MEGAResFrom MEG, the Microbial Ecology Group

FUSA

The FUSA group of genes confer resistance to Fusidic acid through the mechanism, Fusidic acid-resistant mutation.

Other Groups in Fusidic acid-resistant mutation

Sequences

Download Sequences

>MEG_3065|Drugs|Fusidic_acid|Fusidic_acid-resistant_mutation|FUSA|RequiresSNPConfirmation
ATGGCTAGAGAATTTTCATTAGAAAAAACTCGTAATATCGGTATCATGGCTCACATTGATGCTGGTAAAACGACTACGAC
TGAACGTATTCTTTATTACACTGGCCGTATCCACAAAATTGGTGAAACACATGAAGGTGCTTCACAAATGGACTGGATGG
AGCAAGAACAAGACCGTGGTATTACTATCACATCTGCTGCAACAACAGCAGCTTGGGAAGGTCACCGTGTAAACATTATC
GATACACCTGGACACGTAGACTTCACTGTAGAAGTTGAACGTTCATTACGTGTACTTGACGGAGCAGTTACAGTACTTGA
TGCACAATCAGGTGTTGAACCTCAAACTGAAACAGTTTGGCGTCAGGCTACAACTTATGGTGTTCCACGTATCGTATTTG
TAAACAAAATGGACAAATTAGGTGCTAACTTCGAATACTCTGTAAGTACATTACATGATCGTTTACAAGCTAACGCTGCT
CCAATCCAATTACCAATTGGTGCGGAAGACGAATTCGAAGCAATCATTGACTTAGTTGAAATGAAATGTTTCAAATATAC
AAATGATTTAGGTACTGAAATTGAAGAAATTGAAATTCCTGAAGACCACTTAGATAGAGCTGAAGAAGCTCGTGCTAGCT
TAATCGAAGCAGTTGCAGAAACTAGCGACGAATTAATGGAAAAATATCTTGGTGACGAAGAAATTTCAGTTTCTGAATTA
AAAGAAGCTATCCGCCAAGCTACTACTAACGTAGAATTCTACCCAGTACTTTGTGGTACAGCTTTCAAAAACAAAGGTGT
TCAATTAATGCTTGACGCTGTAATTGATTACTTACCTTCACCACTAGACGTTAAACCAATTATTGGTCACCGTGCTAGCA
ACCCTGAAGAAGAAGTAATCGCGAAAGCAGACGATTCAGCTGAATTCGCTGCATTAGCGTTCAAAGTTATGACTGACCCT
TATGTTGGTAAATTAACATTCTTCCGTGTGTACTCAGGTACAATGACATCTGGTTCATACGTTAAGAACTCTACTAAAGG
TAAACGTGAACGTGTAGGTCGTTTATTACAAATGCACGCTAACTCACGTCAAGAAATCGATACTGTATACTCTGGAGATA
TCGCTGCTGCGGTAGGTCTTAAAGATACAGGTACTGGTGATACTTTATGTGGTGAGAAAAATGACATTATCTTGGAATCA
ATGGAATTCCCAGAGCCAGTTATTCACTTATCAGTAGAGCCAAAATCTAAAGCTGACCAAGATAAAATGACTCAAGCTTT
AGTTAAATTACAAGAAGAAGACCCAACATTCCATGCACACACTGACGAAGAAACTGGACAAGTTATCATCGGTGGTATGG
GTGAGCTTCACTTAGACATCTTAGTAGACCGTATGAAGAAAGAATTCAACGTTGAATGTAACGTAGGTGCTCCAATGGTT
TCATATCGTGAAACATTCAAATCATCTGCACAAGTTCAAGGTAAATTCTCTCGTCAATCTGGTGGTCGTGGTCAATACGG
TGATGTTCACATTGAATTCACACCAAACGAAACAGGCGCAGGTTTCGAATTCGAAAACGCTATCGTTGGTGGTGTAGTTC
CTCGTGAATACATTCCATCAGTAGAAGCTGGTCTTAAAGATGCTATGGAAAATGGTGTCTTAGCAGGTTATCCATTAATT
GATGTTAAAGCTAAATTATATGATGGTTCATACCATGATGTCGATTCATCTGAAATGGCCTTCAAAATTGCTGCATCATT
AGCACTTAAAGAAGCTGCTAAAAAATGTGATCCTGTAATCTTAGAACCAATGATGAAAGTAACTATTGAAATGCCTGAAG
AGTACATGGGTGATATCATGGGTGACGTAACATCTCGTCGTGGACGTGTTGATGGTATGGAACCTCGTGGTAATGCACAA
GTTGTTAATGCTTATGTACCACTTTCAGAAATGTTCGGTTATGCAACATCATTACGTTCAAACACTCAAGGTCGCGGTAC
TTACACTATGTACTTCGATCACTATGCTGAAGTTCCAAAATCAATCGCTGAAGATATTATCAAGAAAAATAAAGGTGAAT
AA