MEGAResFrom MEG, the Microbial Ecology Group

MURA

The MURA group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

Other Groups in Fosfomycin target mutation

Sequences

Download Sequences

>MEG_4095|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
ATGCATAGTTATATTGTAGAAGGCGGCTATAAGATAGGTGGTCAAATTACAGCTAGTGGGAATAAGAACGCTGCTTTACC
CTGTATTTTGGCTGCTTTACTTACCGATGAAGAGGTTATTTTAGAAAATATTCCTAATATTAATGATGTAAAAGTTGTTT
TAGATATTTTAAATGACATAGGAGCAGATATTGCAAGAGAGGGAAATACTTTAAAAATAAAAGTTTTAAATATTGTGAAA
ACAGAAATAGATTCTTCTTTTACAGATTTAATTAGGGCTTCCATACTTTTATTAGGGCCTTTTGTTTCTAGGTTTGGAAA
AATAGATATGGCGCTTCCAGGAGGAGATGTGATTGGAAAGAGGAGGCTTGATACTCATTTTTACGGGCTTTGCAAGCTGG
GGGCCAAGTTAAGCACAAAAGATAGAAGGATTGTTTTAAAGGCTAACAAGCTTGTTGGCGCTGAAATGTTTTTAGATGAA
GCTTCTGTTACAGCCACAGAAAATATCATTATGGCTGCAGTTCTTGCTGAAGGAAATACTGTTATTATGAACGCTGCTTG
TGAGCCACATGTTCAAGATTTGTGTAATATGTTAAATTCAATGGGCGCTAATATTTTAGGAATTGGTTCAAATGTTTTAG
AAATAAAAGGTGTAAAAAAATTAAGTGGGACCGTATTTAGAATAGGAGCCGATTTCATGCAAGTTGGTTCTTTAATTAGC
CTTGCTGCATTAACAGGGGGTGAGTTGGAAATTAAAAAAGCAGATCCCCAACATTTCAGATTAATTAGGCATGTATATTC
AAGACTTGGCATTAATTTTGAATATGACAGGGAAAATGTATATGTAAGAAATAAACAAGAATTAAAAGTTAAGTTAGATT
TTGGTGGGCACATTCCAAAAATTGATGATGGCCCATGGCCAGCCTTTCCAACAGACCTTATGAGTATTATTGTAGTTACT
GCAACGCAAGTAGAAGGCACAGTTTTAGTTTTTGAGAAGATGTTTGAATCTAGGATGTTTTTTGTAGATAAATTAATAAA
AATGGGTGCTCGAATTGTGCTTTGTGATCCACACCGCGTAGTAGTTACGGGCAAATCTTCTCTTAAAGGCAATGTTTTGT
CTTCTCCGGATGTACGAGCGGGAATGTCTCTTCTTATTGCTGCTTTTGTTGCTGAAGGTCGCAGCGAGATTCAAAATGTT
TATCAAATTGAAAGAGGATACGAAGATGTAGTTAACAAATTGATTAATTTGGGTGCAAAAATCAAGAAAGTTAAAAGTCA
ATAG

>MEG_4096|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
ATGGATAAAATAGTAATCAAAGGTGGAAATAAATTAACGGGTGAAGTTAAAGTAGAAGGTGCTAAAAATGCAGTATTACC
TATATTAACAGCATCTTTATTAGCTTCTGATAAACCGAGCAAATTAGTTAATGTTCCAGCTTTAAGTGATGTAGAAACAA
TAAATAATGTATTAACAACCTTAAATGCTGACGTTACATACAAAAAGGACGAAAATGCTGTTGTCGTTGATGCAACAAAG
ACTCTAAATGAAGAGGCACCATATGAATATGTTAGTAAAATGCGTGCAAGTATTTTAGTTATGGGACCTCTTTTAGCAAG
ACTAGGACATGCTATTGTTGCATTGCCTGGTGGTTGTGCAATTGGAAGTAGACCGATTGAGCAACACATTAAAGGTTTTG
AAGCTTTAGGCGCAGAAATTCATCTTGAAAATGGTAATATTTATGCTAATGCTAAAGATGGATTAAAAGGTACATCAATT
CATTTAGATTTTCCAAGTGTAGGAGCAACACAAAATATTATTATGGCAGCATCATTAGCTAAGGGTAAGACTTTAATTGA
AAATGCAGCTAAAGAACCTGAAATTGTTGATTTAGCAAACTACATTAATGAAATGGGCGGTAGAATTACTGGTGCTGGTA
CAGACACAATTACAATCAATGGTGTAGAATCATTACATGGTGTAGAACATGCTATCATTCCAGATAGAATTGAAGCAGGC
ACATTACTGATCGCTGGTGCCATTACTCGTGGCGATATTTTTGTACGTGGTGCAATCAAAGAACATATGGCTAGTTTAGT
GTATAAATTAGAAGAAATGGGCGTTGAATTGGAATATCAAGAAGATGGTATTCGTGTACGTGCTGAAGGAGATTTACAGC
CTGTTGACATCAAAACATTACCGCATCCTGGTTTTCCAACCGATATGCAGTCACAAATGATGGCATTATTATTAACAGCA
AACGGACATAAAGTAGTAACTGAAACTGTATTTGAAAATCGTTTTATGCATGTCGCAGAGTTCAAACGTATGAATGCTAA
TATCAATGTAGAAGGTCGTAGTGCTAAACTTGAAGGTAAAAGTCAATTGCAAGGTGCACAAGTTAAAGCGACTGATTTAA
GAGCAGCAGCAGCCTTAATTTTAGCTGGATTAGTTGCTGATGGTAAAACAAGCGTTACTGAATTAACGCACCTAGATAGA
GGCTATGTTGACTTACACGGTAAATTGAAGCAATTAGGTGCAGACATTGAACGTATTAACGATTAA

>MEG_4097|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
ATGGATAAATTTCGTGTTCAGGGGCCAACGAAGCTCCAGGGCGAAGTCACAATTTCCGGCGCTAAAAATGCTGCTCTGCC
TATCCTTTTTGCCGCACTACTGGCGGAAGAACCGGTAGAGATCCAGAACGTCCCGAAACTAAAAGACGTCGATACATCAA
TGAAGCTGCTAAGCCAGCTGGGTGCGAAAGTAGAACGTAATGGTTCTGTGCATATTGATGCCCGCGACGTTAATGTATTC
TGCGCACCTTACGATCTGGTTAAAACCATGCGTGCTTCTATCTGGGCGCTGGGGCCGCTGGTAGCGCGCTTTGGTCAGGG
GCAAGTTTCACTGCCTGGCGGTTGTACGATCGGCGCACGTCCGGTTGATCTACACATTTCTGGCCTCGAACAATTAGGCG
CGACCATCAAACTGGAAGAAGGTTACGTTAAAGCTTCCGTCGATGGTCGTTTGAAAGGCGCACATATCGTGATGGATAAA
GTCAGCGTTGGCGCAACGGTGACCATCATGTGTGCTGCAACCCTTGCGGAAGGCACCACGATTATTGAAAACGCAGCGCG
TGAACCGGAAATCGTCGATACCGCGAACTTCCTGATTACGCTGGGTGCGAAAATTAGCGGTCAGGGCACCGATCGTATCG
TCATCGAAGGTGTGGAACGTTTAGGCGGCGGTGTCTATCGCGTGCTGCCGGATCGTATCGAAACCGGTACTTTCCTGGTG
GCGGCGGCGATCTCTCGCGGCAAAATTATCTGCCGTAACGCGCAGCCAGATACTCTGGACGCCGTGCTGGCGAAACTGCG
TGACGCTGGAGCGGACATCGAAGTCGGCGAGGACTGGATTAGCCTGGATATGCATGGCAAACGTCCGAAGGCTGTTAACG
TACGTACCGCGCCGCATCCGGCATTCCCTACCGATATGCAGGCCCAGTTCACGCTGTTGAACCTGGTGGCAGAAGGGACC
GGATTCATCACCGAAACGGTCTTTGAAAACCGCTTTATGCATGTGCCAGAGCTGAGCCGTATGGGCGCGCACGCCGAAAT
CGAAAGCAATACCGTTATTTGTCACGGTGTTGAAAAACTTTCTGGCGCACAGGTTATGGCAACCGATCTGCGTGCATCAG
CAAGCCTGGTGCTGGCTGGCTGTATTGCGGAAGGGACGACGGTGGTTGATCGTATTTATCACATCGATCGTGGCTACGAA
CGCATTGAAGACAAACTACGCGCTTTAGGTGCAAATATTGAGCGTGTGAAAGGCGAGTAA

