MEGAResFrom MEG, the Microbial Ecology Group

VANA

The vanA gene encodes a D-ala-D-lac ligase. This gene is part of the VanA operon and is a core resistance gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanA-type resistance protein

Sequences

Download Sequences

>>MEG_7336|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGGGTAGGCTGAAAATCGGAATTCTGTTCGGCGGGCTTTCCGAAGAACATCCTATCTCCATCAAATCTGCGCGTGAGGT
CCAGAAGCACCTCGACCTCGAGAAGTACGAGCCGTACTACATCGGGATCACCCAGAGCGGTTCCTGGATGCTGTGCGACG
GCCCCGCCGAGGACTGGGAGAACGGCGACGTCCGCCCGGCCGTCCTGTCGCCGGACCGCGGTGTGCACGGCCTGCTCGTC
CTGGACGAGGGCAAGTACGAGACGATCGCCCTCGACGTGGTGCTGCCGGTGCTGCACGGCAAGTTCGGCGAAGACGGCGC
GATGCAGGGCCTGCTGGAGATCTCCGGCATCCCCTACGTCGGCTGCGACCTCCCGAGCTCGGTCATGTGCATCGACAAGT
CGCTCACCTATTCGGTCGTCCGCGGCGCGGGGATCGCGACGCCGACCTTCCACATCGTCACGCCGGACAACGACGTCGAC
CCGGACGCGCTGAACTACCCGGTCTTCGTGAAGCCCGCCCGCTCCGGCTCGTCGTTCGGCGTCAGCAAGGTCTCCTCGAA
GGAAGAGCTGCCCGCCGCGCTGGCGGAGGCGCGCCAGTACGACGCGAAGATCCTGATCGAAGAGGCCGTTATCGGCAGTG
AGATCGGCTGCTCGATCCTCGGCGACGGCGAGGACCTGTTCGCGGGTGAGGTCGACCGGGTCGCGCTGACCCACGGCTTC
TTCAAGATCCACCAGGAGAAGAGCCCCGAGACCGGTTCCGAGAACTCGAGCTTCATCGTCCCCGCCGACATCCCGGACGC
CTCGCGTGACCTGGTCCAGGAGACGGCCAAGGTCATCTACCGTGCGCTGGGCTGCAGCGGGCTCGCGCGCGTGGACCTGT
TCCTCAAGGAGGACGGCAGTGTCGTGCTCAACGAGGTCAACACCCTGCCCGGCCTGACCTCGTACAGCCGTTACCCGCGG
ATGATGAACGCCGCCGGCCTCTCGCTCGGCGACGTGATCGACCGCCTGGTGAAGCTGACGCTGGCGGGCGTGACGAATGA
GGGATGA

>>MEG_7337|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAATAAAAGTTGCAATATTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCTGTAAAATCCGCAATAGAAAT
AGCCGCTAACATTGATAAAGAAAAATACGAGACGTTATACATTGGGATTACCAAATCTGGTGTATGGAAAATGTGTGAAA
AACCGTGCGTGGAATGGGAAAACGACAATTGCTGTTCAGCAGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCGACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGATC
AATACAAGGTCTTTTTGAATTGTCCGGTATCCCCTTTGTAGGCTGCGATATTCAAAGCTCAGCGATTTGTATGGACAAAT
CACTGACATACATCGTTGCGGAAAATGCTGGCATAGCTACTCCCGAATTTTGGGTTTTTAATAAAGACGATAAGCCGATG
GCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCTGCGCGTTCAGGCTCATCCTTTGGCGTGAAAAAGGTCAATGGAGC
AGACGAATTGGACGCCGCAATTGAATTGGCTGGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGCTTTTGTTGTTGGCGAGGTAGACCAAATCAGACTGCAGCACGGAATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTGTCGGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAATGCGCTCGGCTGTAGAGGTCTAGCCCGTGTCGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACCCTGCCCGGTTTCACTTCATACAGCCGTTATCCTCGT
ATGATGGCCGCTGTAGGTATTGCATTTCCCGAATTGATTGACCGCTTGATTGTATTAGCGTTAAAGGGGTGA

