MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

FOSB

The fosB gene encodes an L-cysteine transferase that catalyzes a reaction between the fosfomycin molecule and L-cysteine, rendering it ineffective as an antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2286755/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>>MEG_3004|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
atgatacaaagtattaaccatatttgtttttcagttgcaaatctagagaaagctattgagttttatcaaaatatacttca
agcgaaattattagtaaaaggtagaaagttagcttattttgatttaaatggtttatggattgctctaaatgtggaagaaa
gtataccaagaaacgaaattcagtactcttacacacatatagctttcactgtaacaaataatgagtttgattctttaaaa
gaaatattaattcaaaatcaagttaatatcttacctggacgagaaagagatgaccgagataaacggtctatttattttac
agatccagatggtcacaagtttgagtttcatactggtactttacaagatcgtttacaatattataaagaagataaaaagt
atatgactttttactga

>>MEG_3005|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
atgattaaaggaataaatcatattacttattcggtttctaatatagctaaatcaattgaattttacagagatattttagg
ggctgacattttagttgaaggtgagacctcggcctattttaatttaggtggtatatggttggctttgaacgaagaaaaaa
atattcctagaagcgaaattaaatattcgtatactcatatagcatttacaatttcagataatgattttgaagattggtat
atctggttgaaagaaaatgaagtaaatattcttgaaggtagagatagagatattagagataaaaaatcaatatatttcac
tgatttagatggtcataaattagaattgcatacaggaagtttagaagatagattgagttattataaagaggctaaacctc
atatgaatttttatatttaa

>>MEG_3006|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
atgctacagggcattaaccatatttgtttttctgtatcaaacttggaaaaatctattgaattctatcaaaaaatacttca
agcaaaattattagtaaaaggtagaaaattagcgtattttgatttaaatggattatggattgctttaaatgttgaagaag
atataccaagaaatgaaattaagcaatcttatacacatatggctttcactgtaactaatgaagcattagaccatttaaaa
gaagtattaattcaaaatgatgttaatattttacctggccgagaaagagatgagagagaccaaagatctctttactttac
agatccagatggccataagtttgagttccacactggcactttgcaaaaccggttagagtactataaagaagataaaaaac
atatgactttttacatataa

>>MEG_3007|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
atggaaataacaaatgttaatcatatttgtttttcagtgagtgatttaaatacctctatacaattttataaagatatttt
acatggtgacttattagtatcaggtagaacgacagcatatttaactattggtcatacttggattgcactgaatcaagaaa
aaaatataccaaggaatgaaataagtcattcctatacgcacgttgctttctccatagatgaagaagattttcaacagtgg
attcaatggcttaaagagaatcaagtaaatattttaaaagggcgaccaagagacattaaagacaaaaaatcgatatattt
tacagatctggatgggcataaaattgaattacatactggaacattaaaagatagaatggaatattataaatgtgagaaga
cgcatatgcaattttacgatgagttttga

>>MEG_3008|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ttgttaaggggaatcaatcatatttgtttttcggtatctaatttagaaaactctattatgttttatgaaaaagtattaga
aggagaattattagttaaaggaagaaaattggcttattttaacatatgtggagtatggatagcgcttaatgaagagacgc
atattccgagaaatgagattcatcaatcttatacgcacattgcattttctgttgaaaaagaagactttaaatgtctaata
cagcgattagaagaaaatgatgttcatattttacaaggaagagaacgtgatgtaagagattgcgaatctatatactttgt
tgatcctgacggtcataaatttgagtttcactcagggacactgcaagaccgtttaaattattatagagatgagaaacctc
atatgacattttattag

>>MEG_3009|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGTTAAAATCTATTAATCATATATGCTTTTCAGTCAGAAATTTAAACGATTCAATACATTTTTATAGAGATATTTTACT
TGGGAAATTGCTATTGACTGGTAAAAAAACTGCTTATTTTGAGCTTGCAGGCCTATGGATTGCTTTAAATGAAGAAAAAG
ATATACCACGTAATGAAATTCACTTTTCATATACACATATAGCTTTCACTATAGATGACAGCGAATTTAAATATTGGCAT
CAGAGGTTAAAAGATAATAACGTGAATATTTTAGAAGGAAGAGTTAGAGATATTAGAGATAGACAATCAATTTACTTTAC
CGACCCTGATGGTCATAAGCTAGAATTACATACTGGCACACTTGAGAACAGATTAAATTATTATAAAGAGGCTAAACCAC
ATATGACATTTTACAAATAA

>>MEG_3010|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
TTGTTAAGGGGAATCAATCATATTTGTTTTTCGGTATCTAATTTAGAAAACTCTATTATGTTTTATGAAAAAGTATTAGA
AGGAGAATTATTAGTTAAAGGAAGAAAATTGGCTTATTTTAACATATGTGGAGTATGGATAGCGCTTAATGAAGAGACGC
ATATTCCGAGAAATGAGGTTCATCAATCTTATACGCACATTGCATTTTCTGTTGAACAAGAAGACTTTAAATGTCTAATA
CAGCGATTAGAAGAAAATGATGTTCATATTTTACAAGGAAGAGAACGTGATGTAAGAGATTGCGAATCTATATACTTTGT
TGATCCTGACGGTCATAAATTTGAGTTTCACTCAGGGACACTGCAAGACCGTTTAAATTATTATAGAGATGAGAAACCTC
ATATGACATTTTATTAG

>>MEG_3011|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTTGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
AACTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>>MEG_3012|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTCGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
ATCTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGCCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>>MEG_3013|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTCGGCCTATTTTAATTTAGGTGATATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
ATCTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAATTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>>MEG_3014|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGA
GGCTGACATTTTAGTTGAAAGTGAGACCTCGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
AACTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA

>>MEG_3015|Drugs|Fosfomycin|Fosfomycin_thiol_transferases|FOSB
ATGATTAAAGGAATAAATCATATTACTTATTCGGTTTCTAATATAGCTAAATCAATTGAATTTTACAGAGATATTTTAGG
GGCTGACATTTTAGTTGAAAGTGAGACCTCGGCCTATTTTAATTTAGGTGGTATATGGTTAGCTTTGAACGAAGAAAAAA
ATATTCCTAGAAGCGAAATTAAATATTCGTATACTCATATAGCATTTACAATTTCAGATAACGATTTTGAAGATTGGTAT
AACTGGTTGAAAGAAAATGAAGTAAATATTCTTGAAGGTAGAGATAGAGATATTAGAGATAAAAAATCAATATATTTCAC
TGATTTAGATGGTCATAAATTAGAATTGCATACAGGAAGTTTAGAAGATAGATTGAGTTATTATAAAGAGGCTAAACCTC
ATATGAATTTTTATATTTAA