>MEG_4098|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
GTGGCCGAGCGTTTCGTCGTGACTGGGGGCAACCGGTTATCAGGCGAAGTGGCCGTCGGCGGCGCCAAGAACAGCGTGCT
CAAGCTCATGGCTGCGACGTTGTTGGCCGAGGGCACCAGCACGATCACCAACTGTCCCGACATCCTCGATGTGCCGCTGA
TGGCGGAGGTACTGCGTGGTCTGGGCGCCACCGTCGAACTCGACGGTGACGTGGCCCGGATCACCGCACCTGACGAGCCG
AAGTACGATGCCGACTTCGCTGCGGTGCGGCAATTCCGCGCCTCGGTCTGTGTGCTGGGACCGCTGGTCGGGCGGTGCAA
ACGGGCCAGGGTCGCGCTGCCGGGCGGTGACGCGATCGGGTCGCGTCCGTTGGATATGCACCAGGCGGGCCTACGGCAAT
TGGGTGCCCACTGCAACATCGAGCACGGCTGCGTGGTAGCCCGAGCGGAAACGTTGCGCGGTGCGGAGATTCAGTTGGAG
TTCCCCTCGGTGGGAGCCACCGAGAACATCTTGATGGCCGCCGTGGTGGCCGAGGGAGTCACCACTATTCACAATGCGGC
TCGAGAACCCGACGTCGTCGACTTGTGCACGATGTTGAACCAGATGGGCGCACAGGTCGAAGGTGCGGGTTCGCCGACAA
TGACCATCACCGGTGTCCCGCGGCTGCATCCAACCGAGCACCGGGTGATCGGAGACCGTATCGTTGCCGCCACATGGGGC
ATCGCTGCCGCAATGACCCGTGGTGATATATCAGTGGCGGGCGTAGACCCGGCGCATCTGCAGCTGGTGCTGCACAAATT
GCACGACGCGGGCGCAACCGTCACCCAGACTGACGCCAGCTTCCGGGTGACCCAGTACGAGCGTCCGAAGGCTGTCAACG
TTGCGACCTTGCCGTTCCCCGGGTTTCCCACGGATCTGCAGCCGATGGCTATCGCTTTGGCGTCGATCGCCGACGGCACA
TCGATGATCACGGAGAACGTGTTCGAGGCGCGGTTCCGCTTCGTTGAAGAGATGATCCGGCTCGGTGCAGACGCTCGGAC
CGACGGGCACCACGCCGTGGTGCGGGGCCTCCCGCAGCTGTCGAGCGCTCCGGTGTGGTGTTCGGACATCCGTGCCGGGG
CCGGCTTGGTGCTGGCGGGGCTCGTTGCCGACGGCGACACCGAGGTCCACGATGTATTCCACATCGATCGCGGATATCCG
TTGTTCGTGGAGAACCTGGTGAGTCTCGGTGCCGAGATCGAACGGGTATGCTGTTAG

>MEG_4099|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA
ATGCCTGGTATCAAGGTTTTTGGAGAAACGGTCTTAAGAGGATCTGTGCGCGTGTCAGGAGCTAAAAATGCTACAACTAA
ATTACTTGTAGCCTCCTTACTTTCGGATCAGCGAACGATTTTAAAGAACGTCCCTAATATTGAAGATGTTCGGCAAACGG
TAGATCTTTGTCGGGTTTTAGGGGCGATTGTAGAGTGGGATCAGCAAGCGCAAGTGATTGAAATTCACACTCCGCGCATT
TTATTGTCCAAGGTTCCTCCGCAATTTTCTTGTGTTAATCGGATTCCTATTTTGCTGTTAGGAGCGTTGTTACGTCGTTG
TCCTTATGGGATTTTTGTTCCTATTTTGGGAGGGGATGCTATAGGACCTCGTACGCTACATTTCCATTTAGAAGGATGGA
AGAAGCTTGGAGCAGAGATAGTAATTAGTGATGAAGGCTATTGGGCTTCAGCTCCAAATGGTCTTGTTGGAGCACACATC
ACGTTACCCTACCCTTCTGTGGGAGCCACAGAAAACCTCATCCTTGCTTCTGTAGGGGCTCAAGGACGAACGATTATTAA
GAATGCTGCTCTTGAAGTGGAAATCATTGATTTGATTGTCTTTTTACAGAAAGCAGGCGTGGAGATTACAACAGATAATG
ATAAGACCATCGAAATTTTTGGATGTCAGGATTTCTATTCTGTTGAGCACTTCATTATTCCAGATAAAATCGAGGCTGCT
TCTTTCGGTATGGCTGCGGTAGTTTCTCAGGGAAGGATCTTCGTAGAACAAGCGCGCCATGAGCATATGATCCCTTTTTT
AAAGGTATTAAGATCGATAGGAGGGGGATTCTCTGTACATGAGAATGGGATCGAATTTTTCTACGATAAGCCTTTGAAAG
GGGGTGTTCTTCTAGAAACGGATGTGCATCCAGGGTTTATTACAGATTGGCAACAACCTTTTGCCGTATTGCTCTCTCAG
TCAGAAGGTTGTTCGGTGATCCATGAGACAGTGCATGAGAATCGTCTTGGGTATTTGAAAGGTTTGGTAAAAATGGGAGC
GCATTGTGATTTATTTCACGAGTGTTTGAGTGCTAAGTCGTGTCGCTATTCTACAGGGAATCATCCTCATAGCGCAGTCA
TTCATGGTCCGACTCCTTTGCAGGCAACAGACTTAGTGATTCCTGATTTGCGCGCAGGATTTGCTTATGTCATGGCCGCA
CTCATTGCAGAAGGCGGAGCCTCATGGATTGAGAATACCGAGATGCTGGATCGAGGGTACACTGATTGGCGAGGGAAATT
AGAAAGATTAGGAGCTAAGGTTTTAGCGCGAGACGCAGTATCTGTGTATGTTTAA