MEGAResFrom MEG, the Microbial Ecology Group

FOSA

The fosA gene encodes a glutathione transferase that catalyzes a reaction between the fosfomycin molecule and glutathione, rendering it ineffective as an antibiotic.

References

Other Groups in Fosfomycin thiol transferases

Sequences

Download Sequences

>Fos|fosA_5_NZ_AEXB01000013|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCCCTCAACCACCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTCACGTTCTGGCACGAGCTGCTGGG
GCTAGCGCTGTACGCCCGCTGGAATACCGGGGCCTATCTCACCTGCGGCGATCTCTGGGTCTGCCTGTCGTACGACGAGG
CGCGCCAGTACGTGCCGCCGCAGGAGAGCGACTACACCCACTACGCGTTTACCGTGGCGGAGGAGGATTTTGAACCGTTC
TCGCAAAGGCTTGAGCAGGCGGGCGTCACCGTCTGGAAGCAGAACAAAAGCGAGGGGGCGTCGTTCTATTTTCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGTCGCGAGAAGCCCTACGCGGGCA
TGGTGTTTACCTCAGACGAGGCTTGA

>Fos|fosA_15_CP002889|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GTGAAAGCCGCCTTTCGGCGGCTATCTGAAAATGGGGAAAACTACTCCGTGCCGCCTTTAAGAAGGCAGCCACCAGCGGT
TTACGGTGAGCACGGCGTGGTTTATGTTCATGAAGTTACCGTACCACGTCTGGCGCAAAAAACAAAAGGGCACGTCATGC
TGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTTACCTTCTGGCACGAGTTGCTGGGGCTG
ACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTTACCTGCGGCGATCTGTGGGTCTGCCTGTCCTATGACGAGGCGCG
CGGTTACGTGCCGCCGCAGGAGAGCGACTATACCCATTACGCGTTTACCGTTGCGGCGGAAGATTTTGAGCCGTTCTCGC
ACAAGCTGGAGCAGGCAGGCGTTACCGTCTGGAAGCAGAACAAAAGTGAGGGGGCATCGTTCTATTTTCTCGACCCGGAT
GGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGCCGGGAGAAACCCTATGCCGGAATGGT
CTTCACCTCAGACGAGGCTTGA

>CARD|phgb|KP143090|1199-1619|ARO:3003209|FosA5|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
TCACTCAGCAAAAAACACCATCCCCTTATACGGCTGCTCGCGGCAGGCGGCCAGACGCTGGGCGAGACTGCCGACGTGCA
GCTCCAGCTTATGGCCATCGGGATCGAGGAAATAGTGCGAAGCGCCTTCGCTACGGTTCAGCTTCCAGACCGCTACGCCG
GCAGCCTCAAGGCGGGCGGCGAAGCTAGCAAAATCGGCTTCGCTAATACTAAACGCATAATGGGTGTAGTCGCTCTCTTC
CGGCGGAGTAACGCGCCGCTGCGGATCCAGCGACAGGCACAGCCACAGATCGCCGCAGGAGAGATAAGCCCCGCTGTCCC
AGCGGGCATGCAGCATCATGCCCAGCAGCTGCTGATAAAACGCCACGCTCGGCGCCAGCTGGCTGACTGCCAGGGTCAGG
TGATTCAGTCCACTCAGCAT

>Fos|fosA_16_M85195|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTCACCTTCTGGCATGAGTTGCTGGG
GCTGACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTCACCTGCGGCGATCTGTGGGTCTGCCTGTCGTACGACGAGG
CGCGCCAGTACGTGCCGCCGCAGGAGAGTGACTACACCCACTACGCGTTTACCGTGGCGGAAGAGGATTTTGAACCGCTC
TCGCAAAGGCTTGAGCAGGCGGGCGTCACCATCTGGAAGCAGAACAAAAGCGAGGGGGCGTCGTTCTATTTCCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGTCGCGAGAAGCCCTATGCGGGCA
TGGTGTTTACCTCAGACGAGGCTTGA

