MEGAResFrom MEG, the Microbial Ecology Group

VANXA

The vanX gene encodes a dipeptidase. This gene is part of the VanA operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>>MEG_7547|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
atggaaataggatttacttttttagatgaaatagtacacggtgttcgttgggacgctaaatatgccacttgggataattt
caccggaaaaccggttgacggttatgaagtaaatcgcattgtagggacatacgagttggctgaatcgcttttgaaggcaa
aagaactggctgctacccaagggtacggattgcttctatgggacggttaccgtcctaatcgtgctgtaaactgttttatg
caatgggctgcacagccggaaaataacctgacaaaggaaagttattatcccaatattgaccgaactgagatgatttcaaa
aggatacgtggcttcaaaatcaagccatagccgcggcagtgccattgatcttacgctttatcgattagacacgggtgagc
ttgtaccaatggggagccgatttgattttatggatgaacgctctcatcatgcggcaaatggaatatcatgcaatgaagcg
caaaatcgcagacgtttgcgctccatcatggaaaacagtgggtttgaagcatatagcctcgaatggtggcactatgtatt
aagagacgaaccataccccaatagctattttgatttccccgttaaataa

>>MEG_7548|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
atggaaataggatttacttttttagataaaatagtacacggtgttcgttgggacgctaaatatgccacttgggataattt
caccggaaaaccggttgacggttatgaagtaaatcgcattgtagggacatacgagttggccgaagcgcttttgaaggcaa
aggaactggctgctacccaaggttacggattgcttctatgggacggttaccgtccgaagcgtgctgtaaattgttttatg
aaatgggctgcacagccggaaaataacctgacaaaggaaatttattttcccaatattgaccgaaccgagatgatttcaaa
aggatatgtggcttcaaaatcaagccacagccgcggaagtgccattgatcttaccctttatcatctagacacgggtgagc
ttgtaccaatggggagcggatttgattttatggatgaacgctctcatcatgcggcaaaaggaatttcaggtaatgaagtg
caaaatcgcagacgtttgcgctccatcatggaaaacagtgggtttgaagcatatagcttcgaatggtggcactatgtatt
aagagacgaaccatacccaaatagctattttgatttccctattaaataa

>>MEG_7549|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAGACGATTTCGTCTTCGTAGACGAGGTTGTGCCCGGAATCCGCTGGGATGCCAAATACGCCACCTGGGACAACTT
CACCGGCAAACCGGTGGACGGATATCTGGTGAACCGCGTCGTCGGCACGCGGGCTTTCTGCGCGGCGTTGGAAAAGGCGC
GGGAGAAAGCCGAGTCTCTCGGCTTCGGCCTGCTCCTTTGGGACGTCTACCGTCCGCAGCGCGCCGTGGACTGCTTCATG
CGCTGGGCGGAACAGCCCGAAGACGGCCGCAAGAAGCTCAGGCACTACCCGAACATCGACCGGCCCCAGATGTTCGAAAA
GGGCTACGTGGCCACCAAGTCGGGCCACAGCCGGGGCAGCACGGTGGACCTGACGCTGTACCACTTGGACACCGGTGAAC
TCGCCGACATGGGTGGCGACCACGACGTGATGGACGTCGTTTCACACCACGGCGCGGCGGGAATCACGCCGGAACAGGAG
AAGAACCGTGAACACCTCTGCTCCATCATGGTGGACAGCGGGTTCGGCTCCTATGAGTTCGAGTGGTGGCATTACAACCT
GAAGAACGAACCTTATCCGGACACCTATTTCGACTTTCCCATCGCGGGCTCGTGA

>>MEG_7550|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAGACGATTTCGTCTTCGTAGACGAGGTTGTGCCCGGAATCCGCTGGGATGCCAAATACGCCACCTGGGACAACTT
CACCGGCAAACCGGTGGACGGATATCTGGTGAACCGCGTCGTCGGCACGCGGGCTTTCTGCGCGGCGTTGGAAAAGGCGC
GGGAGAAAGCCGAGTCTCTCGGCTTCGGCCTGCTCCTTTGGGACGTCTACCGTCCGCAGCGCGCCGTGGACTGCTTCATG
CGCTGGGCGGAACAGCCCGAAGACGGCCGCAAGAAGCTCAGGCACTACCCGAACATCGACCGGCCCCAGATGTTCGAAAA
GGGCTACGTGGCCACCAAGTCGGGCCACAGCCGGGGCAGCACGGTGGACCTGACGCTGTACCACTTGGACACCGGTGAAC
TCGCCGACATGGGTGGCGACCACGACGTGATGGACGTCGTTTCACACCACGGCGCGGCGGGAATCACGCCGGAACAGGAG
AAGAACCGTGAACACCTCTGCTCCATCATGGTGGACAGCGGGTTCGGCTCCTATGAGTTCGAGTGGTGGCACTACACCCT
G