>>MEG_7338|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAGCAGATTGAAGGTCGGGGTCATCTTCGGAGGGGCTTCCGAAGAACATCCCGTCTCCATCAAGTCGGCGCGAGAGGT
GGCAAGAAGTCTCGACACGGAGAAGTACGAACCGTTCTGGATCGGCATCACGACCGGCGGCGAGTGGAAGCTCTGTGACG
GCCCCGACGCGGATTGGGAGAATCGCAGCGCCCGTCCCGCCGTGCTGTCACCCGATCGAAGTGTGCACGGCCTGCTGGTC
ATGGAGCAGGGGGGCTACGAAACCGTGCGCCTCGACCTCGTCTTCCCCGTACTTCACGGCAAGCTCGGCGAAGACGGCGC
GATCCAAGGCCTGTTGGAGCTCGCCGGCATCCCCTACGTCGGCTGCGACATCCAGGGCTCGGCTGTGTGCATGGACAAGG
CCCTGGCCTACATCGTGGCCAAGAGCGCGGGAATCGCCACGCCGAGCTTTTGGGTTGTCGCGGAGAACGAGAAGGTCGAC
GCCGATCACCTTCGCTATCCGGTCTTCGTGAAGCCGGCCCGTTCGGGTTCATCTTTCGGCGTCAGCAAGGTCACCCGAGA
AGACGAGCTGCCGAACGCGCTGAGCGCGGCGCGACAGTACGACTCGAAGGTCCTGATCGAAGAAGCCGTGGCCGGCAGCG
AGATCGGCTGCGCGGTCATGGGTGAACTATTCGGCCTGATCACTGGGGAGGTGGACCGCGTCGACCTCTCGCACGGATTC
TTCAGGATCCACCAGGAGGACTCACCCGAAACCGGATCGGAGAACTCGACGTTCATCGTTCCCGCCGACATCTCCGACGA
ATCGCGCCGGCTCGTCCAAGAGACCGCCAAGGCCATCTACCGCACCCTGGGCTGCAAGGGACTTGCCCGCGTTGACATGT
TCCTCACCGACGACGGACGGGTGGTCCTCAACGAGGTCAACACCATGCCCGGCATGACGTCGTACAGCCGGTACCCGCGG
ATGATGGCCGCCGCGGGACTGCCGATCTCCGACATGATCGACCGGCTCATCTCGATGACAATGCACGGGAAGAAGCGATG
A

>>MEG_7339|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAATAAAAGTTGCAATACTGTTTGGGGGTTGCTCAGAGGAGCATGACGTATCGTTAAAATCTGCAATAGAGAT
AGCCGCTAACATTAATAAAGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCTGGTGTATGGAAAATGTGCGAAA
AACCTTGCGCGGAATGGGAAAACGACAATTGCTATTCAGCTGTACTCTCGCCGGATAAAAAAATGCACGGATTACTTGTT
AAAAAGAACCATGAATATGAAATCAACCATGTTGATGTAGCATTTTCAGCTTTGCATGGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTTTGTAGGCTGCGATATTCAAAGCTCAGCAATTTGTATGGACAAAT
CGTTGACATACATCGTTGCGAAAAATGCTGGGATAGCTACTCCCGCCTTTTGGGTTATTAATAAAGATGATAGGCCGGTG
GCAGCTACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTTCGGTGTGAAAAAAGTCAATAGCGC
GGACGAATTGGACTACGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTCGGGCTGTG
AGGTCGGTTGTGCGGTATTGGGAAACAGTGCCGCGTTAGTTGTTGGCGAGGTGGACCAAATCAGGCTGCAGTACGGAATC
TTTCGTATTCATCAGGAAGTCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCGTTCCCGCAGACCTTTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAAGCGCTCGGCTGTAGAGGTCTAGCCCGTGTGGATATGT
TTTTACAAGATAACGGCCGCATTGTACTGAACGAAGTCAATACTCTGCCCGGTTTCACGTCATACAGTCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATTGCACTTCCCGAACTGATTGACCGCTTGATCGTATTAGCGTTAAAGGGGTGA

