MEGAResFrom MEG, the Microbial Ecology Group

VANA

The vanA gene encodes a D-ala-D-lac ligase. This gene is part of the VanA operon and is a core resistance gene.

References

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>956|M97297.1|TRNVAN|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGGTAAAATCTGCAATAGAGAT
AGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAA
AACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAAT
CGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTG
GCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGC
GGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTG
AGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATC
TTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGA

>976|DQ018711.1|DQ018711|Glycopeptides|VanA-type_resistance_protein|VANA
TTGTATAGAGTAAAAATAGCCATCCTGTTTGGGGGCTGCTCAGAGGAACATGATGTGTCGGTAAAATCAGCGAAAGAGAT
TGCCAACAACATTAACACAGAAAAATATGAGCCAATATACATTGGAATAACCCGATCCGGCGTTTGGAAAATGTGCGAAA
AGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAGAATGCACGGGCTGCTTGTC
ATGCGGGATAAGGGATATCAAATACAGCGTATAGATGCGGCATTTTCGGTTTTGCACGGCAAATCGGGCGAAGACGGCGC
CATACAAGGTTTATTTGAATTGTCCGGCATCCCCTATGTAGGCTGTGATATTCAAAGCTCGGCGGTGTGTATGGACAAAT
CGCTGGCATACATCATTGCGAAAAACGATGGCATAGCTACTCCCGAATTTTGGGTTATTAATAAAGACGATAGGCCGGCG
GCAGCTGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTATGGCGTGAAAAAAGTCAATGGCGC
GGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGCAGA
GGAGCGAGGACGGATACGGGATACGGCAAAAAAAATATATAAGGCGCTCGGCTGTAGAGGTCTTGCCCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCCGGTTTCACGTCATACAGCCGTTATCCCCGT
ATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCGTTAAAGGGGTGA

>Gly|VanHA-Bc|Y15704|23-1054|1032|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAATAAAAGTTGCAATATTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCTGTAAAATCCGCAATAGAAAT
AGCCGCTAACATTGATAAAGAAAAATACGAGACGTTATACATTGGGATTACCAAATCTGGTGTATGGAAAATGTGTGAAA
AACCGTGCGTGGAATGGGAAAACGACAATTGCTGTTCAGCAGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCGACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGATC
AATACAAGGTCTTTTTGAATTGTCCGGTATCCCCTTTGTAGGCTGCGATATTCAAAGCTCAGCGATTTGTATGGACAAAT
CACTGACATACATCGTTGCGGAAAATGCTGGCATAGCTACTCCCGAATTTTGGGTTTTTAATAAAGACGATAAGCCGATG
GCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCTGCGCGTTCAGGCTCATCCTTTGGCGTGAAAAAGGTCAATGGAGC
AGACGAATTGGACGCCGCAATTGAATTGGCTGGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGCTTTTGTTGTTGGCGAGGTAGACCAAATCAGACTGCAGCACGGAATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTGTCGGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAATGCGCTCGGCTGTAGAGGTCTAGCCCGTGTCGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACCCTGCCCGGTTTCACTTCATACAGCCGTTATCCTCGT
ATGATGGCCGCTGTAGGTATTGCATTTCCCGAATTGATTGACCGCTTGATTGTATTAGCGTTAAAGGGGTGA

>Gly|VanA-Pt_3_DQ018710|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCGGAGGAGCATGACGTTTCGGTTAAATCTGCAAGAGAGAT
TGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATTCGGTGTTTGGAAAATGTGCGAAA
AACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTT
AAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGATC
AATACAAGGTCTGTTTGAATTGTCCGGTATCCCCTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAAT
CGCTGACATACACAATTGCGAAAAACGCTGGCATAGCTACTCCTGATTTTTGGGTTATTAATAAAGACGATAAGCCGGCG
ATAGATGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGGCGC
AGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGTAGA
GGTGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGTAGAGGTCTTTCCCGTGTTGATATGT
TTTTACAAGATAACGGCAGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCATACAGCCGTTATCCCCGT
ATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCATTAAAGGGATGA

>Gly|VanA-Ao2|HQ679900|1034-2080|1047|Glycopeptides|VanA-type_resistance_protein|VANA
ATGGGTAGGCTGAAAATCGGAATTCTGTTCGGCGGGCTTTCCGAAGAACATCCTATCTCCATCAAATCTGCGCGTGAGGT
CCAGAAGCACCTCGACCTCGAGAAGTACGAGCCGTACTACATCGGGATCACCCAGAGCGGTTCCTGGATGCTGTGCGACG
GCCCCGCCGAGGACTGGGAGAACGGCGACGTCCGCCCGGCCGTCCTGTCGCCGGACCGCGGTGTGCACGGCCTGCTCGTC
CTGGACGAGGGCAAGTACGAGACGATCGCCCTCGACGTGGTGCTGCCGGTGCTGCACGGCAAGTTCGGCGAAGACGGCGC
GATGCAGGGCCTGCTGGAGATCTCCGGCATCCCCTACGTCGGCTGCGACCTCCCGAGCTCGGTCATGTGCATCGACAAGT
CGCTCACCTATTCGGTCGTCCGCGGCGCGGGGATCGCGACGCCGACCTTCCACATCGTCACGCCGGACAACGACGTCGAC
CCGGACGCGCTGAACTACCCGGTCTTCGTGAAGCCCGCCCGCTCCGGCTCGTCGTTCGGCGTCAGCAAGGTCTCCTCGAA
GGAAGAGCTGCCCGCCGCGCTGGCGGAGGCGCGCCAGTACGACGCGAAGATCCTGATCGAAGAGGCCGTTATCGGCAGTG
AGATCGGCTGCTCGATCCTCGGCGACGGCGAGGACCTGTTCGCGGGTGAGGTCGACCGGGTCGCGCTGACCCACGGCTTC
TTCAAGATCCACCAGGAGAAGAGCCCCGAGACCGGTTCCGAGAACTCGAGCTTCATCGTCCCCGCCGACATCCCGGACGC
CTCGCGTGACCTGGTCCAGGAGACGGCCAAGGTCATCTACCGTGCGCTGGGCTGCAGCGGGCTCGCGCGCGTGGACCTGT
TCCTCAAGGAGGACGGCAGTGTCGTGCTCAACGAGGTCAACACCCTGCCCGGCCTGACCTCGTACAGCCGTTACCCGCGG
ATGATGAACGCCGCCGGCCTCTCGCTCGGCGACGTGATCGACCGCCTGGTGAAGCTGACGCTGGCGGGCGTGACGAATGA
GGGATGA

>Gly|ddlA2_2_AL939117|Glycopeptides|VanA-type_resistance_protein|VANA
TTGGCCAGGTTGAAGGTCGGCATCGTATTCGGGGGCTCTTCCGAAGAACACGCCGTTTCCGTCAAGTCCGCCCAGGAGGT
CGCACGCAACCTCGACACCGAGAAGTACCAGCCGTTCTTCGTGGGGATCACGAAGGACGGCGCCTGGAGACTCTGCGACG
GGCCAGGCCAGGACTGGGAGAACGGCGACTGCCGTCCGGTCGTGCTGTCACCGGACCGGAGCGTGCACGGGCTGCTCGTC
CTGGAGCAGGGGCAGTACCGGTCGGTCCGCCTGGACGTCGTCCTTCCCGTCCTGCACGGCACCCTCGGTGAGGACGGTGC
GACGCAGGGGCTGCTGGAGCTCTCCGGCATTCCGTACGTGGGCTGCGACGTCCAGAGCTCCGCCCTGTGCATGGACAAAT
CCCTTGCGTACGTCGTCGCCAGGAGCGCGGGGATCGCCACGCCGGATTTCTGGACCGTGACAGGAGACGAGACCATCGAT
CCCGGCCGGCTCACGTATCCCGTCTTCGTGAAGCCGGCCCGTTCGGGGTCGTCCTTCGGCGTCAGCAAGGTGTGCCGCCC
GGAAGACCTGGCGACCGCGGTGGAGTCCGCCCGGCGGTACGACACGAAGGTGCTGATCGAAGCGGCCGTCGTCGGCAGCG
AGGTCGGCTGCGCCATCCTGGGGAACGACCCCGACCTGATCGTGGGCGAGGTGGACCGCATCGCGCTCTCCCACGGATTC
TTCCGGATCCACCAGGAGGAGCAGCCCGAGAACGGCTCGGAGAACTCGACGCCGGTCGTTCCCGCCGACATCCCGACGGA
GAAGCGGTCGCTCGTCCAGGAGACCGCGAAGGCCGTGTACCGAGCCCTGGGATGCCGGGGGCTGTCCCGCGTGGACATGT
TCCTCAAGGAGGACGGGGAAGTCGTCCTCAACGAGGTCAACACCCTGCCCGGCATGACCTCGTACAGCCGTTATCCGAGG
ATGATGGCGGCCGCGGGGCTGCCACTGTCCGAGGTGATCGACCGGACGCTGTCCCTGGCGTTGACGGGGAAGCTCCGATG
A

>Gly|VanA-Pt2_4_AY926880|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCCGAGGAGCATGACGTGTCGGTTAAATCTGCAAGAGAGAT
TGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCCGGTGTTTGGAAAATGTGCGAAA
AACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTT
AAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGGGATGCACAGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAAT
CGCTTACATACACAATTGCGAAAAACGCTGGCATAGCTATTCCTGAATTTTGGGTTATTAATAAAGACGATAAGCCGGCG
GCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGTCGC
AGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCAGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGCAGAGGTCTTTCCCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCGTACAGCCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATAACGCTCCCCGAACTGATTGACCGCCTGATCGTATTCGCGTTACAGGGGTGA

>Gly|VanA-A_1_FJ866609|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGTTAAAATCTGCAATAGAGAT
AGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAA
AACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAAT
CGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTG
GCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGC
GGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTG
AGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATC
TTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGA

>349|KF478993.1|KF478993|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAGCAGATTGAAGGTCGGGGTCATCTTCGGAGGGGCTTCCGAAGAACATCCCGTCTCCATCAAGTCGGCGCGAGAGGT
GGCAAGAAGTCTCGACACGGAGAAGTACGAACCGTTCTGGATCGGCATCACGACCGGCGGCGAGTGGAAGCTCTGTGACG
GCCCCGACGCGGATTGGGAGAATCGCAGCGCCCGTCCCGCCGTGCTGTCACCCGATCGAAGTGTGCACGGCCTGCTGGTC
ATGGAGCAGGGGGGCTACGAAACCGTGCGCCTCGACCTCGTCTTCCCCGTACTTCACGGCAAGCTCGGCGAAGACGGCGC
GATCCAAGGCCTGTTGGAGCTCGCCGGCATCCCCTACGTCGGCTGCGACATCCAGGGCTCGGCTGTGTGCATGGACAAGG
CCCTGGCCTACATCGTGGCCAAGAGCGCGGGAATCGCCACGCCGAGCTTTTGGGTTGTCGCGGAGAACGAGAAGGTCGAC
GCCGATCACCTTCGCTATCCGGTCTTCGTGAAGCCGGCCCGTTCGGGTTCATCTTTCGGCGTCAGCAAGGTCACCCGAGA
AGACGAGCTGCCGAACGCGCTGAGCGCGGCGCGACAGTACGACTCGAAGGTCCTGATCGAAGAAGCCGTGGCCGGCAGCG
AGATCGGCTGCGCGGTCATGGGTGAACTATTCGGCCTGATCACTGGGGAGGTGGACCGCGTCGACCTCTCGCACGGATTC
TTCAGGATCCACCAGGAGGACTCACCCGAAACCGGATCGGAGAACTCGACGTTCATCGTTCCCGCCGACATCTCCGACGA
ATCGCGCCGGCTCGTCCAAGAGACCGCCAAGGCCATCTACCGCACCCTGGGCTGCAAGGGACTTGCCCGCGTTGACATGT
TCCTCACCGACGACGGACGGGTGGTCCTCAACGAGGTCAACACCATGCCCGGCATGACGTCGTACAGCCGGTACCCGCGG
ATGATGGCCGCCGCGGGACTGCCGATCTCCGACATGATCGACCGGCTCATCTCGATGACAATGCACGGGAAGAAGCGATG
A