>>MEG_7551|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAGGGATGATTTCGTCTTCGTCGACGAGGTCGTCTCCGGAATCCGCTGGGACGCCAAGTACGCCACGTGGGACAACTT
CACCGGCAAGCCGGTGGACGGCTACCTGGTGAACCGCGTCGTCGGAACACGTGCGTTCTGCGCGGCGCTGGAAAAGGCGC
GGGACAAGGCCGCGGAACTCGGCTTCGGGCTGCTTCTCTGGGACGTGTACCGCCCGCAGCGCGCGGTGGACCGCTTCATG
CGCTGGGCGGAAGAGCCCGAAGACGGCCGGAAGAAGGCCAGGCACTACCCGAACATCGAGCGGCCCCAGATGTTCGAACA
GGGCTACGTGGCCACCAAGTCCGGGCACAGCCGGGGCAGCACGGTGGACCTGACGCTCTACCGCCTGGACACCGGTGAGC
TCGCCGACATGGGCGGTGACCACGACCTGATGGACGTCGTCTCGCACCACGGTGCCGACGGGGTGCCGGAAGAGGCCGCG
AAGAACCGCGCGCACCTGTGCGCGATCATGGAAGGTTCCGGCTTCAGCTCCTACGAGTGCGAGTGGTGGCACTACAACCT
GAAGGACGAGCCTTACCCGGACACTTATTTGGATTTTCCCATCGAGTAG

>>MEG_7552|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAGGGATGATTTCGTCTTCGTCGACGAGGTCGTCTCCGGAATCCGCTGGGACGCCAAGTACGCCACGTGGGACAACTT
CACCGGCAAGCCGGTGGACGGCTACCTGGTGAACCGCGTCGTCGGCACACGTGCGTTCTGCGCGGCGCTGGAAAAGGCGC
GGGACAAGGCCGCGGAACTCGGCTTCGGGCTGCTTCTTTGGGACGTGTACCGCCCGCAGCGCGCGGTGGACCGCTTCATG
CGCTGGGCGGAAGAGCCCGAAGACGGCCGGAAGAAGGCCAGGCACTACCCGAACATCGAGCGGCCCCAGATGTTCGAACA
GGGCTACGTGGCCACCAAGTCCGGGCACAGCCGGGGCAGCACGGTGGACCTGACGCTCTACCGCCTGGACACCGGTGAGC
TCGCCGACATGGGCGGTGACCACGACCTGATGGACGTCGTCTCGCACCACGGTGCCGACGGGGTGCCGGAAGAGGCCGCG
AAGAACCGCGCGCACCTGTGCGCGATCATGGAAGGTTCCGGCTTCAGCTCCTACGAGTGCGAGTGGTGGCACTACAACCT
GAAGGACGAGCCTTACCCGGACACCTATTTCGATTTTCCCATCGAGTAG

>>MEG_7553|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAATAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCCACATGGGACAATTT
CACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGTAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAA
AAGAACTGGCTGCTACTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAACTGTTTTTTG
CAATGGGCTGCACAGCCGGAAGATGACCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TGGTACCAATGGGGAGCGGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCG
CAAAATCGCAGACGTTTGCGTTCCATCATGGAAGACAGTGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAACCATACCCCAACAGCTATTTTGATTTCCCCGTTAAATAA

>>MEG_7554|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGAAAAAAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCTACATGGGACAATTT
CACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGCAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAA
AAGAACTGGCTGCTGCTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAATTGTTTTGTG
CAATGGGCTGCACAGCCGGAAGATGGCCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCGATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCGGGTTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCG
CAAAATCGCAGATGTTTGCGTTCCATCATGGAAAACAGCGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTCAAATAA

>>MEG_7555|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGACCGGGGACTTCGCCTTCGTGGACGAGCTGGTGTCCGGAATCCGGTGGGACGCCAAGTACGCCACCTGGGACAACTT
CACCGGCAAACCCGTGGACGGATACCTGGCGAACCGGATCGTCGGCACCAAGGCCCTGTGCGCGGCTCTGGGAAGGGCGC
AAGAACGGGCCGAAGACCTCGGCTTCGGGCTGCTCCTGTGGGACGGCTACCGCCCGCAGCGCGCCGTGGACTGCTTCCTC
CGCTGGTCACAACAGCCGGAGGACGGCCGGACGAAGGCCCGGCACTACCCGAACATCGGCAGGGCCGAGATGTTCGACAG
GGGGTACGTGGCCGCCAGGTCGGGCCACAGCCGAGGTGCCACCGTCGACTTGACGCTGTACCACCTGACCACCGGTGAAC
TCGCGGCCATGGGCGGCGGCCACGACCTCATGGACCCGATATCGCATCACGACGCCCGAGACGTCCCGCGGGCCGAGGCG
GCGAACCGACGGCATCTGCGCTCGATCATGGCCGCCTGCGGTTTCGCCTCATACGCCTGCGAGTGGTGGCACTACACGCT
GAAGGAGGAGCCGCACCCGGACACCTACTTCGACTTTCCCATCGCGTAG

>>MEG_7556|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
GTGGTGCTCCGCAGCGCCGCCCGGCCGGAGCTCTGGAAGCGTGCGCCGGTACTCACGGTGTCGGCGCTGTTGCTGGGCCT
CGTGATGATGCTGCACGCGGAGATTCCAAATCGGTTCGGGTCCGTCGGCAGCCTGGTCGAGACCTTCCTGCCGTGGTTCG
GTCTGTTCGTCCCCGTGCTGGCCGCCGGAGCGCTGTGGCGCCGCTCCGCCGCCGCGGTGACCGCGCTGGTGCTGCCGGTC
ACGGTGTGGCTGAGCCTCTTCGGCGGGCTGCTCGGCGACAAGTCAGGCGCGGGCGGCGAATTCACCATGGCCTCCCACAA
CGTCGGCGCCGAGAACCCGGACCCGGCCGGCACCGCCCGCGACCTGGCTGCCTCCGGAGTGGACGTACTGGCGCTGGAGG
AGATCACCGCACAGGACCGGGAGGTGTATGAGAAGGGGCTGGCCAGGGAGTATCCGTACCACACGGTGCAGGGCACGGTC
GGGTTGTGGAGCAAGCTGCCGCTGTCGGGCACGCGGCCGGTCGACATCGCGACGGACTACGGGCCGCTGGCGGACACCAA
ACCGGCCGACGTCACGATGGCCGGCAACCGAGCGCTGCGCACCACGGTGGCCACGGAAAGGGGCCCGCTGGTGGTGTACG
TGGCCCACCTGGGCTCCGTACGGCTCAATCCTCGGGCGGGGTTCTGGACGGACTCCCGCGACCGGAACGCGTGGGCGCTC
GGCGAGGCCCTCGCCGCCGACCGCAGTGAGCGGATCGCGCTGCTCGGCGACCTGAACGGCACCGTGGACGACCGCGCGTT
GGCGGGCATCACCTCGCAGCTGCACTCGGTCCAGGAGGCGGCCGGGAACGGGTTCGGCTTCACCTGGCCGGCGAAGTTCC
CGGTGGCGCGGATCGACCAGATCCTGGTGCGCGGCGTGGAGCCGACCGGTTCGTGGACGCTGCCCGCCACCGGCAGCGAC
CACCTGCCTGTGGCGGCGGGGGTCAGCTGGTGA

>>MEG_7557|Drugs|Glycopeptides|VanA-type_resistance_protein|VANXA
ATGGAAAAGGGATTTGTTTTTTTAGATGAAATATTGCACGGTGTTCGCTGGGACGCCAAATATGCCACATGGGACAATTT
CACAGGGAAACCAGTAGACGGATATGAGGTCAATCGCATAGTGGGAACACATGCCTTAGCCCTTGCGCTGCTGAAGGCGC
AGAAGCAAGCGGCGGCTCTTGGGTACGGTTTGCTGTTATGGGACGGGTATCGGCCCAAACGTGCGGTAGATTGCTTCCTG
CGTTGGTCCGAACAACCGGAAGACAACCTCACAAAAGAAAGATACTATCCGAATATCGAGCGAACCGAGATGGTTTCAAA
AGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGCGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGC
TTGTACCAATGGGGAGCGGATTTGATTTTATGGATGAGCGTTCACACCATGCGGCAAAAGGGATTGCAAGCATGGAAGCG
CAAAATCGCAGACGTTTGCGTTCCATCATGGAAAACAGTGGGTTTGAACCATATAGCTTCGAATGGTGGCACTATGTATT
AAGAAACGAAACCATACCCCAATAG