>>MEG_7340|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
TTGGCCAGGTTGAAGGTCGGCATCGTATTCGGGGGCTCTTCCGAAGAACACGCCGTTTCCGTCAAGTCCGCCCAGGAGGT
CGCACGCAACCTCGACACCGAGAAGTACCAGCCGTTCTTCGTGGGGATCACGAAGGACGGCGCCTGGAGACTCTGCGACG
GGCCAGGCCAGGACTGGGAGAACGGCGACTGCCGTCCGGTCGTGCTGTCACCGGACCGGAGCGTGCACGGGCTGCTCGTC
CTGGAGCAGGGGCAGTACCGGTCGGTCCGCCTGGACGTCGTCCTTCCCGTCCTGCACGGCACCCTCGGTGAGGACGGTGC
GACGCAGGGGCTGCTGGAGCTCTCCGGCATTCCGTACGTGGGCTGCGACGTCCAGAGCTCCGCCCTGTGCATGGACAAAT
CCCTTGCGTACGTCGTCGCCAGGAGCGCGGGGATCGCCACGCCGGATTTCTGGACCGTGACAGGAGACGAGACCATCGAT
CCCGGCCGGCTCACGTATCCCGTCTTCGTGAAGCCGGCCCGTTCGGGGTCGTCCTTCGGCGTCAGCAAGGTGTGCCGCCC
GGAAGACCTGGCGACCGCGGTGGAGTCCGCCCGGCGGTACGACACGAAGGTGCTGATCGAAGCGGCCGTCGTCGGCAGCG
AGGTCGGCTGCGCCATCCTGGGGAACGACCCCGACCTGATCGTGGGCGAGGTGGACCGCATCGCGCTCTCCCACGGATTC
TTCCGGATCCACCAGGAGGAGCAGCCCGAGAACGGCTCGGAGAACTCGACGCCGGTCGTTCCCGCCGACATCCCGACGGA
GAAGCGGTCGCTCGTCCAGGAGACCGCGAAGGCCGTGTACCGAGCCCTGGGATGCCGGGGGCTGTCCCGCGTGGACATGT
TCCTCAAGGAGGACGGGGAAGTCGTCCTCAACGAGGTCAACACCCTGCCCGGCATGACCTCGTACAGCCGTTATCCGAGG
ATGATGGCGGCCGCGGGGCTGCCACTGTCCGAGGTGATCGACCGGACGCTGTCCCTGGCGTTGACGGGGAAGCTCCGATG
A

>>MEG_7341|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCCGAGGAGCATGACGTGTCGGTTAAATCTGCAAGAGAGAT
TGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATCCGGTGTTTGGAAAATGTGCGAAA
AACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTT
AAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGGGATGCACAGCAAGTCAGGTGAAGATGGATC
CATACAAGGTCTGTTTGAATTGTCCGGTATCCCTTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAAT
CGCTTACATACACAATTGCGAAAAACGCTGGCATAGCTATTCCTGAATTTTGGGTTATTAATAAAGACGATAAGCCGGCG
GCAGATACGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGTCGC
AGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCAGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCAGCAGA
GGAGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGCAGAGGTCTTTCCCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCGTACAGCCGTTATCCCCGT
ATGATGGCCGCTGCAGGTATAACGCTCCCCGAACTGATTGACCGCCTGATCGTATTCGCGTTACAGGGGTGA

>>MEG_7342|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGAATAGAGTAAAAGTTGCAATCCTGTTTGGGGGTTGCTCGGAGGAGCATGACGTTTCGGTTAAATCTGCAAGAGAGAT
TGCCGCTAACATTGACAACGAAAAATACGAGCCGTTATACATTGGAATTACGAAATTCGGTGTTTGGAAAATGTGCGAAA
AACCGTGCGCGGAATGGGAAAACAGCAATTGCTATTCAGCCGTACTCTCGCCGGATAAAAAAATGCACGGTTTGCTTGTT
AAAAAGAACCATGAATATGAAATCCACCACGTTGATGTAGCATTTTCGGTTTTGCACGGCAAGTCGGGTGAAGATGGATC
AATACAAGGTCTGTTTGAATTGTCCGGTATCCCCTATGTGGGCTGCGATATTCAAAGCTCCGCGATTTGTATGGACAAAT
CGCTGACATACACAATTGCGAAAAACGCTGGCATAGCTACTCCTGATTTTTGGGTTATTAATAAAGACGATAAGCCGGCG
ATAGATGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCTTATGGCGTGAAAAAAGTCAATGGCGC
AGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGTAGA
GGTGCGAGGACGGATACAGGAAACGGCAAAAAAAATATATAAGGCGCTCGGTTGTAGAGGTCTTTCCCGTGTTGATATGT
TTTTACAAGATAACGGCAGCATTGTACTTAACGAAGTCAATACCCTGCCTGGTTTCACGTCATACAGCCGTTATCCCCGT
ATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCATTAAAGGGATGA

>>MEG_7343|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
TTGTATAGAGTAAAAATAGCCATCCTGTTTGGGGGCTGCTCAGAGGAACATGATGTGTCGGTAAAATCAGCGAAAGAGAT
TGCCAACAACATTAACACAGAAAAATATGAGCCAATATACATTGGAATAACCCGATCCGGCGTTTGGAAAATGTGCGAAA
AGCCATGCATGGATTGGGACAACGAAAACTGCCGTTCGGCAGTGCTTTCTCCGGACAAAAGAATGCACGGGCTGCTTGTC
ATGCGGGATAAGGGATATCAAATACAGCGTATAGATGCGGCATTTTCGGTTTTGCACGGCAAATCGGGCGAAGACGGCGC
CATACAAGGTTTATTTGAATTGTCCGGCATCCCCTATGTAGGCTGTGATATTCAAAGCTCGGCGGTGTGTATGGACAAAT
CGCTGGCATACATCATTGCGAAAAACGATGGCATAGCTACTCCCGAATTTTGGGTTATTAATAAAGACGATAGGCCGGCG
GCAGCTGCGTTTACCTATCCTGTTTTTGTTAAGCCGGCGCGTTCAGGCTCATCCTATGGCGTGAAAAAAGTCAATGGCGC
GGACGAATTGGACGCCGCAATTGAATCGGCAAGACAATATGACAGCAAAATCTTAATTGAGCAGGCTGTTTTGGGCTGTG
AGGTCGGTTGTGCCGTATTGGGAAACAGTTCCGAGTTGATTGTTGGCGAGGTGGACCAAATCAGGCTGCAGCACGGTATC
TTTCGTATTCATCAGGAAGCCGAGCCGGAAAAAGGCTCTGAAAACGCAGTTATAACCATTCCCGCAGACCTGTCGGCAGA
GGAGCGAGGACGGATACGGGATACGGCAAAAAAAATATATAAGGCGCTCGGCTGTAGAGGTCTTGCCCGTGTTGATATGT
TTTTACAAGATAACGGCCGCATTGTACTTAACGAAGTCAATACCCTGCCCGGTTTCACGTCATACAGCCGTTATCCCCGT
ATGATGGTCGCTGCAGGTATAACGCTTCCCGAACTGATTGACCGCCTGATCGTATTAGCGTTAAAGGGGTGA