>Fos|fosA_6_NZ_DS999363|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GTGATTTTAGGGCTCAACCATATAACCATTGCAGTTAGTGACTTAGAGCGCTCTCTTAAGTTTTATCGGGAGACGTTGGG
GTTCACTGCTCACGCTAAGTGGGACAACGGGGCTTACTTGTCGGTAGGTGAACTCTGGTTTTGCCTTTCTCACGATGAAC
CTTGCCCCAAAACCGACTATACCCACGTAGCTTTTGATATCGAACCAAAAGAATTTGAAGCCTTTGCGAAACGTGTAGTT
TCATTGGGTGTGGAAGTTTGGAAACAGAATAAGAGTGAAGGGCAGTCACTTTATATCTTAGACCCTGATGGTCATAAACT
AGAGATACACTCTGGCTCCCTTAAAAGCAGGTTAGAATCCCTAAGAACTAAGCTGTATAGTGGACTCGTTTGGCTTTAA

>Fos|fosA_13_EU487198|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAATCACTCAACCATCTGACCCTCGCGGTCAGCGACCTGCAAAAAAGCGTTACCTTCTGGCACGAGCTGCTGGG
GCTGACGCTGCACGCCCGCTGGAATACCGGGGCCTATCTTACCTGCGGCGATCTGTGGGTCTGCCTGTCCTATGACGAGG
CGCGCGGTTACGTGCCGCCGCAGGAGAGCGACTATACCCATTACGCGTTTACCGTTGCGGCGGAAGATTTTGAGCCGTTC
TCGCACAAGCTGGAGCAGGCGGGCGTTACCGTCTGGAAGCAAAACAAAAGTGAGGGGGCATCGTTCTATTTTCTCGACCC
GGACGGGCACAAGCTGGAGCTGCACGTGGGCAGCCTCGCCGCGCGGCTGGCGGCGTGCCGGGAGAAACCCTATGCCGGAA
TGGTCTTCACCTCAGACGAGGCTTGA

>1639|AB985401.1|AB985401|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCAGTTATTAGGTTCAGTGGCTTCCCCTTTTGTTCGTCGTTTACGTTTAGTACTGGCAGGGCAACCTTATCAGTTTGT
AGCGCTTAATATTTTTGAGTCTGAAGGCCGTTCAGTGTTGGTACAACATAATCCGGCACGCAAAGTGCCTGTGTTAGTGG
ATGGAGAGCAGGTTATTTTTGATTCAGGCGTAATTTATCGTTATTTGGCTTCGAAACTGAAATTCAAACCATTGAGCTGG
GATCAGGAAAACGGTCTGACGACCATCAATGCCTGCACAGACTCCTTGGTTGAATTACTGCTTTGTAAGCGCTCAGGTTT
TGACGTGACTGAAGATAAATTGTTTTTTAATCTTCAGCATGAGCGAATTCAGGCGACGCTAGAGGCACTTGAGCAACAAA
TCAGGGCAGGGCATTTCGGTGACTGGGACTATCCTGGTATCAGTCTGTTCACTTTAATCGACTGGATATTGTTCCGCGAT
TTAGTCGACTTAAAACCCTTCCCTGTATTATTACAGTTCAGAAATGCGCATTTAAACCGGCCGATGGTCGCTGAAACCGA
CCCGCGTTTAAGCTAA

>Fos|fosA_8_ACHE01000077|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGGAAATAACAAGTGTTAATCATATTTGTTTTTCAGTGAGTGATTTAAATACCTCTATACAATTTTATAAAGATATTTT
ACATGGTGACTTATTAGTATCAGGTAGAACGACAGCATATTTAACTATTGGTCATACTTGGATTGCACTGAATCAAGAAA
AAAATATACCAAGGAATGAAATAAGTCATTCCTATACGCACATTGCTTTCTCCATAGATGAAGAAGATTTTCAACAGTGG
ATTCAATGGCTTAAAGAGAATCAAGTAAATATTTTAAAAGGGCGACCAAGAGACATTAAAGACAAAAAATCGATATATTT
TACAGATCCGGATGGGCATAAAATTGAATTACATACTGGAACATTAAAAGATAGAATGGAATATTATAAATGTGAGAACA
CGCATATGCAATTTTACGATGAGTTTTGA

