MEGAResFrom MEG, the Microbial Ecology Group

PTSL

The PTSL group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

References

    Other Groups in Fosfomycin target mutation

    Sequences

    Download Sequences

    >>MEG_5819|Drugs|Fosfomycin|Fosfomycin_target_mutation|PTSL|RequiresSNPConfirmation
    ATGATTTCAGGCATTTTAGCATCCCCGGGTATCGCTTTCGGTAAAGCTCTGCTTCTGAAAGAAGACGAAATTGTCATTGA
    CCGGAAAAAAATTTCTGCCGACCAGGTTGATCAGGAAGTTGAACGTTTTCTGAGCGGTCGTGCCAAGGCATCAGCCCAGC
    TGGAAACGATCAAAACGAAAGCTGGTGAAACGTTCGGTGAAGAAAAAGAAGCCATCTTTGAAGGGCATATTATGCTGCTC
    GAAGATGAGGAGCTGGAGCAGGAAATCATAGCCCTGATTAAAGATAAGCACATGACAGCTGACGCAGCTGCTCATGAAGT
    TATCGAAGGTCAGGCTTCTGCCCTGGAAGAGCTGGATGATGAATACCTGAAAGAACGTGCGGCTGACGTACGTGATATCG
    GTAAGCGCCTGCTGCGCAACATCCTGGGCCTGAAGATTATCGACCTGAGCGCCATTCAGGATGAAGTCATTCTGGTTGCC
    GCTGACCTGACGCCGTCCGAAACCGCACAGCTGAACCTGAAGAAGGTGCTGGGTTTCATCACCGACGCGGGTGGCCGTAC
    TTCCCACACCTCTATCATGGCGCGTTCTCTGGAACTACCTGCTATCGTGGGTACCGGTAGCGTCACCTCTCAGGTGAAAA
    ATGACGACTATCTGATTCTGGATGCCGTAAATAATCAGGTTTACGTCAATCCAACCAACGAAGTTATTGATAAAATGCGC
    GCTGTTCAGGAGCAAGTGGCTTCTGAAAAAGCAGAGCTTGCTAAACTGAAAGATCTGCCAGCTATTACGCTGGACGGTCA
    CCAGGTAGAAGTATGCGCTAACATTGGTACGGTTCGTGACGTTGAAGGTGCAGAGCGTAACGGCGCTGAAGGCGTTGGTC
    TGTATCGTACTGAGTTCCTGTTCATGGACCGCGACGCACTGCCCACTGAAGAAGAACAGTTTGCTGCTTACAAAGCAGTG
    GCTGAAGCGTGTGGCTCGCAAGCGGTTATCGTTCGTACCATGGACATCGGCGGCGACAAAGAGCTGCCATACATGAACTT
    CCCGAAAGAAGAGAACCCGTTCCTCGGCTGGCGCGCTATCCGTATCGCGATGGATCGTAGAGAGATCCTGCGCGATCAGC
    TCCGCGCTATCCTGCGTGCCTCGGCTTTCGGTAAATTGCGCATTATGTTCCCGATGATCATCTCTGTTGAAGAAGTGCGT
    GCACTGCGCAAAGAGATCGAAATCTACAAACAGGAACTGCGCGACGAAGGTAAAGCGTTTGACGAGTCAATTGAAATCGG
    CGTAATGGTGGAAACACCGGCTGCCGCAACAATTGCACGTCATTTAGCCAAAGAAGTTGATTTCTTTAGTATCGGCACCA
    ATGATTTAACGCAGTACACTCTGGCAGTTGACCGTGGTAATGATATGATTTCACACCTTTACCAGCCAATGTCACCGTCC
    GTGCTGAACTTGATCAAGCAAGTTATTGATGCTTCTCATGCTGAAGGCAAATGGACTGGCATGTGTGGTGAGCTTGCTGG
    CGATGAACGTGCTACACTTCTGTTGCTGGGGATGGGTCTGGACGAATTCTCTATGAGCGCCATTTCTATCCCGCGCATTA
    AGAAGATTATCCGTAACACGAACTTCGAAGATGCGAAGGTGTTAGCAGAGCAGGCTCTTGCTCAACCGACAACGGACGAG
    TTAATGACGCTGGTTAACAAGTTCATTGAAGAAAAAACAATCTGCTAA