MEGAResFrom MEG, the Microbial Ecology Group

VANZA

The function of the vanZ genes is currently unknown. This gene is part of the VanA operon and is an accessory gene.

References

Other Groups in VanA-type accessory protein

Sequences

Download Sequences

>959|M97297.1|TRNVAN|Glycopeptides|VanA-type_accessory_protein|VANZA
TTGGGAAAAATATTATCTAGAGGATTGCTAGCTTTATATTTAGTGACACTAATCTGGTTAGTGTTATTCAAATTACAATA
CAATATTTTATCAGTATTTAATTATCATCAAAGAAGTCTTAACTTGACTCCATTTACTGCTACTGGGAATTTCAGAGAGA
TGATAGATAATGTTATAATCTTTATTCCATTTGGCTTGCTTTTGAATGTCAATTTTAAAGAAATCGGATTTTTACCTAAG
TTTGCTTTTGTACTGGTTTTAAGTCTTACTTTTGAAATAATTCAATTTATCTTCGCTATTGGAGCGACAGACATAACAGA
TGTAATTACAAATACTGTTGGAGGCTTTCTTGGACTGAAATTATATGGTTTAAGCAATAAGCATATGAATCAAAAAAAAT
TAGACAGAGTTATTATTTTTGTAGGTATACTTTTGCTCGTATTATTGCTCGTTTACCGTACCCATTTAAGAATAAATTAC
GTGTAA

>574|DQ018711.1|DQ018711|Glycopeptides|VanA-type_accessory_protein|VANZA
ATGAACGGCGGAAGCAGGTTGAAGAATTGGGTTGTTCGGGCATTTTTTGCCTCCTATATGTACGCATTATTCAAAATCAT
CGTGCTCAAGTTTGGCCCGACAGACGTCGAGTTTCTATGGGTACGGCTAATGCGAAACTCGACCAACCCGGAATGTATTG
CCGCCCGGCTGCATGCCGGCAATCTGATCCCTTTGAAGGAAATTTCCAGGGCGAGTGATTCGATGTCGGGGCACAGCCTT
TTGAACTTGTTGGGGAATGTTGGGATCTTCGTCCCTTTAGGCATTTTCCTCGGTGTTCTGGCGAAATCCGGCAAACTGAC
GTTGGCAGGGTCGTTTTGGAGCTCCTTGGGCGTAAGTCTCGTGTTAGAATGCACACAAGTTTTATTTTCGATCGGAACAT
TCGACGTCGACGACCTCATTTTGAATTCCATCGGAGGCTCAATCGGTTTTGTCGTTTATGCGCTGTGCGCGCTAGGCTGA