MEGAResFrom MEG, the Microbial Ecology Group

FOSK

The fosK gene encodes a glutathione transferase that catalyzes a reaction between the fosfomycin molecule and glutathione, rendering it ineffective as an antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4136070/

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>>MEG_3023|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSK
ATGATCACTGGTATCAATCACATCACCTTTTCCGTCAGGGACTTGAGCTCTTCAATCGAGTTCTATCGTGACTTGCTGGG
AATGAGGCTGCACGTGACCTGGGAAGCAGGTGCTTATTTTACAGCGGGTGATACGTGGGTATGTCTGAGCGTCGGGGAAC
CTAAACCCGCCAACGACTACACGCATGTGGCATTCAGTGTTGGCGAAAGAGAGCTTGTTGAGCTGCACGCTAGGCTAAAA
GAAGCCGGGGTTGAGGAGTGGAAGCAGAATACAAGTGAGGGTAACTCCGTGTATCTGCTTGATCCAAACGGCCATCGCAT
TGAGCTTCACTGCGGAACGTTGGCAACCCGCTTAGCTGAGTTGGAGAAGTCGCCCTATAAAAGGTTGGTCTGGTGCTGA