MEGAResFrom MEG, the Microbial Ecology Group

VANZA

The function of the vanZ genes is currently unknown. This gene is part of the VanA operon and is an accessory gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Other Groups in VanA-type accessory protein

Sequences

Download Sequences

>>MEG_7615|Drugs|Glycopeptides|VanA-type_accessory_protein|VANZA
atgaaatctagaaaacataatattacaaaaggattatttatagtttacataattattttaacatggataatactatttaa
gttgcaatttgatatctcatcccttgaaaccatgaatcttagaagcataaacttagtaccttttgctgggtcacttataa
ttaataatagagtagatatatcagagattatattaaatgtggctatatttgtaccatttgggatatatgtgtgtatgcta
aaagaagaatggagctttataaaaaaagttatacctatttttataactagtttggcatttgaaacacttcaatatatatt
tgcactaggtgcaagtgatataacggatttgataggaaacacactaggaggaatcataggaatagctgtttttatgctat
tatcgaaaatatttaagaataataccataaaaattatcaatgtattggcattgattgtgacaattattgttgtattattt
ttaggattagttatttttgcaaacttatag

>>MEG_7616|Drugs|Glycopeptides|VanA-type_accessory_protein|VANZA
atggaaaaaatattatctagaggattgctagctttatatttagtgacactaatctggttagtgttattcaaattacaata
caatattttgtcagtatttcattatcaccaaagaagtcttaacttgattccatttgctgcacatggaagtctcagagaga
tgatagataatattatcatctttatcccttttggcttgcttttgaatgtcaatttcaaaaaagttggatttttactcaag
tttgcttttatattagttttaagtcttacttttgaattaatacaatttatcttcgcaattggagcgacagatatgacaga
tgtaattacaaatactgttggaggctttcttggactgaaattatatggtttaagcaataagcacataaataataaaaaat
tagacagaattattatttttgtaggtatacttttgctcgtattattgctctattaccgtacccatttaaaaattaaatat
tcttag

>>MEG_7617|Drugs|Glycopeptides|VanA-type_accessory_protein|VANZA
ATGAACGGCGGAAGCAGGTTGAAGAATTGGGTTGTTCGGGCATTTTTTGCCTCCTATATGTACGCATTATTCAAAATCAT
CGTGCTCAAGTTTGGCCCGACAGACGTCGAGTTTCTATGGGTACGGCTAATGCGAAACTCGACCAACCCGGAATGTATTG
CCGCCCGGCTGCATGCCGGCAATCTGATCCCTTTGAAGGAAATTTCCAGGGCGAGTGATTCGATGTCGGGGCACAGCCTT
TTGAACTTGTTGGGGAATGTTGGGATCTTCGTCCCTTTAGGCATTTTCCTCGGTGTTCTGGCGAAATCCGGCAAACTGAC
GTTGGCAGGGTCGTTTTGGAGCTCCTTGGGCGTAAGTCTCGTGTTAGAATGCACACAAGTTTTATTTTCGATCGGAACAT
TCGACGTCGACGACCTCATTTTGAATTCCATCGGAGGCTCAATCGGTTTTGTCGTTTATGCGCTGTGCGCGCTAGGCTGA