MEGAResFrom MEG, the Microbial Ecology Group

VANJ

The vanJ gene encodes an enzyme that may play a role in the recycling of undecaprenol pyrophosphate (C55-PP), which is then utilized as a precursor to Lipid II. Recycling of C55-PP appears to counteract the mechanism of action of teicoplanin but not vancomycin.

References

Sequences

Download Sequences

>CARD|phgb|NC_003888|3968821-3969814|ARO:3002914|vanJ|Glycopeptides|Undecaprenol_pyrophosphate_recycling|VANJ
GTGGTGCTCCGCAGCGCCGCCCGGCCGGAGCTCTGGAAGCGTGCGCCGGTACTCACGGTGTCGGCGCTGTTGCTGGGCCT
CGTGATGATGCTGCACGCGGAGATTCCAAATCGGTTCGGGTCCGTCGGCAGCCTGGTCGAGACCTTCCTGCCGTGGTTCG
GTCTGTTCGTCCCCGTGCTGGCCGCCGGAGCGCTGTGGCGCCGCTCCGCCGCCGCGGTGACCGCGCTGGTGCTGCCGGTC
ACGGTGTGGCTGAGCCTCTTCGGCGGGCTGCTCGGCGACAAGTCAGGCGCGGGCGGCGAATTCACCATGGCCTCCCACAA
CGTCGGCGCCGAGAACCCGGACCCGGCCGGCACCGCCCGCGACCTGGCTGCCTCCGGAGTGGACGTACTGGCGCTGGAGG
AGATCACCGCACAGGACCGGGAGGTGTATGAGAAGGGGCTGGCCAGGGAGTATCCGTACCACACGGTGCAGGGCACGGTC
GGGTTGTGGAGCAAGCTGCCGCTGTCGGGCACGCGGCCGGTCGACATCGCGACGGACTACGGGCCGCTGGCGGACACCAA
ACCGGCCGACGTCACGATGGCCGGCAACCGAGCGCTGCGCACCACGGTGGCCACGGAAAGGGGCCCGCTGGTGGTGTACG
TGGCCCACCTGGGCTCCGTACGGCTCAATCCTCGGGCGGGGTTCTGGACGGACTCCCGCGACCGGAACGCGTGGGCGCTC
GGCGAGGCCCTCGCCGCCGACCGCAGTGAGCGGATCGCGCTGCTCGGCGACCTGAACGGCACCGTGGACGACCGCGCGTT
GGCGGGCATCACCTCGCAGCTGCACTCGGTCCAGGAGGCGGCCGGGAACGGGTTCGGCTTCACCTGGCCGGCGAAGTTCC
CGGTGGCGCGGATCGACCAGATCCTGGTGCGCGGCGTGGAGCCGACCGGTTCGTGGACGCTGCCCGCCACCGGCAGCGAC
CACCTGCCTGTGGCGGCGGGGGTCAGCTGGTGA