>Fos|fosA_10_EU195449|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGATGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTAGCGGTCTGGAAGCTGAACCGTAGCGAAGGCGCTTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAGCAGCCGTATAAGGGGA
TGGTGTTTTTTGCTGAGTGA

>Fos|fosA_1_NZ_ACWU01000146|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTCACCGGTCTCAATCACCTGACCCTGGCGGTCGCCGATCTGCCGGCCAGCATCGCCTTCTACCGCGATCTTCTCGG
CTTTCGCCTGGAAGCGCGCTGGGACCAGGGCGCCTATCTCGAACTGGGTTCGCTGTGGCTGTGCCTGTCCCGGGAGCCGC
AGTACGGCGGGCCGGCCGCGGACTACACGCACTACGCCTTCGGCATCGCCGCCGCGGATTTCGCCCGCTTCGCCGCGCAG
CTGCGCGCGCATGGCGTGCGCGAATGGAAGCAGAACCGCAGCGAGGGCGATTCGTTCTACTTCCTCGACCCGGACGGCCA
TCGCCTGGAGGCCCACGTCGGCGACCTGCGCAGCCGGCTCGCGGCGTGCCGGCAAGCGCCCTATGCGGGAATGCGTTTCG
CCGACTAG

>Fos|fosA_3_NZ_ACWO01000079|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAAGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTATTTCCTCGATCC
CGATGGCCATAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGTCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGCTGAGTGA

>CARD|phgb|FN543093|2365648-2366056|ARO:3000149|FosA|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
TTAATCATAAAACCGCATTCCTTTATAGGGCGCGGCGCGGCAGGCGGCGAGCCGGGTGGCGAGGCTGCCGACGTGCAGCT
CAAGCTGATGCCCGTCCGGGTCGAGAAAATACCAGGAGTCGCCCTCGCTGCGGTTGGTTTTCCAGGGCGTTACGCCCGCG
GCGGTCAGTGTTTCCACTACCTGCGGGAAATCCGCCTCACTTACGGTAAACGCATAATGCGTGTAGTCCGCGGCAGGCGA
ACCGGCATTTTCATCCAGCGACAGACACAGCCACAGAGAGCCGCACGAAAGATATGCCCCGCCGTCCCAGCGCGCATGCA
GTCGCAGCCCCGGCAGCGACTGGTAAAACGCAAGGCTTCGCGCCACATCGCGCACCGCGAGCGTCAGGTGATTAAGCCCG
CTGAGCATG

>1019|JQ343850.1|JQ343850|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGCAGGGATTGAATCATCTGACGCTGGCGGTCAGCGATCTGGCGTCAAGCCTGGCATTTTATCAGCAGTTACCTGG
AATGCGCCTGCACGCCAGCTGGGATAGCGGAGCCTATCTCTCCTGTGGGGCGCTGTGGCTGTGCTTGTCGCTGGATGAGC
AGCGGCGTAAAACGCCCCCTCAGGAAAGCGACTATACCCACTACGCCTTCAGCGTGGCGGAAGAAGAGTTTGCCGGGGTG
GTGGCTCTGCTGGCGCAGGCGGGGGCTGAGGTATGGAAAGATAACCGCAGTGAAGGGGCGTCTTACTATTTTCTCGACCC
TGACGGCCATAAGCTGGAGCTGCATGTGGGGAATCTGGCGCAGCGGCTGGCCGCCTGTCGCGAACGCCCCTACAAGGGGA
TGGTCTTTTTTGATTGA

