MEGAResFrom MEG, the Microbial Ecology Group

VANRA

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanA operon and is a regulator gene.

References

Other Groups in VanA-type regulator

Sequences

Download Sequences

>Gly|VanR-Pt|DQ018711|1-696|696|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTGTTGTGGACGATGAACATGAAATTGCCGATTTGGTTGAGCTATACTTGAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCGTTGGAATGTATAGACAAGACCGATCTTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCGCAAGCGGCCTCGCTATCTGCCAAAAAATAAGGGACAAGCACACCTATCCAATTATCACGCTGACC
GCGAAAGATACGGAGGTAGATAAAATTACAGGGCTAACAATCGGCGCGGACGATTATATAACGAAGCCCTTTCGCCCGCT
GGAGTTAATTGCGCGGGTCAAGGCGCAGTTGCGCCGATACAAAAAATACAATGGAGTAACGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATATAAACACGCATGAGTGTTTTCTGAACGAGAAGCAGTTATCCCTCACTCCCACC
GAGTTTTCAATCCTGCGCATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCAGTTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATCTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAGTATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA

>Gly|VanR-A|M97297|3976-4671|696|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTATTGTGGATGATGAACATGAAATTGCCGATTTGGTTGAATTATACTTAAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCATTGGAATGTATAGACAAGTCTGAGATTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCACAAGCGGCCTTACTATCTGTCAAAAAATAAGGGACAAGCACACCTATCCGATTATCATGCTGACC
GGGAAAGATACAGAGGTAGATAAAATTACAGGGTTAACAATCGGCGCGGATGATTATATAACGAAGCCCTTTCGCCCACT
GGAGTTAATTGCTCGGGTAAAGGCCCAGTTGCGCCGATACAAAAAATTCAGTGGAGTAAAGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATGTTAACACCCATGAGTGTTATCTGAACGAGAAGCAGTTATCCCTTACTCCCACC
GAGTTTTCAATACTGCGAATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCTGCTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATTTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAATATATAAAAACGGTATGGGGGGTTGGTTATAAAATTGAAAAATAA

>1416|DQ018710.1|DQ018710|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTGTTGTGGACGATGAACATGAAATTGCCGATTTGGTTGAGCTATACTTGAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCGTTGGAATGTATAGACAAGACCGATCTTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCGCAAGCGGCCTCGCTATCTGCCAAAAGATAAGGGACAAGCACACCTATCCAATTATCATGCTGACC
GCGAAAGATACGGAGGTAGATAAAATTACAGGGCTAACAATCGGCGCGGACGATTATATAACGAAGTCCTTTCGCCCGCT
GGAGTTAATTGCGAGGGTCAAGGCGCAGTTGCGCCGATACAAAAAATACAGTGGAGTAGCGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATATAAACACGCATGAGTGTTTTCTGAACGAGAAGCAGTTATCACTCACTCCCACC
GAGTTTTCAATCCTGCGCATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCAGTTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATCTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAGTATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA

>Gly|VanR-Pt2|AY926880|718-1413|696|Glycopeptides|VanA-type_regulator|VANRA
ATGAGCGATAAAATACTTATTGTGGATGATGAACATGAAATTGCCGATTTGGTTGAATTATACTTAAAAAACGAGAATTA
TACGGTTTTCAAATACTATACCGCCAAAGAAGCATTGGAATGTATAGACAAGTCTGAGATTGACCTTGCCATATTGGACA
TCATGCTTCCCGGCACAAGCGGCCTTACTATCTGTCAAAAAATAAGGGACAAGCACACCTATCCGATTATCATGCTGACC
GGGAAAGATACAGAGGTAGATAAAATTACAGGGTTAACAATCGGCGCGGATGATTATATAACGAAGCCCTTTCGCCCACT
GGAGTTAATTGCTCGGGTAAAGGCCCAGTTGCGCCGATACAAAAAATTCAGTGGAGTAAAGGAGCAGAACGAAAATGTTA
TCGTCCACTCCGGCCTTGTCATTAATGTTAACACCCATGAGTGTTATCTGAACGAGAAGCAGTTATCCCTTACTCCCACC
GAGTTTTCAATACTGCGAATCCTCTGTGAAAACAAGGGGAATGTGGTTAGCTCCGAGCTGCTATTTCATGAGATATGGGG
CGACGAATATTTCAGCAAGAGCAACAACACCATCACCGTGCATATCCGGCATTTGCGCGAAAAAATGAACGACACCATTG
ATAATCCGAAATATATAAAAACGGTATGGGGGGTTGGCTATAAAATTGAAAAATAA