Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_7398|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA atgaaaaacatcggcattaccgtttatggatgtaatcaggatgaggcagatgcattccgtgctctttcgccacaatttggcattatgccctcgattattaacgccgacgtgtcggaagctaacgccatatccgcccctttaaatcaatgtatcagtgtgggacacaaatccgagatttccgcgtctattcttgttgcgctgaagagaggcggtgtgaaatatatctctacccgaagcatcggctgcaatcatatagatacaattgccgctaagagaatcggcatcactgtcggcaatgtggcgtattcgccggatagcgttgctgattttaccatgatgctgatgcttatggcagtacgcaacacgaaatctatcgtacggtctgtggaaaaacatgatttcaggctggacagcgttcgggggaaggtactgagcgagatgacagttggcgtggtgggaacaggtcagataggcaaagcggttattgagcggctgcgaggatttggatgtaaagtgttggcttatagtcacagcaaaagtatagaggtatactatgttccgtttgatgagttgttgcaaaatagcgatatcgttacccttcatgtgccgctccatacggatacgcactatatcatcggtcacgaacaaatacagagaatgaagaaaggagcgtttattatcaatactagtcgcggtccacttgtagatacctatgcgttggttaaagcattagaaaacggaaaactgggcggtgccgcattggatgtattggagggagaagaagagtttttctactctgattgtacccaaagacccattgataatcaatttttacttaaacttcaaaaaatgcctaacgtgataatcacaccgcatacggcttattataccgagcaagcgttgcgtgataccgttgaaaaaaccattacaaactgtttggattttgaaaggagactggagcatgaatag >>MEG_7399|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA CACATCGACGTGGAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACTCGCCGGACAGCGTCGCGGACTTCACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACGGAAGTCCATGACTACCGGCTGAACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCGCATCGGTGTCGCGGTCATGGACAGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCGCCGATTACGTCCCCCTCGACGATTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTATCACCTCCTCGATCGTCGGAACATCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGAAACCGAGGCCCTCATCTCGGCCCTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGGACAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATCATCAGTCCGCATACCGCCTATTACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATTCGAAAGCGGGAAGTAG >>MEG_7400|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGCGAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGCCGAACATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAGACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAACCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACTTCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTGAACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGACCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACGAATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAACATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGCACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGAACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTACACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCCGAAAGCGGGAAGTAGTATGGGTAGGCTGA >>MEG_7401|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGACCTACAGCGAACCAGCGCGATCAGCTGCCCCCCGCACCGGATCGCCGGCGTCCGCCTCCTCCTCGGCCGTCTTGGCGAGGGGAATCACGATTTATGGTTGCGGATCGGACGAGGCCGCCTTGTTCCGGGAGATGGCTCCTCGTTTCGGCGTAATGCCGACCATTGTGGACGAGCCGGTATCCGAGGCGAATATCGGGCTGGTCTCCGGAAATCGATGCATCAGTATCGGTCACAAGACCAAGGTCACGAATTCCATTCTTCTCGCCCTCGCCGAAGCGGGCGTGGAATACATCTCCACCAGGAGCATCGGCTTCAACCACATCGATGTGGAATACGCGGCGAGCGTCGGTATCACCGTGGGCAATGTCGCCTACTCGCCCGACAGCGTCGCCGACTTCACGCTGATGCTGATGCTGATGGCGGTGCGCGACGCCAAGTCCATCATCCGCCGCACCGAGGTGCACGACTACCGGCTGAACGAGGTGCGCGGGAAAGAGCTGCGCGATCTGACCGTCGGAGTGGTCGGAACAGGGCGGATCGGGGTCGCGGTGCTGGACCGGCTGCGTGGTTTCGGCTGCCGGGTGCTGGCCTACGACACGCTGCTGACCGCCTCGGCCGATTACGTTCCGCTCGACGAATTGCTCCAGCAGAGCGACATCGTGACGCTCCATGTGCCGCTCAACAACGATACCTATCATCTTCTCGACCGGAAGAACATCGAGCGGATGAAGGACGGCGCGTACATCATCAACACCGGACGTGGCCCGCTCATCGAAACCGAAGCCCTCATTTCGGCACTGGAAGACGGCAAACTGGGCGGAGCGGCATTGGACGTCGTCGAAGGAGAGGAAGGCATCTTCTACGCCGACTGCCGGAACAAGCCGCTCGAGAGCGAAACGTTGCTGCGGCTGGAAAAGCTGCCGAACGTGCTCATCAGTCCGCATACCGCCTATTACACGGACCACGCACTGAGTGACACTGTTGAAAACTCCATCATCAATTGTCTCCAATTCGAAAGCGGGAAGTAG >>MEG_7402|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAAAAACATCGGCATTACCGTTTATGGATGCGAGCAGGATGAGGCAGATGCATTCCGTGCCCTTTCGCCGCGCTTTGGCATTATGCCCACGATAATTAACGCCGCCGTGTCAGAAGCCAACGCCATATCAGCCCCCTGCAATCAATGTATCAGCGTGGGACACAAATCCGAGGTTTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGCGTGAAATATATCTCTACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCGCTGTCGGCAATGTGGCGTATTCGCCGGATAGCGTTGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCCAAATCTATTGTGCGCTCTGTGGAAAAACATGATTTCAGGCTGGACAGTGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGGTGGGAACCGGCCATATAGGCAAAGCGGTTATTGAGCGGCTGCGGGGATTTGGATGTCATGTGCTGGCTTATGATCGCAGCCAAAAAATAGAGGCAAACTATGTTCCGTTTGATGCGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCGGCCACGAACAAATAAAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGGCGCGGTCCACTTGTAGATACCGATGCGCTGGTTAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAGGGAGAGGAAGAGTTTTTCTACTCTGATTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGGCTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACAATTAAAAACTGTTTGGATTTTGAAAGGAGCCAGGAGCATGAATAG >>MEG_7403|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCTGTGCCCTTTCGCCGCGTTTTGGCGTTATGCCCTCGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGCGTGGGACATAAATCAGAGGTGTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATCTCCACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCACTGTCGGCAATGTGGCGTATTCGCCGGATAGCGTTGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCTAAATCTATTGTCCGCTCTGTGGAAAAACATGATTTCAGGTTGGACAGTGTCCGTGGCAAGGTACTGAGCGACATGACAGTCGGCGTGGTGGGAACGGGCCATATAGGCAAAGCAGTTATTGAGCGGTTGCGGGGATTTGGATGTAAAGTGCTGGCTTATAGTCGCAGCCAAAGTATAGAGGCAAACTATGTTCCGTTTGATGAGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCAGCCACGAACAAATACAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGCCGCGGTCCACTTGTATATACCAATGAGCTGGTCAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGATTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGGCTTTTTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACCAATATAAACTGTTTGGATTTTGAAAGGAGCCAGGAGCATGAATAG >>MEG_7404|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGCTGCCTACAATGTCCGCCATGACCTACAGCGAACCAGCGCGATCAGAGGCAAGTCGCTCCCGATCGCTGGCGTCCGCGCCCTCCTCGGCCGACGAGGCAAGGGGAATCACGATTTATGGCTGCGGTCAGGACGAGGCCGTCCTCTTCAAGGAGATGGCGCCTCGCTTCGGCATAATGCCGACCATCGCGGAAGCGCCGGTATCCGAAGCCACTATCGAATTGGCGTCAGGTAACCGATGCATCAGTGTCGGTCATAAGACTCCGATCTCGAACTCCATTCTCCTCGCGCTCCGTGAGGCGGGTGTGGAGTACATCTCCACGAGGAGCATCGGGTTCAATCACATCGACGTGAAATACGCCGAGAGCATCGGCATCACCGTCGGTAACGTCGCCTACTCGCCGGACAGCGTCGCGGACTTCACGCTGATGCTGATGCTGATGGTGATACGCGACGCCAAATCCATCATCCGCCGCACGGAAGTCCATGACTACCGGCTGAACGCCGTACGCGGGAAAGAACTGCGCGACCTGACCGTCGGGGTGGTCGGAACAGGGCGCATCGGTGTCGCGGTCATGGACAGGTTGAAGGGCTTCGGCTGCCGGGTGCTGGCCTATGACACGATCCCCAACGCCTCCGCCGATTACGTCCCCCTCGACGATTTGCTGCAGCAGAGCGATATCGTGACACTTCACGTGCCACTCAACACGGACACGTATCACCTCCTCGATCGTCGGAACATCGAGGAGATGAAGGGTGGCGCGTACATCATCAACACCGGGCGCGGTCCACTCATCGAAACCGAGGCCCTCATCTCGGCCCTGGAAAGCGGAAACCTCGGCGGAGCGGCGCTGGACGTCCTCGAAGGAGAGGAAGGGATCTTCTACGCCGACTGCCGGGACAAGGCAATCGACGGCAACAAGCCGTTGCTGCGGCTGCAGGAGCTGTCGAACGTGATCATCAGTCCGCATACCGCCTATTACACGGACCACGCTCTGAGCGACACTGTTGAAAACTCCATCATCAATTGCCTCGAATTCGAAAGCGGGAAGTAG >>MEG_7405|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGTCCTACAGAGACCTGGGTTTGATCGACAGCGAAGTGATCGCGGAGCGACGCGTCCGAGCGCTCGACGATTCGTCACCCTCGGCCGTCCCGACCACTGGGGTCAGAGTTTTCGGATGCGGTCACGACGAAGCCGTTTTGTTCCGCGAGATGGGAACCCGCCTCGGGATAACGCCAAGCATCACCGAGGAAGCGATCAGTGAAACCAACGCTGAACTGGCGCGTGGCAACCGATGCATCAGCGTGAGCCACAAGACGCAGATCGACAATTCCACGCTGCTGGCGCTGAGCCGAGTCGGAGTGGAGTACATCTCCACCAGAAGCGTCGGGTACAACCACATCGACGTGGAATTCGCGGCGAGCATCGGCATCTCGGTCGGCAACGTCGACTACTCGCCCGACAGCGTGGGCGACTACACACTGATGTTGATGCTGATGACCGTACGCCACGCGAAATCAATTGTCCGCCGCGCCGATACGCATGATTACCGGCTGAATGACACGCGCGGCAGGGAGCTGCGCGACTTGACCGTCGGGGTGATCGGAACAGGGCGCATCGGCACAGCAGTCATCGACCGGCTGCAGGGATTTGGCTGCCGCGTGCTGGCACATGACAGCGGGCCTCACGCCTCCGCCGACTACGTTCCGCTCGATGAACTGCTGCGGCAGAGCGACATTGTCACGCTCCACACTCCACTCACCGCGGACACACACCATCTCCTCGATCGCCAACGCATCGACCAGATGAAGCACGGCGCGTACATCGTCAACACGGGTCGCGGACCGCTGCTCGATACCGAGGCCCTCCTCTCCGCATTGGAGAGCGGCCGGTTGGGCGGCGCGGCGCTCGATGTCGTCGAAGGAGAGGAAGGGATCTTCTACGCCGACTGCAGGAACAGGCTCATCGAGAACAAGGCCCTGGTGCGGCTACAGCGCCTGCCGAATGTGCTGATCAGTCCGCACTCCGCCTACTACACAGACCACGCCCTGAACGACACCGTCGAAAACAGCCTCGTCAACTGCCTGAACTTTGAAAGTGGGAGAACAGCATGA >>MEG_7406|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGACCTTCTCCTCGACCTCCTCGGCCCCTCCACCGTCACCGCTCCTCCCGGCAACGAGAATCACGGTTTACGGCTGCGGGCGGGACGAGGCCGCCTTGTTCCGCCGGACGGCACCCCGTTTCGGCGTCGAGGCGACTCTCACGGAGGCCGCCGTATCCGAAGAGAACGCCGAGATGGCGGCCGGAAACCAATGCATCAGCATTGACCACAAGACCCCGGTCACACCTGCCACTCTCCGCGCTCTCCACCGGGCCGGCGTGACGTACATATCCACCCGGAGTATCGGTTACAACCACATCGATGTGACATACGCGGCCGGCGTGGGGATATCCGTCGAGAACGTCACCTACTCCCCCGCCGGCGTGGCCGACTACACCCTGATGCTCATGCTGATGGCGGTGCGCAACGCGAAATCCACCGTCCGCCGCGCGGAGCTGCACGACTACCGGCTGAACGAGATACGCGGTAAGGAGCTGCGCGACCTGACCGTCGGAGTGATCGGGACGGGGCGTATCGGTGCGGCGGTCGTGGACAGGCTGCGGGGTTTTGGCTCCCGGGTACTGGCCTACGGAAAACGGCCCACCATCGCGGCAGATTACGTCTCTCTCGACGAGTTGCTGCGGTCGAGCGACATCGTGTCGCTGCACGTACCGCTGACCCCGGACACGCATCACCTTCTCGATCAAAGCCGTATCCGGCGGATGAAAAGTGGCGCTTTCGTCATCAACACCGGACGCGGCCCGCTCATCGACACCGAAGCGCTGGTACCGGCGTTGGAGAGCGGCAGGTTGAGCGGTGCGGCGCTGGATGTCATCGAGGGCGAGGAAGGGATCTTCTACGCCGACTGCAGAAACAGAACCATCGAAAGCACGTGGCTCCCGCGGCTGCAGAAAATGCCGAACGTACTCATCAGCCCGCACACCGCCTATTACACCGACCACGCCCTGATGGACACGGTCGAGAACTCCATCATCAACTGCCTTAATTTCGGAAGCAGGAAACAGCATGGCTGA >>MEG_7407|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAAAAACATCGGCATTACCATCTATGGATGTGAGCAGGATGAGGCTGATGTGTTCAAGGAACTTTCGCCGCGCTTTGGCGTTATACCTGCCATTACAAGCTCTGCCGTATCAGAAACCAACGTAATGTTAGCCCCTGGAAATCAATGTATCAGCGTGGGGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCGTTGAAGGAATCCGGCGTCAAATATATCTCTACTCGAAGTATTGGTTACAATCACATAGACATGAAGGCCGCGGAAAGTATGGGTATTGCTGTCGGGAACGTGGCATATTCACCGGATAGCGTTGCCGATTATACATTGATGCTGATGCTCATGGCAGTACGCAACGCGAAATCTATTGTGCGCTCTGTGGAAAAACATGATTTCAAGCTGGACAGCGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGCTGGGAACCGGTCATATAGGCAAGAGGGTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAACAAAGAGGCGGCGGCAAATTATGTGTCCCTCAATGAATTGCTGCAAAAAAGCGACATTCTTACCATTCACGTACCGCTTAGCGCGGACACATACCATATGATCGGTCGCGAACAGATTAAAGCAATGAAACAGGGCGCGTTTCTTATCAATACAGCGCGAGGCGGGCTTATAGATACCGATGTGCTGGTTAAAGCATTGGAAAACGGAAAACTGGGCGGCGCCGCATTGGATGTATTGGAGGGAGAGGAAGGACTTTTCTACTTTGATTGCACACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGGATGCCGAACGTGATAATCACGCCGCATACGGCTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAATACAATCAAGAACTGTCTGGAATTTGAGAGGAGAGAGACACTTGTATAG >>MEG_7408|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAAAAACATCGGCATTACCATCTATGGATGTGAGCAGGATGAGGCTGATGTGTTCAAGGAACTTTCGCCGCGCTTTGGCGTTATACCTGCCATTACAAGCTCTGCCGTATCAGAAACCAACGTAATGTTAGCCCCTGGAAATCAATGTATCAGCGTGGGGCACAAATCTGAGATTTCCGAATCCATTCTTCTTGCGTTGAAGGAATCCGGCGTCAAATATATCTCTACTCGAAGTATTGGTTACAATCACATAGACATGAAGGCCGCGGAAAGTATGGGTATTGCTGTCGGGAACGTGGCATATTCACCGGATAGCGTTGCCGATTATACATTGATGCTGATGCTCATGGCAGTACGCAACGCGAAATCTATTGTGCGCTCTGTGGAAAAACATGATTTCAAGCTGGACAGCGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGCTGGGAACCGGTCATATAGGCAAGAGGGTTATTGAGCGACTGCGGGGATTTGGATGTCATGTGCTGGCGTATGGTCACAACAAAGAGGCGGCGGCAAATTATGTGTCCCTCAATGAATTGCTGCAAAAAAGCGACATTCTTACCATTCACGTACCGCTTAGCGCGGACACATACCATATGATCGGTCGCGAACAGATTAAAGCAATGAAACAGGGCGCGTTTCTTATCAATACAGCGCGAGGCGGGCTTATAGATACCGATGTGCTGGTTAAAGCATTGGAAAACGGAAAACTGGGCGGCGCCGCATTGGATGTATTGGAGGGAGAGGAAGGACTTTTCTACTTTGATTGCACACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGGATGCCGAACGTGATAATCACGCCGCATACGGCTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAATACAATCAAGAACTGTCTGGAATTTGAGAGGAGAGAGACACTTGTATAGAGTAAAAATAGCCATCCTGTTTGGGGGCTGCTCAGAGGAACATGATGTGTCGGTAAAATCAGCGAAAGAGATTGCCAACAACATTAACACAGAAAAATATGAGCCAATATACATTGGAATAACCCGATCCGGCGTTTGGAAAATGTGCGAAAAGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAGAATGCACGGGCTGCTTGTCATGCGGGATAAGGGATATCAAATACAGCGTATAGATGCGGCATTTTCGGTTTTGCACGGCAAATCGGGCGAAGACGGCGCCATACAAGGTTTATTTGAATTGTCCGGCATCCCCTATGTAGGCTGTGATATTCAAAGCTCGGCGGTGTGTATGGACAAATCGCTGGCATACATCATTGCGAAAAACGATGGCATAGCTACTCCCGAATTTTGGGTTATTAATAAAGACGATAGGCCGGCGGCAGCTGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTATGGCGTGAAAAAAGTCAATGGCGCGGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTGAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATCTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGCAGAGGAGCGAGGACGGATACGGGATACGGCAAAAAAAATATATAAGGCGCTCGGCTGTAGAGGTCTTGCCCGTGTTGATATGTTTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCCGGTTTCACGTCATACAGCCGTTATCCCCGTATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCGTTAAAGGGGTGATAAGCATGGAAAAGGGATTTGTTTTTTTAGATGAAATATTGCACGGTGTTCGCTGGGACGCCAAATATGCCACATGGGACAATTTCACAGGGAAACCAGTAGACGGATATGAGGTCAATCGCATAGTGGGAACACATGCCTTAGCCCTTGCGCTGCTGAAGGCGCAGAAGCAAGCGGCGGCTCTTGGGTACGGTTTGCTGTTATGGGACGGGTATCGGCCCAAACGTGCGGTAGATTGCTTCCTGCGTTGGTCCGAACAACCGGAAGACAACCTCACAAAAGAAAGATACTATCCGAATATCGAGCGAACCGAGATGGTTTCAAAAGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGCGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTTGTACCAATGGGGAGCGGATTTGATTTTATGGATGAGCGTTCACACCATGCGGCAAAAGGGATTGCAAGCATGGAAGCGCAAAATCGCAGACGTTTGCGTTCCATCATGGAAAACAGTGGGTTTGAACCATATAGCTTCGAATGGTGGCACTATGTATTAAGAAACGAAACCATACCCCAATAG >>MEG_7409|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAAAAACATCGGCATTACCGTTTATGGATGCGAGCAGGATGAGGCAGATGCATTCCGTGCCCTTTCGCCGCGCTTTGGCATTATGCCCACGATAATTAACGCCGCCGTGTCAGAAGCCAACGCCATATCAGCCCCCTGCAATCAATGTATCAGCGTGGGACACAAATCCGAGGTTTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGCGTGAAATATATCTCTACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCGCTGTCGGCAATGTGGCGTATTCGCCGGATAGCGTTGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCCAAATCTATTGTGCGCTCTGTGGAAAAACATGATTTCAGGCTGGACAGTGTCCGTGGCAAGGTACTGCGCGACATGACAGTCGGCGTGGTGGGAACCGGCCATATAGGCAAAGCGGTTATTGAGCGGCTGCGGGGATTTGGATGTCATGTGCTGGCTTATGATCGCAGCCAAAAAATAGAGGCAAACTATGTTCCGTTTGATGCGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCGGCCACGAACAAATAAAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGGCGCGGTCCACTTGTAGATACCGATGCGCTGGTTAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAGGGAGAGGAAGAGTTTTTCTACTCTGATTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGGCTTACTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACAATTAAAAACTGTTTGGATTTTGAAAGGAGCCAGGAGCATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCGGAGGAGCATGACGTTTCGGTTAAATCTGCAAGAGAGATTGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATTCGGTGTTTGGAAAATGTGCGAAAAACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTTAAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGATCAATACAAGGTCTGTTTGAATTGTCCGGTATCCCCTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAATCGCTGACATACACAATTGCGAAAAACGCTGGCATAGCTACTCCTGATTTTTGGGTTATTAATAAAGACGATAAGCCGGCGATAGATGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGGCGCAGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTGAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATCTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGTAGAGGTGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGTAGAGGTCTTTCCCGTGTTGATATGTTTTTACAAGATAACGGCAGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCATACAGCCGTTATCCCCGTATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCATTAAAGGGATGATAAGAATGAAAATAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCCACATGGGACAATTTCACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGTAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAAAAGAACTGGCTGCTACTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAACTGTTTTTTGCAATGGGCTGCACAGCCGGAAGATGACCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAAAGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCAATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTGGTACCAATGGGGAGCGGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCGCAAAATCGCAGACGTTTGCGTTCCATCATGGAAGACAGTGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATTAAGAAACGAACCATACCCCAACAGCTATTTTGATTTCCCCGTTAAATAA >>MEG_7410|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGGCGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGGGACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGTTGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATTTCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCGGTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACCGTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCCACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTGGTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGATTