MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FUSH

The fusH gene encodes an esterase that converts fusidic acid into an inactive molecule, therefore causing resistance to fusidic acid.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/9084170

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Fusidic acid esterases

Sequences

Download Sequences

>>MEG_3074|Drugs|Fusidic_acid|Fusidic_acid_esterases|FUSH
TTGCTCAACAAAGGAATCCGCACGCGGCGGGCTCGCGGGGCACTGGCCGGCGGCACGGTCCTGACGGCCGCCGCCGCCCT
GCTCACCGCGGTGCCGGCCGCGCAGGCGATTTCCGGCGAGCCCCCGGCCGCGACCGACCACGCCTTCACCGCCCGGCTGC
ACATCGGCGAGGGCGACACCCTCCGCGGCTGTTCCGCCGCTCTGGTGCACCAGCAGTGGCTGCTGACCGCCACGAGCTGT
TTCGCCGCCACCCCGGGTGGCGAGGTCAAGTCGGGCAAGCCCGCGCTGAAGTCGACGGCGACCCTGGGCGGCAAGACCCT
CGGCATAGTCGAGGTCGTTCCGCGCGACGACCGGGACGTGGCCATGGTCCGGCTCGCCGAACCCGTCACCACGGTCGAGC
CCGTGCGGCTGGCCGCGGACGCCCCCGTGGCGGCCGAGACCCTGCTCGGTGCAGGGTTCGGGCGGACCCGGACGGAGTGG
GCCCCGGACCAGTTGCACACCGGCGAGTTCCGAGTGGACTCCGTCACCGGCACCACCGTGGAGCTGACCGGTCAGGACGG
GGTGTCCGTGTGCAAGGGCGACACCGGCGGCCCGGCCCTGCGCGGCACGGGTGGTGAGGTCGAGCTGGCCGCCGTGCACA
GCCGGTCCTGGCAGGGCGGGTGCTTCGGCGAGACGGAGACCCGGACCGGCGCGGTGGACGCCAGGGCCGACGGCCTGGCG
GACTGGGTGACGGACGTCCGCAACCGCGACCGGACGCAGTCGGCCGACGTCGACGGCGACGGCAGGGCCGACCTCGTCGT
CCTGCGCTCGAACGGCGACGTCGTCGTCCACCGCAACCTGGGCGACAGCTTCGCCGCCGGCCGGGTCATGTCCGGCGGCT
GGGGCCTCTTCGTGACCTGGAAGGACCTGGGCCGGCTCTATTTCGCCGACGTCGACGGCGACCGCAAGGCCGACATGATC
GTCCACACCAGCGACGGCAACATCGAGGTCCGCTTCAACCACGGCACCTACTGGGACCAGGGCACGCACTGGTCCGGCGG
CTGGGGCCGCTTCATCGACGGCAGCGACCTGGGCCGGCTCTACTTCGCCGATGTGGACGGCGACGGCAGGGCGGACATGA
TCGTCCACACCGGCGACGGCAACGTCGAGGTGCGCTTCAACCACGGCACGTACTGGGACCAGGGGACGCACTGGTCGGGC
GGCTGGGGCCGCTTCGTGACCTGGAAGGACCTGGGCCGGCTCTACTTCGCCGATGTCGACGGCGACGGCAGGGCGGACAT
GATCGTCCACACCGGCGACGGCAACGTAGAGGTCCGCTTCAACCACGGCACGTACTGGGACCAGGGCACGCACTGGTCCG
GCGGCTGGGGCCGCTTCGTCGACGGCAGCGACCTGGGGTCCCTCGAGTTCGGCGACGCCACCGGTGACGGCAAGGCCGAC
CTGCTCGTCCGCACCAAGGACGGGAAGGTCGCCCTCCGTACCAACCACGGCACCTACTGGGACCAGGGCAAGTTCATGAT
CACGCTCTGA