Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

BLE

The BLE group of genes confer resistance to Glycopeptides through the mechanism, Bleomycin resistance protein.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Bleomycin resistance protein

    Sequences

    Download Sequences

    >>MEG_1457|Drugs|Glycopeptides|Bleomycin_resistance_protein|BLE
    atgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcgg
    aatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccgggctcg
    atcccctcgcgagttggttcagctgctgcctgaggctggacgacctcgcggagttctaccggcagtgcaaatccgtcggc
    atccaggaaaccagcagcggctatccgcgcatccatgcccccgaactgcaggagtggggaggcacgatggccgctttggt
    cgacccggacgggacgctcctgcgcctgatacagaacgaattgcttgcaggcatctcatga

    >>MEG_1458|Drugs|Glycopeptides|Bleomycin_resistance_protein|BLE
    atggccaagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggct
    cgggttctcccgggacttcgtggaggacgacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtcc
    aggaccaggtggtgccggacaacaccctggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggag
    gtcgtgtccacgaacttccgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttcgc
    cctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggagcaggactga

    >>MEG_1459|Drugs|Glycopeptides|Bleomycin_resistance_protein|BLE
    atggtgaaattcacgggtgccatcccggtcctgaccgccgtcgacgtaccggccggcgtcgccttctgggtcggcacgct
    gggtttcgaggaggacttcgccgacgacggcttcgcgggcatccaccgcggcgacgtacagctcttcatcagccggacgg
    aacaccagctcgtcgcggacaacacctccgcgtgggtggaggtcctgggcctcgacgaactgcacgcgcagtggtcacag
    gtgctctccaccgactacgcggacgcctcgggcccggccatgaccgcggtgacggacaccccttgggggcgtgagttcgc
    ggtgcgcgacccggccgggaactgcgtccacttcgccgccgagcactga

    >>MEG_1460|Drugs|Glycopeptides|Bleomycin_resistance_protein|BLE
    gtgagaatgttacagtctatcccggcattgccagtcggggatattaaaaagagtataggtttttattgcgataaactagg
    tttcactttggttcaccatgaagatggattcgcagttctaatgtgtaatgaggttcggattcatctatgggaggcaagtg
    atgaaggctggcgctctcgtagtaatgattcaccggtttgtacaggtgcggagtcgtttattgctggtactgctagttgc
    cgcattgaagtagagggaattgatgaattatatcaacatattaagcctttgggcattttgcaccccaatacatcattaaa
    agatcagtggtgggatgaacgagactttgcagtaattgatcccgacaacaatttgattagcttttttcaacaaataaaaa
    gctaa