>301|FJ349556.1|FJ349556|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGATTGAAAATAGCCATCCTGTTTGGGGGTTGCTCAGAAGAGCATAATGTATCGGTAAAATCAGCGGCAGAGAT
TGCCAACAACATTGATATAGGAAAATATGAACCAATATACATCGGAATAACCCAATCTGGCGTTTGGAAAACATGCGAAA
AACCATGTATAGATTGGGATAATGAACACTGTCGCTCGGCAGTACTTTCTCCGGATAAAAAAATGCATGGGTTGCTTATT
ATGCAAGATAAAGGATATCAAATACAGCGTATAGATGTAGTCTTTTCAGTGTTGCACGGAAAATCGGGTGAAGACGGCGC
CATACAAGGATTATTTGAATTGTCTGGTATACCTTATGTAGGCTGTGATATTCAAAGTTCGGCGGTTTGTATGGACAAAT
CACTGGCATATATTATTGCGAAAAACGCTGGCATAGCTACTCCTGAATTTCAGGTCATTTATAAAGACGATAAGCCAGCG
GCAGATTCGTTTACCTATCCCGTTTTTGTTAAGCCAGCACGTTCAGGTTCCTCCTATGGTGTGAATAAAGTTAATAGTGC
GGATGAATTGGACTCCGCAATTGACTTGGCAAGACAATATGACAGCAAAATCCTAATTGAGCAGGGTGTTTTAGGTTATG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTTCGACTTGATTGTTGGTGAAGTGGATCAAATCAGACTGCAACACGGTATT
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGTTCTGAAAACGCAACTATAACCGTTCCCGCAGAACTATCGGCAGA
GGAGCGAGAACGGATAAAAGAAGCGGCAAAAAATATATATAAGGCGCTCGGGTGTAGAGGTCTTTCTCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTAAATGAAGTCAATACCATGCCTGGTTTCACGTCATACAGCCGTTATCCACGT
ATGATGGTCTCAGCAGGTATAACAATTCCCGAACTGATTGACCATCTGATTGTATTAGCTGTAAAGGAGTGA

>319|AF155139.2|AF155139|Glycopeptides|VanA-type_resistance_protein|VANA
TTGAATAGATTAAAAATAGCCATCCTGTTTGGGGGCTGTTCAGAGGAACACGATGTGTCGGTAAAATCGGCGAAAGAGAT
TGCCAATAACATTGACACGGAAAAATATGAGCCGATATACATCGGAATCACCCGATCCGGCGTCTGGAAAATGTGCGAAA
AGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAAAATGCACGGGCTGCTTGTT
ATGCGGAATAAAGGATATCAAATCCAACGTATAGACGCGGTATTTTCGGTTTTGCACGGCAAATCGGGTGAAGACGGCGC
CATACAAGGTTTATTTGAATTGTCCAGCATCCCCTATGTAGGCTGTGATGTTCAAAGTTCGGCGGTGTGTATGGACAAAT
CCCTGACATACATTGTGGCCCAAAATGCTGGTTTTGGCACTCCTGAATTTTTGATTTTGAATCATGGCGATATACCGGAT
TCAAATACCTTAACATATCCTGTTTTTGTTAAACCGGCGCGTTCCGGCTCATCTTTCGGCGTGAATAAAGTCAATAACGA
GGACGAATTAGACGCCGCCATTGAAACAGCAAGGCAGTATGACAGTAAAGTCCTGATTGAACAAGCTGTTCCAGGCCTTG
AAGTTGGCTGTGCCGTGTTGGGAAACGGTACCGACTTAATCGTTGGCGAAGTGGACCAAATTTCACTTTCGCATGGTATC
TTTCGTATTCATCAAGAAGATCAACCAGAAAAAGGCTCCGAAAACGCAGTTGTTTTGGTTCCCGCAAACCTGTCGGCAGA
GAAACGCATAAAGATACAAGAGACGGCGAAAGCAATTTATAAGGCGCTCGGCTGTAAAGGTCTTTCTCGTGTTGATATGT
TTTTGCAGGAAAACGGACGTATTATACTGAATGAAGTCAATACGTTGCCGGGATTCACGGCATACAGCCGTTATCCCCGT
ATGATGGCTGCCGCGGGGATGACACTGTCCGGGTTAATTGATCATTGCATCACACTGGCACTCAAAGGATGA