MEGAResFrom MEG, the Microbial Ecology Group

FOSB

The fosB gene encodes an L-cysteine transferase that catalyzes a reaction between the fosfomycin molecule and L-cysteine, rendering it ineffective as an antibiotic.

References

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>Fos|fosB_1_X54227|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAGGTGAGACCTCGGCCTATTTTAATTTAGGTGGTATATGGTTGGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAATGATTTTGAAGATTGGTAT
ATCTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>Fos|Fcyn|FosB|AHLO01000073|63139-63558|417|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGTTAAAATCTATTAATCATATATGCTTTTCAGTCAGAAATTTAAACGATTCAATACATTTTTATAGAGATATTTTACT
TGGGAAATTGCTATTGACTGGTAAAAAAACTGCTTATTTTGAGCTTGCAGGCCTATGGATTGCTTTAAATGAAGAAAAAG
ATATACCACGTAATGAAATTCACTTTTCATATACACATATAGCTTTCACTATAGATGACAGCGAATTTAAATATTGGCAT
CAGAGGTTAAAAGATAATAACGTGAATATTTTAGAAGGAAGAGTTAGAGATATTAGAGATAGACAATCAATTTACTTTAC
CGACCCTGATGGTCATAAGCTAGAATTACATACTGGCACACTTGAGAACAGATTAAATTATTATAAAGAGGCTAAACCAC
ATATGACATTTTACAAATAA

>Fos|fosB_3_HQ219726|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTTGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
AACTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>Fos|fosB_2_X89875|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTCGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
AACTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA