MEGAResFrom MEG, the Microbial Ecology Group

MURA

The MURA group of genes confer resistance to Fosfomycin through the mechanism, Fosfomycin target mutation.

References

    Other Groups in Fosfomycin target mutation

    Sequences

    Download Sequences

    >>MEG_4092|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
    ATGCATAGTTATATTGTAGAAGGCGGCTATAAGATAGGTGGTCAAATTACAGCTAGTGGGAATAAGAACGCTGCTTTACC
    CTGTATTTTGGCTGCTTTACTTACCGATGAAGAGGTTATTTTAGAAAATATTCCTAATATTAATGATGTAAAAGTTGTTT
    TAGATATTTTAAATGACATAGGAGCAGATATTGCAAGAGAGGGAAATACTTTAAAAATAAAAGTTTTAAATATTGTGAAA
    ACAGAAATAGATTCTTCTTTTACAGATTTAATTAGGGCTTCCATACTTTTATTAGGGCCTTTTGTTTCTAGGTTTGGAAA
    AATAGATATGGCGCTTCCAGGAGGAGATGTGATTGGAAAGAGGAGGCTTGATACTCATTTTTACGGGCTTTGCAAGCTGG
    GGGCCAAGTTAAGCACAAAAGATAGAAGGATTGTTTTAAAGGCTAACAAGCTTGTTGGCGCTGAAATGTTTTTAGATGAA
    GCTTCTGTTACAGCCACAGAAAATATCATTATGGCTGCAGTTCTTGCTGAAGGAAATACTGTTATTATGAACGCTGCTTG
    TGAGCCACATGTTCAAGATTTGTGTAATATGTTAAATTCAATGGGCGCTAATATTTTAGGAATTGGTTCAAATGTTTTAG
    AAATAAAAGGTGTAAAAAAATTAAGTGGGACCGTATTTAGAATAGGAGCCGATTTCATGCAAGTTGGTTCTTTAATTAGC
    CTTGCTGCATTAACAGGGGGTGAGTTGGAAATTAAAAAAGCAGATCCCCAACATTTCAGATTAATTAGGCATGTATATTC
    AAGACTTGGCATTAATTTTGAATATGACAGGGAAAATGTATATGTAAGAAATAAACAAGAATTAAAAGTTAAGTTAGATT
    TTGGTGGGCACATTCCAAAAATTGATGATGGCCCATGGCCAGCCTTTCCAACAGACCTTATGAGTATTATTGTAGTTACT
    GCAACGCAAGTAGAAGGCACAGTTTTAGTTTTTGAGAAGATGTTTGAATCTAGGATGTTTTTTGTAGATAAATTAATAAA
    AATGGGTGCTCGAATTGTGCTTTGTGATCCACACCGCGTAGTAGTTACGGGCAAATCTTCTCTTAAAGGCAATGTTTTGT
    CTTCTCCGGATGTACGAGCGGGAATGTCTCTTCTTATTGCTGCTTTTGTTGCTGAAGGTCGCAGCGAGATTCAAAATGTT
    TATCAAATTGAAAGAGGATACGAAGATGTAGTTAACAAATTGATTAATTTGGGTGCAAAAATCAAGAAAGTTAAAAGTCA
    ATAG

    >>MEG_4093|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
    ATGCCTGGTATCAAGGTTTTTGGAGAAACGGTCTTAAGAGGATCTGTGCGCGTGTCAGGAGCTAAAAATGCTACAACTAA
    ATTACTTGTAGCCTCCTTACTTTCGGATCAGCGAACGATTTTAAAGAACGTCCCTAATATTGAAGATGTTCGGCAAACGG
    TAGATCTTTGTCGGGTTTTAGGGGCGATTGTAGAGTGGGATCAGCAAGCGCAAGTGATTGAAATTCACACTCCGCGCATT
    TTATTGTCCAAGGTTCCTCCGCAATTTTCTTGTGTTAATCGGATTCCTATTTTGCTGTTAGGAGCGTTGTTACGTCGTTG
    TCCTTATGGGATTTTTGTTCCTATTTTGGGAGGGGATGCTATAGGACCTCGTACGCTACATTTCCATTTAGAAGGATGGA
    AGAAGCTTGGAGCAGAGATAGTAATTAGTGATGAAGGCTATTGGGCTTCAGCTCCAAATGGTCTTGTTGGAGCACACATC
    ACGTTACCCTACCCTTCTGTGGGAGCCACAGAAAACCTCATCCTTGCTTCTGTAGGGGCTCAAGGACGAACGATTATTAA
    GAATGCTGCTCTTGAAGTGGAAATCATTGATTTGATTGTCTTTTTACAGAAAGCAGGCGTGGAGATTACAACAGATAATG
    ATAAGACCATCGAAATTTTTGGATGTCAGGATTTCTATTCTGTTGAGCACTTCATTATTCCAGATAAAATCGAGGCTGCT
    TCTTTCGGTATGGCTGCGGTAGTTTCTCAGGGAAGGATCTTCGTAGAACAAGCGCGCCATGAGCATATGATCCCTTTTTT
    AAAGGTATTAAGATCGATAGGAGGGGGATTCTCTGTACATGAGAATGGGATCGAATTTTTCTACGATAAGCCTTTGAAAG
    GGGGTGTTCTTCTAGAAACGGATGTGCATCCAGGGTTTATTACAGATTGGCAACAACCTTTTGCCGTATTGCTCTCTCAG
    TCAGAAGGTTGTTCGGTGATCCATGAGACAGTGCATGAGAATCGTCTTGGGTATTTGAAAGGTTTGGTAAAAATGGGAGC
    GCATTGTGATTTATTTCACGAGTGTTTGAGTGCTAAGTCGTGTCGCTATTCTACAGGGAATCATCCTCATAGCGCAGTCA
    TTCATGGTCCGACTCCTTTGCAGGCAACAGACTTAGTGATTCCTGATTTGCGCGCAGGATTTGCTTATGTCATGGCCGCA
    CTCATTGCAGAAGGCGGAGCCTCATGGATTGAGAATACCGAGATGCTGGATCGAGGGTACACTGATTGGCGAGGGAAATT
    AGAAAGATTAGGAGCTAAGGTTTTAGCGCGAGACGCAGTATCTGTGTATGTTTAA

    >>MEG_4094|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
    ATGGATAAAATAGTAATCAAAGGTGGAAATAAATTAACGGGTGAAGTTAAAGTAGAAGGTGCTAAAAATGCAGTATTACC
    TATATTAACAGCATCTTTATTAGCTTCTGATAAACCGAGCAAATTAGTTAATGTTCCAGCTTTAAGTGATGTAGAAACAA
    TAAATAATGTATTAACAACCTTAAATGCTGACGTTACATACAAAAAGGACGAAAATGCTGTTGTCGTTGATGCAACAAAG
    ACTCTAAATGAAGAGGCACCATATGAATATGTTAGTAAAATGCGTGCAAGTATTTTAGTTATGGGACCTCTTTTAGCAAG
    ACTAGGACATGCTATTGTTGCATTGCCTGGTGGTTGTGCAATTGGAAGTAGACCGATTGAGCAACACATTAAAGGTTTTG
    AAGCTTTAGGCGCAGAAATTCATCTTGAAAATGGTAATATTTATGCTAATGCTAAAGATGGATTAAAAGGTACATCAATT
    CATTTAGATTTTCCAAGTGTAGGAGCAACACAAAATATTATTATGGCAGCATCATTAGCTAAGGGTAAGACTTTAATTGA
    AAATGCAGCTAAAGAACCTGAAATTGTTGATTTAGCAAACTACATTAATGAAATGGGCGGTAGAATTACTGGTGCTGGTA
    CAGACACAATTACAATCAATGGTGTAGAATCATTACATGGTGTAGAACATGCTATCATTCCAGATAGAATTGAAGCAGGC
    ACATTACTGATCGCTGGTGCCATTACTCGTGGCGATATTTTTGTACGTGGTGCAATCAAAGAACATATGGCTAGTTTAGT
    GTATAAATTAGAAGAAATGGGCGTTGAATTGGAATATCAAGAAGATGGTATTCGTGTACGTGCTGAAGGAGATTTACAGC
    CTGTTGACATCAAAACATTACCGCATCCTGGTTTTCCAACCGATATGCAGTCACAAATGATGGCATTATTATTAACAGCA
    AACGGACATAAAGTAGTAACTGAAACTGTATTTGAAAATCGTTTTATGCATGTCGCAGAGTTCAAACGTATGAATGCTAA
    TATCAATGTAGAAGGTCGTAGTGCTAAACTTGAAGGTAAAAGTCAATTGCAAGGTGCACAAGTTAAAGCGACTGATTTAA
    GAGCAGCAGCAGCCTTAATTTTAGCTGGATTAGTTGCTGATGGTAAAACAAGCGTTACTGAATTAACGCACCTAGATAGA
    GGCTATGTTGACTTACACGGTAAATTGAAGCAATTAGGTGCAGACATTGAACGTATTAACGATTAA

