MEGAResFrom MEG, the Microbial Ecology Group

FUSE

The FUSE group of genes confer resistance to Fusidic acid through the mechanism, Fusidic acid-resistant mutation.

References

    Other Groups in Fusidic acid-resistant mutation

    Sequences

    Download Sequences

    >>MEG_3071|Drugs|Fusidic_acid|Fusidic_acid-resistant_mutation|FUSE|RequiresSNPConfirmation
    ATGAGTCGTGTTGGTAAGAAAATTATTGACATCCCTAGTGACGTAACAGTAACTTTTGATGGAAATCATGTAACTGTTAA
    AGGTCCTAAAGGTGAATTATCAAGAACTTTAAATGAAAGAATGACATTCAAACAAGAAGAAAACACAATTGAAGTTGTAA
    GACCATCTGATTCTAAAGAAGATAGAACAAACCATGGTACAACTCGTGCTTTATTAAACAATATGGTACAAGGTGTTTCT
    CAAGGATACGTAAAAGTACTTGAACTTGTTGGTGTAGGTTACCGTGCTCAAATGCAAGGTAAAGACTTAATCCTTAACGT
    TGGTTATTCTCACCCAGTAGAAATTAAAGCTGAAGAAAACATTACTTTCTCAGTTGAGAAAAACACAGTCGTTAAAGTTG
    AAGGTATTTCAAAAGAACAAGTTGGAGCATTAGCATCTAACATCCGTTCAGTAAGACCTCCAGAGCCTTACAAAGGTAAA
    GGTATTCGTTACCAAGGTGAATACGTTCGCCGTAAAGAAGGTAAAACTGGTAAATAA