCTTGGGTACGGTTTGCTGTTATGGGACGGGTATCGGCCCAAACGTGCGGTAGATTGCTTCCTG
CGTTGGTCCGAACAACCGGAAGACAACCTCACAAAAGAAAGATACTATCCGAATATCGAGCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGCGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCGGATTTGATTTTATGGATGAGCGTTCACACCATGCGGCAAAAGGGATTGCAAGCATGGAAGCG
CAAAATCGCAGACGTTTGCGTTCCATCATGGAAAACAGTGGGTTTGAACCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAAACCATACCCCAATAG

>Gly|VanX-Pt2|AY926880|4769-5377|609|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAAAAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCTACATGGGACAATTT
CACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGCAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAA
AAGAACTGGCTGCTGCTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAATTGTTTTGTG
CAATGGGCTGCACAGCCGGAAGATGGCCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCGATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCGGGTTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCG
CAAAATCGCAGATGTTTGCGTTCCATCATGGAAAACAGCGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTCAAATAA

>Gly|VanX-Ao2|HQ679900|2070-2678|609|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAGGGATGATTTCGTCTTCGTCGACGAGGTCGTCTCCGGAATCCGCTGGGACGCCAAGTACGCCACGTGGGACAACTT
CACCGGCAAGCCGGTGGACGGCTACCTGGTGAACCGCGTCGTCGGCACACGTGCGTTCTGCGCGGCGCTGGAAAAGGCGC
GGGACAAGGCCGCGGAACTCGGCTTCGGGCTGCTTCTTTGGGACGTGTACCGCCCGCAGCGCGCGGTGGACCGCTTCATG
CGCTGGGCGGAAGAGCCCGAAGACGGCCGGAAGAAGGCCAGGCACTACCCGAACATCGAGCGGCCCCAGATGTTCGAACA
GGGCTACGTGGCCACCAAGTCCGGGCACAGCCGGGGCAGCACGGTGGACCTGACGCTCTACCGCCTGGACACCGGTGAGC
TCGCCGACATGGGCGGTGACCACGACCTGATGGACGTCGTCTCGCACCACGGTGCCGACGGGGTGCCGGAAGAGGCCGCG
AAGAACCGCGCGCACCTGTGCGCGATCATGGAAGGTTCCGGCTTCAGCTCCTACGAGTGCGAGTGGTGGCACTACAACCT
GAAGGACGAGCCTTACCCGGACACCTATTTCGATTTTCCCATCGAGTAG

>Gly|VanX-Sc|AL939117|55404-56012|609|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGACCGGGGACTTCGCCTTCGTGGACGAGCTGGTGTCCGGAATCCGGTGGGACGCCAAGTACGCCACCTGGGACAACTT
CACCGGCAAACCCGTGGACGGATACCTGGCGAACCGGATCGTCGGCACCAAGGCCCTGTGCGCGGCTCTGGGAAGGGCGC
AAGAACGGGCCGAAGACCTCGGCTTCGGGCTGCTCCTGTGGGACGGCTACCGCCCGCAGCGCGCCGTGGACTGCTTCCTC
CGCTGGTCACAACAGCCGGAGGACGGCCGGACGAAGGCCCGGCACTACCCGAACATCGGCAGGGCCGAGATGTTCGACAG
GGGGTACGTGGCCGCCAGGTCGGGCCACAGCCGAGGTGCCACCGTCGACTTGACGCTGTACCACCTGACCACCGGTGAAC
TCGCGGCCATGGGCGGCGGCCACGACCTCATGGACCCGATATCGCATCACGACGCCCGAGACGTCCCGCGGGCCGAGGCG
GCGAACCGACGGCATCTGCGCTCGATCATGGCCGCCTGCGGTTTCGCCTCATACGCCTGCGAGTGGTGGCACTACACGCT
GAAGGAGGAGCCGCACCCGGACACCTACTTCGACTTTCCCATCGCGTAG

>751|AY618461.1|AY618461|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAGACGATTTCGTCTTCGTAGACGAGGTTGTGCCCGGAATCCGCTGGGATGCCAAATACGCCACCTGGGACAACTT
CACCGGCAAACCGGTGGACGGATATCTGGTGAACCGCGTCGTCGGCACGCGGGCTTTCTGCGCGGCGTTGGAAAAGGCGC
GGGAGAAAGCCGAGTCTCTCGGCTTCGGCCTGCTCCTTTGGGACGTCTACCGTCCGCAGCGCGCCGTGGACTGCTTCATG
CGCTGGGCGGAACAGCCCGAAGACGGCCGCAAGAAGCTCAGGCACTACCCGAACATCGACCGGCCCCAGATGTTCGAAAA
GGGCTACGTGGCCACCAAGTCGGGCCACAGCCGGGGCAGCACGGTGGACCTGACGCTGTACCACTTGGACACCGGTGAAC
TCGCCGACATGGGTGGCGACCACGACGTGATGGACGTCGTTTCACACCACGGCGCGGCGGGAATCACGCCGGAACAGGAG
AAGAACCGTGAACACCTCTGCTCCATCATGGTGGACAGCGGGTTCGGCTCCTATGAGTTCGAGTGGTGGCACTACACCCT
G