Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

FOSE

The FOSE group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin thiol transferases.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Fosfomycin thiol transferases

    Sequences

    Download Sequences

    >>MEG_3019|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSE
    atggaaggtatcagccacatcacgcttattgtccgcgacctctcgcgcatgaccaccttcctttgcgatggtctcggtgc
    gcgagaggtttatgacagtgctggccacaattactcgctttcccgcgagaaattctttgtccttggtggcgtttggttgg
    ccgctatggagggagtgccgccatctgagcgctcctatcagcatgtcgcctttcgggtgagtgagtcagatcttgccgta
    tatcaggcaagacttgggtcgctgggcgtggagattcgcccacccaggccacgcgtgaatggagaggggctgtccctgta
    cttctatgattttgacaaccatctgtttgagctgcacaccggcacattggagcagcgccttgccaggtacggagctgggc
    gctaa

    >>MEG_3020|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSE
    ATGACCACCTTCCTTTGCGATGGTCTCGGTGCGCGAGAGGTTTATGACAGTGCTGGCCACAATTACTCGCTTTCCCGCGA
    GAAATTCTTTGTCCTTGGTGGCGTTTGGTTGGCCGCTATGGAGGGAGTGCCGCCATCTGAGCGCTCCTATCAGCATGTCG
    CCTTTCGGGTGAGTGAGTCAGATCTTGCCGTATATCAGGCAAGACTTGGGTCGCTGGGCGTGGAGATTCGCCCACCCAGG
    CCACGCGTGAATGGAGAGGGGCTGTCCCTGTACTTCTATGATTTTGACAACCATCTGTTTGAGCTGCACACCGGCACATT
    GGAGCAGCGCCTTGCCAGGTACGGAGCTGGGCGCTAA