MEGAResFrom MEG, the Microbial Ecology Group

VANSA

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanA operon and is a regulator gene.

References

Other Groups in VanA-type regulator

Sequences

Download Sequences

>Gly|VanS-Pt2|DQ018710|3721-4881|1161|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATATCGTTGT
GATTGTTATGGCAGCAGTTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCGTACGTT
TTTTGGAAAACAGTTATCACTTAGAGCGTCAGGACGCGATGAAAATATATCAGTATACTATACGGAACAATATAGAAATC
TTTATTTATGTGGCGATTGCCATTAGTATTCTTATTCTATGCCGCGTCATGCTTTCAAAATTTGCAAAATACTTTGACGA
GATAAATACCGGCATTGATATACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGAGTTCATGGAAC
AGAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTT
GTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCGTTATCGGTTATCTGAGCCTGCTTGACGAGGCGCCAGA
CATGCCGGTAGAGCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGCCTCGAACAGCTAATCGACGAGT
TTTTTGAGATTACACGGTATAACCTCCAAACGATTACGCTCACGAAAAAGCACATAGACCTATACTATATGCTGGTGCAG
ATGACCGATGAATTTTATCCCCAGCTTGCCGCGAATGGAAAACAGGCGGTTATCCATGCTTCCGAGGATTTGACCGTATC
CGGCGACCCCGATAAGCTGGCGAGGGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGCGAGGACAACAGCGTCA
TTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCCGGAAGCATCCCCAAAGATAAGCTC
GCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCCCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATTGGCGAT
TGCAAAAGAAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACGACGTTCACGGTAGAGC
TTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA

>954|M97297.1|TRNVAN|Glycopeptides|VanA-type_regulator|VANSA
TTGGTTATAAAATTGAAAAATAAAAAAAACGACTATTCCAAACTAGAACGAAAACTTTACATGTATATCGTTGCAATTGT
TGTGGTAGCAATTGTATTCGTGTTGTATATTCGTTCAATGATCCGAGGGAAACTTGGGGATTGGATCTTAAGTATTTTGG
AAAACAAATATGACTTAAATCACCTGGACGCGATGAAATTATATCAATATTCCATACGGAACAATATAGATATCTTTATT
TATGTGGCGATTGTCATTAGTATTCTTATTCTATGTCGCGTCATGCTTTCAAAATTCGCAAAATACTTTGACGAGATAAA
TACCGGCATTGATGTACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGATGTTATGGAACAAAAGC
TCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTTGTTATG
TACTTGGCGCACGATATTAAAACGCCCCTTACATCCATTATCGGTTATTTGAGCCTGCTTGACGAGGCTCCAGACATGCC
GGTAGATCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGACTCGAACAGCTAATCGACGAGTTTTTTG
AGATTACACGGTATAACCTACAAACGATAACGCTAACAAAAACGCACATAGACCTATACTATATGCTGGTGCAGATGACC
GATGAATTTTATCCTCAGCTTTCCGCACATGGAAAACAGGCGGTTATTCACGCCCCCGAGGATCTGACCGTGTCCGGCGA
CCCTGATAAACTCGCGAGAGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGTGAGGATAACAGCATCATTGACA
TTACCGCGGGCCTCTCCGGGGATGTGGTGTCAATCGAATTCAAGAACACTGGAAGCATCCCAAAAGATAAGCTAGCTGCC
ATATTTGAAAAGTTCTATAGGCTGGACAATGCTCGTTCTTCCGATACGGGTGGCGCGGGACTTGGATTGGCGATTGCAAA
AGAAATTATTGTTCAGCATGGAGGGCAGATTTACGCGGAAAGCAATGATAACTATACGACGTTTAGGGTAGAGCTTCCAG
CGATGCCAGACTTGGTTGATAAAAGGAGGTCCTAA

>Gly|VanS-Pt|AY926880|1391-2551|1461|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATATCGTTGT
GATTGTTATGGCAGCAGTTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCGTACGTT
TTTTGGAAAACAGTTATCACTTAGATCGCCTGGACGCGATGAAATTATATCAATATTCCATACGGAACAATATAGATATC
TTTATTTATGTGGCGATTGTCATTAGTATTCTTATTCTATGTCGCGTCATGCTTTCAAAATTCGCAAAATACTTTGACGA
GATAAATACCGGCATTGATGTACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGATGTTATGGAAC
AAAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTT
GTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCATTATCGGTTATTTGAGCCTGCTTGACGAGGCTCCAGA
CATGCCGGTAGATCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGACTCGAACAGCTAATCGACGAGT
TTTTTGAGATTACACGGTATAACCTACAAACGATAACGCTAACAAAAACGCACATAGACCTATACTATATGCTGGTGCAG
ATGACCGATGAATTTTATCCTCAGCTTTCCGCACATGGAAAACAGGCGGTTATTCACGCCCCCGAGGATCTGACCGTGTC
CGGCGACCCTGATAAACTCGCGAGAGTCTTTAACAACATTTTGGAAAACGCCGCTGCATACAGCGAGGACAACAGCGTCA
TTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCCGGAAGCATCCCCAAAGATAAGCTC
GCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCTCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATTGGCGAT
TGCAAAAGAAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACTACGTTCACGGTAGAGC
TTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA

>Gly|VanS-Pt_5_DQ018711|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATAT
CGTTGTGATTGTTATGGCAGCAGCTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCG
TACGTTTTTTGGAAAACAGTTATCACTTAGAGCGTCAGGACGCGATGATAATATATCAGTATACTATACGGAACAATATA
GAAATTTTTATTTATGTGGCGATTGCCATTAGTATTCTTATTCTATGCCGCGTCATGCTTTCAAAATTTGCGAAATACTT
TGACGAGATAAATACCGGCATTGATATACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGAGTTCA
TGGAACAGAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTTGCAGAACAAAGAAAAAAT
GACGTTGTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCGTTATCGGTTATCTGAGCCTGCTTGACGAGGC
GCCAGACATGCCGGTAGAGCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGCCTCGAACAGCTAATCG
ATGAGTTTTTTGAGATTACGCGGTATAACCTCCAAACGATTACGCTCACGAAAAAGCACATAGACCTATACTATATGCTG
GTGCAGATGGCCGATGAATTTTATCCGCAGCTTGCCGCGAATGGAAAACAGGCGGTTATCCATGCTTCCGAGGATTTGAC
CGTAACCGGCGACTCCGATAAGCTGGCGAGGGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGCGAGGACAACA
GCGTCATTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCAGGAAGCATCCCCAAAGAT
AAGCTCGCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCCCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATT
GGCGATTGCAAAAGGAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACGACGTTTACGG
TAGAGCTTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA