MEGAResFrom MEG, the Microbial Ecology Group

VANSA

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanA operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanA-type regulator

Sequences

Download Sequences

>>MEG_7486|Drugs|Glycopeptides|VanA-type_regulator|VANSA
ttgaaaaataaaaataaaaaaaacgactattccaaactagaacgaaaactctatatgtatattgtcgcgattgttgtggt
agcagttatattcgtgttgtatattcgttcaatgatccgagggaagcttggggagtggatcgtacgttttttggaaaacg
aatatggcttaaatcagctggacgcgatgaaattatatcattattccatacggaacaatatagaaatctttatttatgtg
gcgatcgccattagtattcttattctatgccgcgtcatgctttcaaaatttgcaaaatactttgacgagatcaataccgg
cattgatgtacttattcagaacgaagataaacaaattgagctttctgcggaaatggatgttatggaacacaagctcaaca
cattaaaacggactctggaaaagcgagagcaggatgcaaagctggccgaacaaagaaaaaatgatgttgttatgtacttg
gcgcatgatattaaaacgccccttacatccattatcggttatttgagcctgcttgacgaggcgccagacatgccggtaga
tcaaaaggcaaagtatgtgcatatcacgttggacaaagcgtatcgccttgaacaactaatcgacgagttttttgagatta
cacggtataacctccaaacgattactctcacaaaaacgcacatagacctatactatatgctggtgcagatgaccgatgaa
ttttatccccagctttccgcacatggaaaacaggcgattatccacgcctccgtagatctgaccgtatccggtgacccaga
taaacttgcgagagtctttaacaacattttgaaaaacgccgctgcgtacagtgaggacaacagcatcattgacattaccg
cgggcctatccgggaatatggtgtcaatcgtattcaagaacacaggaagcataccaaaagataagcttgctgccatattt
gaaaagttctataggttggacaatgctcgttcttccgaaacaggcggcgcgggacttggattggcgatcgcaaaagaaat
cattgtcctgcatggtgggcagatatatgcggaaagtaatgatcactacacgacatttacggtagagcttccagcctttc
cagacttggttgataaaagagattcctaa

>>MEG_7487|Drugs|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATATCGTTGT
GATTGTTATGGCAGCAGTTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCGTACGTT
TTTTGGAAAACAGTTATCACTTAGATCGCCTGGACGCGATGAAATTATATCAATATTCCATACGGAACAATATAGATATC
TTTATTTATGTGGCGATTGTCATTAGTATTCTTATTCTATGTCGCGTCATGCTTTCAAAATTCGCAAAATACTTTGACGA
GATAAATACCGGCATTGATGTACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGATGTTATGGAAC
AAAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTT
GTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCATTATCGGTTATTTGAGCCTGCTTGACGAGGCTCCAGA
CATGCCGGTAGATCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGACTCGAACAGCTAATCGACGAGT
TTTTTGAGATTACACGGTATAACCTACAAACGATAACGCTAACAAAAACGCACATAGACCTATACTATATGCTGGTGCAG
ATGACCGATGAATTTTATCCTCAGCTTTCCGCACATGGAAAACAGGCGGTTATTCACGCCCCCGAGGATCTGACCGTGTC
CGGCGACCCTGATAAACTCGCGAGAGTCTTTAACAACATTTTGGAAAACGCCGCTGCATACAGCGAGGACAACAGCGTCA
TTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCCGGAAGCATCCCCAAAGATAAGCTC
GCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCTCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATTGGCGAT
TGCAAAAGAAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACTACGTTCACGGTAGAGC
TTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA

>>MEG_7488|Drugs|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATATCGTTGT
GATTGTTATGGCAGCAGTTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCGTACGTT
TTTTGGAAAACAGTTATCACTTAGAGCGTCAGGACGCGATGAAAATATATCAGTATACTATACGGAACAATATAGAAATC
TTTATTTATGTGGCGATTGCCATTAGTATTCTTATTCTATGCCGCGTCATGCTTTCAAAATTTGCAAAATACTTTGACGA
GATAAATACCGGCATTGATATACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGAGTTCATGGAAC
AGAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTGGCCGAACAAAGAAAAAATGACGTT
GTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCGTTATCGGTTATCTGAGCCTGCTTGACGAGGCGCCAGA
CATGCCGGTAGAGCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGCCTCGAACAGCTAATCGACGAGT
TTTTTGAGATTACACGGTATAACCTCCAAACGATTACGCTCACGAAAAAGCACATAGACCTATACTATATGCTGGTGCAG
ATGACCGATGAATTTTATCCCCAGCTTGCCGCGAATGGAAAACAGGCGGTTATCCATGCTTCCGAGGATTTGACCGTATC
CGGCGACCCCGATAAGCTGGCGAGGGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGCGAGGACAACAGCGTCA
TTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCCGGAAGCATCCCCAAAGATAAGCTC
GCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCCCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATTGGCGAT
TGCAAAAGAAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACGACGTTCACGGTAGAGC
TTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA

>>MEG_7489|Drugs|Glycopeptides|VanA-type_regulator|VANSA
TTGGCTATAAAATTGAAAAATAAAAATAAGAATAAAAAAACCGATTATTCCAAACTAAAACGAAAACTCTACCAGTATAT
CGTTGTGATTGTTATGGCAGCAGCTGTATTCGTGTTGTTTTTGCGTTTATTTATCAAGGGGACACTTGGGGAGTGGATCG
TACGTTTTTTGGAAAACAGTTATCACTTAGAGCGTCAGGACGCGATGATAATATATCAGTATACTATACGGAACAATATA
GAAATTTTTATTTATGTGGCGATTGCCATTAGTATTCTTATTCTATGCCGCGTCATGCTTTCAAAATTTGCGAAATACTT
TGACGAGATAAATACCGGCATTGATATACTTATTCAGAACGAAGATAAACAAATTGAGCTTTCTGCGGAAATGGAGTTCA
TGGAACAGAAGCTCAACACATTAAAACGGACTCTGGAAAAGCGAGAGCAGGATGCAAAGCTTGCAGAACAAAGAAAAAAT
GACGTTGTTATGTACTTGGCGCACGATATTAAAACGCCCCTTACATCCGTTATCGGTTATCTGAGCCTGCTTGACGAGGC
GCCAGACATGCCGGTAGAGCAAAAGGCAAAGTATGTGCATATCACGTTGGACAAAGCGTATCGCCTCGAACAGCTAATCG
ATGAGTTTTTTGAGATTACGCGGTATAACCTCCAAACGATTACGCTCACGAAAAAGCACATAGACCTATACTATATGCTG
GTGCAGATGGCCGATGAATTTTATCCGCAGCTTGCCGCGAATGGAAAACAGGCGGTTATCCATGCTTCCGAGGATTTGAC
CGTAACCGGCGACTCCGATAAGCTGGCGAGGGTCTTTAACAACATTTTGAAAAACGCCGCTGCATACAGCGAGGACAACA
GCGTCATTGACATTACGGCGGGCCTCTCCGGGGATGTGGTGTCCATCGTTTTCAAGAACGCAGGAAGCATCCCCAAAGAT
AAGCTCGCTGCCATATTTGAAAAGTTTTACAGGCTGGACGATGCCCGTTCTTCCGATACGGGCGGCGCGGGACTTGGATT
GGCGATTGCAAAAGGAATCATTGTTCAGCATGGCGGGCAGATTTACGCGGAAAGCAATGATAACTACACGACGTTTACGG
TAGAGCTTCCGGCCTTGCCAGACTTGGTTGATAAAAGGAGTTCCTAA