MEGAResFrom MEG, the Microbial Ecology Group

FOSK

The fosK gene encodes a glutathione transferase that catalyzes a reaction between the fosfomycin molecule and glutathione, rendering it ineffective as an antibiotic.

References

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>CARD|phgb|AB917040|736-1135|ARO:3003207|FosK|Fosfomycin|Fosfomycin_thiol_transferases|FOSK
ATGATCACTGGTATCAATCACATCACCTTTTCCGTCAGGGACTTGAGCTCTTCAATCGAGTTCTATCGTGACTTGCTGGG
AATGAGGCTGCACGTGACCTGGGAAGCAGGTGCTTATTTTACAGCGGGTGATACGTGGGTATGTCTGAGCGTCGGGGAAC
CTAAACCCGCCAACGACTACACGCATGTGGCATTCAGTGTTGGCGAAAGAGAGCTTGTTGAGCTGCACGCTAGGCTAAAA
GAAGCCGGGGTTGAGGAGTGGAAGCAGAATACAAGTGAGGGTAACTCCGTGTATCTGCTTGATCCAAACGGCCATCGCAT
TGAGCTTCACTGCGGAACGTTGGCAACCCGCTTAGCTGAGTTGGAGAAGTCGCCCTATAAAAGGTTGGTCTGGTGCTGA