>Fos|FN543093.2|gene2318|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTCAGCGGGCTTAATCACCTGACGCTCGCGGTGCGCGATGTGGCGCGAAGCCTTGCGTTTTACCAGTCGCTGCCGGG
GCTGCGACTGCATGCGCGCTGGGACGGCGGGGCATATCTTTCGTGCGGCTCTCTGTGGCTGTGTCTGTCGCTGGATGAAA
ATGCCGGTTCGCCTGCCGCGGACTACACGCATTATGCGTTTACCGTAAGTGAGGCGGATTTCCCGCAGGTAGTGGAAACA
CTGACCGCCGCGGGCGTAACGCCCTGGAAAACCAACCGCAGCGAGGGCGACTCCTGGTATTTTCTCGACCCGGACGGGCA
TCAGCTTGAGCTGCACGTCGGCAGCCTCGCCACCCGGCTCGCCGCCTGCCGCGCCGCGCCCTATAAAGGAATGCGGTTTT
ATGATTAA

>1434|AB522969.1|AB522969|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
GTGTTACGAGGATTGAATCATATTACTATTGCAGTAAGTGACCTTGAACGTTCCGTGGAGTTCTATACGCGTCTATTAGG
AATGAAGGCACATGTCCGCTGGGATAGTGGGGCATATCTGAGCTTGGAGGCTACTTGGATTTGCTTGTCTTGTGACGAAG
TGCATCCGAGCCAAGATTACTGTCACATCGCGTTTGATGTTTCCGAAGAGAATTTCGAACCAGTTACTAAAAAGCTTCGC
GAAGCACATGTCGTTGAATGGAAACAAAATAGAAGCGAAGGACTTTCTTTATACTTGCTCGATCCTGACGGCCATAAATT
GGAAATCCATAGCGGTAGCCTACAAAGTCGTTTGGAATCGTTGAAGTCTAAACCCTATCAAGGGTTAGTATGGCTATAA

>Fos|fosA_2_AGDM01000012|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGTTAAGCGGATTGAATCATCTGACCCTGGCGGTCAGCAGCCTGGCGCCGAGCGTGGCGTTTTATCACCAGCTGCTGGG
GATGACGCTGCACGCGCGCTGGGACGGCGGGGCCTATCTCTCCTGCGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTCACTCCGCCGGAAGAGAGCGACTATACCCACTACGCCTTTAGCGTCGCCGAAGCCGACTTCGCCGGGTTC
AGCGCGCGGCTGGAAACGGCCGGGGTGGCGGTGTGGAAGGTGAACCGCAGCGAAGGGGCGTCTTATTACTTCCTCGATCC
TGACGGCCACAAGCTGGAGCTGCACGTCGGCAGCCTCGCCCTGCGCCTGGCGGCGTGCCGCGAGCAGCCGTATAAAGGGA
TGGTGTTTTATGACGAGTGA

>Fos|fosA_7_NZ_AFBO01000747|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTGCTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCTTATCTCTCCTGCGGCGATTTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGACGAGAGCGACTACACCCATTATGCGTTTAGTATTAGCGAAGCCGATTTTGCTAGCTTC
GCCGTCCGCCTTGAGGCTGCCGGCGTGGCGATGTGGAAGCTGAACCGTAGCGAAGGTGCCTCGCACTACTTTCTCGACCC
CGACGGCCACAAGCTGGAGCTGCACGTCGGCAGTCTTGCCCAGCGGCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGATCAGTGA

>Fos|fosA_9_NZ_ACZD01000244|Fosfomycin|Fosfomycin_thiol_transferases|FOSA
ATGCTGAGTGGACTGAATCACCTGACCCTGGCAGTCAGCCAGCTGGCGCCGAGCGTGGCGTTTTATCAGCAGCTACTGGG
CATGACGCTGCATGCCCGCTGGGACAGCGGGGCCTATCTTTCCTGTGGCGATCTGTGGCTGTGCCTGTCGCTGGATCCGC
AGCGGCGCGTTACTCCGCCGGAGGAGAGCGACTACACCCATTATGCGTTTAGCATTAGCGAGGCGGATTTCGCTAGCTTC
GCCGCCCGCCTTGAGGCTGCCGGCGTGGCGATCTGGAAGCTGAACCGTAGCGAAGGCGCTTCGCACTACTTTCTCGATCC
CGATGGCCACAAGCTGGAGCTGCACGTCGGCAGTCTCGCCCAGCGGCTGGCCGCCTGCCGCGAACAGCCGTATAAGGGGA
TGGTGTTTTTTGATCAGTGA