MEGAResFrom MEG, the Microbial Ecology Group

FOSX

The fosX gene encodes a hydrase that acts on fosfomycin, rendering it ineffective as an antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/17567049

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>>MEG_3024|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSX
atgaaaggcatcagccacatcacattcatcgtccgcgacctgaatcgtatggccgcacttctctgtgagggactgggtgc
gcgtgaggtgtatgacagctcaaaccagaacttctcgttgtcccgcgaaaagttctttgtgcttggtagtacgtggctag
ctgcaatggaaggtgaaccgcccgccgagcgttcatatcagcatgttgcctttgcggtgagtgagacggacttgcctgcg
tatcaagccagacttgaggcactcggcgttgagattcggccaccgcgtagccgtgttgacggtgagggtctctccctgta
cttctacgactttgacaatcatttatttgaacttcattcaggtactttagagcagcgccttgtccggtatcaggcggggc
gctaa

>>MEG_3025|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSX
atgattacgggccttagccacatcacgtttatctgccgcgacctcgaccgcatggaagccgtgctgaccggcgtcctggg
ggcgcggcgggtctacgacagcggcgaggccacgttttccctgtcccgggagcggttttatctggtcggcggggagggtg
acgacgggctgtggctggcggtcatggaaggcgagcccctggccgagccgacctacaaccacgtggcctttgccgtggac
gaagcggacttcgaggcctgtctggcccgcgtccaggccctgggactgacctttcgcccgccgcgcctccgggtggccgg
tgagggccggtcgctatatttttacgaccacgacaaccatcttttcgaactgcataccggaaccttgccggagcggctgg
cccgctaccgccagggacgcgccgccgccccggccccaacgcccgacaaccccgaaaccccgtaa

>>MEG_3026|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSX
atgatttcaggattaagccatatcactttaattgtgaaagatttgaataaaacaaccacattcttaagagaaatttttaa
tgcagaagaaatctattctagtggcgatcagactttttcgctttccaaagaaaaattttttctaattgctggcctatgga
tttgcattatggaaggagactctttacaagagcaaacttacaatcatattgcgttccgaattcaatctgaggaagtggat
gaatatattgagcggattaaatctcttggtgtggaaataaaaccagaacgtcccagagtcgaaggtgagggacgctcaat
ttatttttatgactttgataatcatctctttgaattacacgctggtacattagaagaacgcttgaaaaggtatcacgaat
ag

>>MEG_3027|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSX
atgggaattcttggcattagtcatctgacattcgtggtccgcgatgtagagcgcactgcgagactggtctgcgaaggact
tggggcggaagaggtatacgacagcaaagccaaaaacttttcgctgtcacgagagaagttttttctcttgggcggcgtat
ggcttgctttcatggaaggagtgccatcggagcggtcctatcggcacgtcgcttttgaagtgaccgaagaggaaattgca
agatatgaggctagccttagaaacctcggtgtggaagtcagagagccgcggccaagagtggctggagaggggctgtcact
gtatttctacgactatgacaacaacttattcgagctacatgcgggaacactggcgcaacgacttgaaaggtatacgcaat
ga

>>MEG_3028|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSX
ATGATTTCAGGATTAAGCCATATCACTTTAATTGTGAAAGATTTGAATAAAACAACTGCTTTCTTACAGAATATTTTTAA
TGCAGAAGAAATCTATTCTAGTGGCGACAAAACATTTTCGCTTTCCAAAGAAAAATTTTTTCTAATAGCTGGTTTGTGGA
TTTGCATTATGGAAGGAGATTCTTTACAAGAGCGAACTTACAATCATATTGCTTTCCAAATTCAATCCGAGGAAGTGGAT
GAATATACTGAGCGGATTAAAGCTCTCGGTGTGGAAATGAAACCAGAACGTCCCAGAGTCCAAGGTGAAGGACGTTCCAT
TTATTTTTATGATTTTGATAATCATCTGTTTGAATTACACGCTGGTACATTAGAAGAACGCTTAAAAAGGTATCACGAAT
AG