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGGCCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAGCATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGGTAAAATCTGCAATAGAGATAGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAAAACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTTAAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATCCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAATCGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTGGCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGCGGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTGAGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATCTTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGAGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGTTTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGTATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGATAAGCATGGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTTCACCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAAAAGAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATGCAATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAAAGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTTGTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCGCAAAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATTAAGAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA >>MEG_7411|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCCATGCTCTTTCGCCTCGCTTTGGCGTTATGGCAACGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGTGTGGGACATAAATCAGAGATTTCCGCCTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATTTCTACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCTGCTAAGAGAATGGGCATCACTGTCGACAATGTGGCGTACTCGCCGGATAGCGTTGCCGATTATACTATGATGCTAATTCTTATGGCAGTACGCAACGTAAAATCGATTGTGCGCTCTGTGGAAAAACATGATTTCAGGTTGGACAGCGACCGTGGCAAGGTACTCAGCGACATGACAGTTGGTGTGGTGGGAACGGGCCAGATAGGCAAAGCGGTTATTGAGCGGCTGCGAGGATTTGGATGTAAAGTGTTGGCTTATAGTCGCAGCCGAAGTATAGAGGTAAACTATGTACCGTTTGATGAGTTGCTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATACGGATACGCACTATATTATCAGCCACGAACAAATACAGAGAATGAAGCAAGGAGCATTTCTTATCAATACTGGGCGCGGTCCACTTGTAGATACCTATGAGTTGGTTAAAGCATTAGAAAACGGGAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGATTGCACCCAAAAACCAATTGATAATCAATTTTTACTTAAACTTCAAAGAATGCCTAACGTGATAATCACACCGCATACGGCCTATTATACCGAGCAAGCGTTGCGTGATACCGTTGAAAAAACCATTAAAAACTGTTTGGATTTTGAAAGGAGACAGGAGCATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGTTAAAATCTGCAATAGAGATAGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAAAACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTTAAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATCCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAATCGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTGGCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGCGGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTGAGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATCTTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGAGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGTTTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGTATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGATAAGCATGGAAATAGGATTTACTTTTTTAGATGAAATAGTACACGGTGTTCGTTGGGACGCTAAATATGCCACTTGGGATAATTTCACCGGAAAACCGGTTGACGGTTATGAAGTAAATCGCATTGTAGGGACATACGAGTTGGCTGAATCGCTTTTGAAGGCAAAAGAACTGGCTGCTACCCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCTAAGCGTGCTGTAAACTGTTTTATGCAATGGGCTGCACAGCCGGAAAATAACCTGACAAAGGAAAGTTATTATCCCAATATTGACCGAACTGAGATGATTTCAAAAGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGCAGTGCCATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTTGTACCAATGGGGAGCCGATTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAATGGAATATCATGCAATGAAGCGCAAAATCGCAGACGTTTGCGCTCCATCATGGAAAACAGTGGGTTTGAAGCATATAGCCTCGAATGGTGGCACTATGTATTAAGAGACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTTAAATAA >>MEG_7412|Drugs|Glycopeptides|VanA-type_resistance_protein|VANHA ATGAATAACATCGGCATTACTGTTTATGGATGTGAGCAGGATGAGGCAGATGCATTCTGTGCCCTTTCGCCGCGTTTTGGCGTTATGCCCTCGATAATTAACGCCAACGTGTCGGAATCCAACGCCAAATCCGCGCCTTTCAATCAATGTATCAGCGTGGGACATAAATCAGAGGTGTCCGCGTCTATTCTTCTTGCGCTGAAGAGAGCCGGTGTGAAATATATCTCCACCCGAAGCATCGGCTGCAATCATATAGATACAACTGCCGCTAAGAGAATGGGCATCACTGTCGGCAATGTGGCGTATTCGCCGGATAGCGTTGCCGATTATACCATGATGCTGATGCTTATGGCAGTACGCAACGCTAAATCTATTGTCCGCTCTGTGGAAAAACATGATTTCAGGTTGGACAGTGTCCGTGGCAAGGTACTGAGCGACATGACAGTCGGCGTGGTGGGAACGGGCCATATAGGCAAAGCAGTTATTGAGCGGTTGCGGGGATTTGGATGTAAAGTGCTGGCTTATAGTCGCAGCCAAAGTATAGAGGCAAACTATGTTCCGTTTGATGAGTTGTTGCAAAATAGCGATATCGTTACGCTTCATGTGCCGCTCAATGCGGATACGCGCCATATCATCAGCCACGAACAAATACAGAGAATGAAGCAAGGCGCGTTTATTATCAATACTGGCCGCGGTCCACTTGTATATACCAATGAGCTGGTCAAAGCATTAGAAAACGGAAAACTGGGCGGTGCCGCATTGGATGTATTGGAAGGAGAGGAAGAGTTTTTCTACTCTGATTGCTCACAAAAACCAATTGATAATCAATTTTTACTGAAACTTCAAAGAATGCCGAACGTGATAATCACGCCGCATACGGCTTTTTATACCGAACAGGCGTTGCGTGATACCGTTGAAAAAACCAATATAAACTGTTTGGATTTTGAAAGGAGCCAGGAGCATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCCGAGGAGCATGACGTGTCGGTTAAATCTGCAAGAGAGATTGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCCGGTGTTTGGAAAATGTGCGAAAAACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTTAAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGGGATGCACAGCAAGTCAGGTGAAGATGGATCCATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAATCGCTTACATACACAATTGCGAAAAACGCTGGCATAGCTATTCCTGAATTTTGGGTTATTAATAAAGACGATAAGCCGGCGGCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGTCGCAGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTGAGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATCTTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCAGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCAGCAGAGGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGCAGAGGTCTTTCCCGTGTTGATATGTTTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCGTACAGCCGTTATCCCCGTATGATGGCCGCTGCAGGTATAACGCTCCCCGAACTGATTGACCGCCTGATCGTATTCGCGTTACAGGGGTGATAAGAATGAAAAAAGGATTTACTTTTTTAGATGAAATATTACACGGTGTTCGTTGGGACGCTAAATATGCTACATGGGACAATTTCACCGGAAAGCCGGTTGACGGATATGAAGTAAATCGCATTGCAGGAACATACGAGTTGGCCGACGCGCTTTTGAAGGTAAAAGAACTGGCTGCTGCTCAAGGGTACGGATTGCTTCTATGGGACGGTTACCGTCCCCAACGCGCTGTAAATTGTTTTGTGCAATGGGCTGCACAGCCGGAAGATGGCCTGACAAAGGAAAGATATTATCCCAATATTGACCGAACCGAGATGGTTTCAAAAGGATACGTGGCTTCAAAATCAAGCCATAGCCGCGGAAGTGCGATTGATCTTACGCTTTATCGATTAGACACGGGTGAGCTTGTACCAATGGGGAGCGGGTTTGATTTTATGGATGAACGCTCTCATCATGCGGCAAAAGGAATTTCAGGCAATGAAGCGCAAAATCGCAGATGTTTGCGTTCCATCATGGAAAACAGCGGGTTTGAAGCATATAGCTTCGAATGGTGGCACTATGTATTAAGAAACGAACCATACCCCAATAGCTATTTTGATTTCCCCGTCAAATAA