MEGAResFrom MEG, the Microbial Ecology Group

FUSH

The fusH gene encodes an esterase that converts fusidic acid into an inactive molecule, therefore causing resistance to fusidic acid.

References

Sequences

Download Sequences

>CARD|phgb|Z50108|238-1768|ARO:3003026|fusH|Fusidic_acid|Fusidic_acid_esterases|FUSH
TTGCTCAACAAAGGAATCCGCACGCGGCGGGCTCGCGGGGCACTGGCCGGCGGCACGGTCCTGACGGCCGCCGCCGCCCT
GCTCACCGCGGTGCCGGCCGCGCAGGCGATTTCCGGCGAGCCCCCGGCCGCGACCGACCACGCCTTCACCGCCCGGCTGC
ACATCGGCGAGGGCGACACCCTCCGCGGCTGTTCCGCCGCTCTGGTGCACCAGCAGTGGCTGCTGACCGCCACGAGCTGT
TTCGCCGCCACCCCGGGTGGCGAGGTCAAGTCGGGCAAGCCCGCGCTGAAGTCGACGGCGACCCTGGGCGGCAAGACCCT
CGGCATAGTCGAGGTCGTTCCGCGCGACGACCGGGACGTGGCCATGGTCCGGCTCGCCGAACCCGTCACCACGGTCGAGC
CCGTGCGGCTGGCCGCGGACGCCCCCGTGGCGGCCGAGACCCTGCTCGGTGCAGGGTTCGGGCGGACCCGGACGGAGTGG
GCCCCGGACCAGTTGCACACCGGCGAGTTCCGAGTGGACTCCGTCACCGGCACCACCGTGGAGCTGACCGGTCAGGACGG
GGTGTCCGTGTGCAAGGGCGACACCGGCGGCCCGGCCCTGCGCGGCACGGGTGGTGAGGTCGAGCTGGCCGCCGTGCACA
GCCGGTCCTGGCAGGGCGGGTGCTTCGGCGAGACGGAGACCCGGACCGGCGCGGTGGACGCCAGGGCCGACGGCCTGGCG
GACTGGGTGACGGACGTCCGCAACCGCGACCGGACGCAGTCGGCCGACGTCGACGGCGACGGCAGGGCCGACCTCGTCGT
CCTGCGCTCGAACGGCGACGTCGTCGTCCACCGCAACCTGGGCGACAGCTTCGCCGCCGGCCGGGTCATGTCCGGCGGCT
GGGGCCTCTTCGTGACCTGGAAGGACCTGGGCCGGCTCTATTTCGCCGACGTCGACGGCGACCGCAAGGCCGACATGATC
GTCCACACCAGCGACGGCAACATCGAGGTCCGCTTCAACCACGGCACCTACTGGGACCAGGGCACGCACTGGTCCGGCGG
CTGGGGCCGCTTCATCGACGGCAGCGACCTGGGCCGGCTCTACTTCGCCGATGTGGACGGCGACGGCAGGGCGGACATGA
TCGTCCACACCGGCGACGGCAACGTCGAGGTGCGCTTCAACCACGGCACGTACTGGGACCAGGGGACGCACTGGTCGGGC
GGCTGGGGCCGCTTCGTGACCTGGAAGGACCTGGGCCGGCTCTACTTCGCCGATGTCGACGGCGACGGCAGGGCGGACAT
GATCGTCCACACCGGCGACGGCAACGTAGAGGTCCGCTTCAACCACGGCACGTACTGGGACCAGGGCACGCACTGGTCCG
GCGGCTGGGGCCGCTTCGTCGACGGCAGCGACCTGGGGTCCCTCGAGTTCGGCGACGCCACCGGTGACGGCAAGGCCGAC
CTGCTCGTCCGCACCAAGGACGGGAAGGTCGCCCTCCGTACCAACCACGGCACCTACTGGGACCAGGGCAAGTTCATGAT
CACGCTCTGAC