>>MEG_7344|Drugs|Glycopeptides|VanA-type_resistance_protein|VANA
ATGACCTTCTCCTCGACCTCCTCGGCCCCTCCACCGTCACCGCTCCTCCCGGCAACGAGAATCACGGTTTACGGCTGCGG
GCGGGACGAGGCCGCCTTGTTCCGCCGGACGGCACCCCGTTTCGGCGTCGAGGCGACTCTCACGGAGGCCGCCGTATCCG
AAGAGAACGCCGAGATGGCGGCCGGAAACCAATGCATCAGCATTGACCACAAGACCCCGGTCACACCTGCCACTCTCCGC
GCTCTCCACCGGGCCGGCGTGACGTACATATCCACCCGGAGTATCGGTTACAACCACATCGATGTGACATACGCGGCCGG
CGTGGGGATATCCGTCGAGAACGTCACCTACTCCCCCGCCGGCGTGGCCGACTACACCCTGATGCTCATGCTGATGGCGG
TGCGCAACGCGAAATCCACCGTCCGCCGCGCGGAGCTGCACGACTACCGGCTGAACGAGATACGCGGTAAGGAGCTGCGC
GACCTGACCGTCGGAGTGATCGGGACGGGGCGTATCGGTGCGGCGGTCGTGGACAGGCTGCGGGGTTTTGGCTCCCGGGT
ACTGGCCTACGGAAAACGGCCCACCATCGCGGCAGATTACGTCTCTCTCGACGAGTTGCTGCGGTCGAGCGACATCGTGT
CGCTGCACGTACCGCTGACCCCGGACACGCATCACCTTCTCGATCAAAGCCGTATCCGGCGGATGAAAAGTGGCGCTTTC
GTCATCAACACCGGACGCGGCCCGCTCATCGACACCGAAGCGCTGGTACCGGCGTTGGAGAGCGGCAGGTTGAGCGGTGC
GGCGCTGGATGTCATCGAGGGCGAGGAAGGGATCTTCTACGCCGACTGCAGAAACAGAACCATCGAAAGCACGTGGCTCC
CGCGGCTGCAGAAAATGCCGAACGTACTCATCAGCCCGCACACCGCCTATTACACCGACCACGCCCTGATGGACACGGTC
GAGAACTCCATCATCAACTGCCTTAATTTCGGAAGCAGGAAACAGCATGGCTGAGTCGGACAAGTTGGCCAGGTTGAAGG
TCGGCATCGTATTCGGGGGCTCTTCCGAAGAACACGCCGTTTCCGTCAAGTCCGCCCAGGAGGTCGCACGCAACCTCGAC
ACCGAGAAGTACCAGCCGTTCTTCGTGGGGATCACGAAGGACGGCGCCTGGAGACTCTGCGACGGGCCAGGCCAGGACTG
GGAGAACGGCGACTGCCGTCCGGTCGTGCTGTCACCGGACCGGAGCGTGCACGGGCTGCTCGTCCTGGAGCAGGGGCAGT
ACCGGTCGGTCCGCCTGGACGTCGTCCTTCCCGTCCTGCACGGCACCCTCGGTGAGGACGGTGCGACGCAGGGGCTGCTG
GAGCTCTCCGGCATTCCGTACGTGGGCTGCGACGTCCAGAGCTCCGCCCTGTGCATGGACAAATCCCTTGCGTACGTCGT
CGCCAGGAGCGCGGGGATCGCCACGCCGGATTTCTGGACCGTGACAGGAGACGAGACCATCGATCCCGGCCGGCTCACGT
ATCCCGTCTTCGTGAAGCCGGCCCGTTCGGGGTCGTCCTTCGGCGTCAGCAAGGTGTGCCGCCCGGAAGACCTGGCGACC
GCGGTGGAGTCCGCCCGGCGGTACGACACGAAGGTGCTGATCGAAGCGGCCGTCGTCGGCAGCGAGGTCGGCTGCGCCAT
CCTGGGGAACGACCCCGACCTGATCGTGGGCGAGGTGGACCGCATCGCGCTCTCCCACGGATTCTTCCGGATCCACCAGG
AGGAGCAGCCCGAGAACGGCTCGGAGAACTCGACGCCGGTCGTTCCCGCCGACATCCCGACGGAGAAGCGGTCGCTCGTC
CAGGAGACCGCGAAGGCCGTGTACCGAGCCCTGGGATGCCGGGGGCTGTCCCGCGTGGACATGTTCCTCAAGGAGGACGG
GGAAGTCGTCCTCAACGAGGTCAACACCCTGCCCGGCATGACCTCGTACAGCCGTTATCCGAGGATGATGGCGGCCGCGG
GGCTGCCACTGTCCGAGGTGATCGACCGGACGCTGTCCCTGGCGTTGACGGGGAAGCTCCGATGACCGGGGACTTCGCCT
TCGTGGACGAGCTGGTGTCCGGAATCCGGTGGGACGCCAAGTACGCCACCTGGGACAACTTCACCGGCAAACCCGTGGAC
GGATACCTGGCGAACCGGATCGTCGGCACCAAGGCCCTGTGCGCGGCTCTGGGAAGGGCGCAAGAACGGGCCGAAGACCT
CGGCTTCGGGCTGCTCCTGTGGGACGGCTACCGCCCGCAGCGCGCCGTGGACTGCTTCCTCCGCTGGTCACAACAGCCGG
AGGACGGCCGGACGAAGGCCCGGCACTACCCGAACATCGGCAGGGCCGAGATGTTCGACAGGGGGTACGTGGCCGCCAGG
TCGGGCCACAGCCGAGGTGCCACCGTCGACTTGACGCTGTACCACCTGACCACCGGTGAACTCGCGGCCATGGGCGGCGG
CCACGACCTCATGGACCCGATATCGCATCACGACGCCCGAGACGTCCCGCGGGCCGAGGCGGCGAACCGACGGCATCTGC
GCTCGATCATGGCCGCCTGCGGTTTCGCCTCATACGCCTGCGAGTGGTGGCACTACACGCTGAAGGAGGAGCCGCACCCG
GACACCTACTTCGACTTTCCCATCGCGTAG