    >>MEG_4095|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
    ATGGATAAATTTCGTGTTCAGGGGCCAACGAAGCTCCAGGGCGAAGTCACAATTTCCGGCGCTAAAAATGCTGCTCTGCC
    TATCCTTTTTGCCGCACTACTGGCGGAAGAACCGGTAGAGATCCAGAACGTCCCGAAACTAAAAGACGTCGATACATCAA
    TGAAGCTGCTAAGCCAGCTGGGTGCGAAAGTAGAACGTAATGGTTCTGTGCATATTGATGCCCGCGACGTTAATGTATTC
    TGCGCACCTTACGATCTGGTTAAAACCATGCGTGCTTCTATCTGGGCGCTGGGGCCGCTGGTAGCGCGCTTTGGTCAGGG
    GCAAGTTTCACTGCCTGGCGGTTGTACGATCGGCGCACGTCCGGTTGATCTACACATTTCTGGCCTCGAACAATTAGGCG
    CGACCATCAAACTGGAAGAAGGTTACGTTAAAGCTTCCGTCGATGGTCGTTTGAAAGGCGCACATATCGTGATGGATAAA
    GTCAGCGTTGGCGCAACGGTGACCATCATGTGTGCTGCAACCCTTGCGGAAGGCACCACGATTATTGAAAACGCAGCGCG
    TGAACCGGAAATCGTCGATACCGCGAACTTCCTGATTACGCTGGGTGCGAAAATTAGCGGTCAGGGCACCGATCGTATCG
    TCATCGAAGGTGTGGAACGTTTAGGCGGCGGTGTCTATCGCGTGCTGCCGGATCGTATCGAAACCGGTACTTTCCTGGTG
    GCGGCGGCGATCTCTCGCGGCAAAATTATCTGCCGTAACGCGCAGCCAGATACTCTGGACGCCGTGCTGGCGAAACTGCG
    TGACGCTGGAGCGGACATCGAAGTCGGCGAGGACTGGATTAGCCTGGATATGCATGGCAAACGTCCGAAGGCTGTTAACG
    TACGTACCGCGCCGCATCCGGCATTCCCTACCGATATGCAGGCCCAGTTCACGCTGTTGAACCTGGTGGCAGAAGGGACC
    GGATTCATCACCGAAACGGTCTTTGAAAACCGCTTTATGCATGTGCCAGAGCTGAGCCGTATGGGCGCGCACGCCGAAAT
    CGAAAGCAATACCGTTATTTGTCACGGTGTTGAAAAACTTTCTGGCGCACAGGTTATGGCAACCGATCTGCGTGCATCAG
    CAAGCCTGGTGCTGGCTGGCTGTATTGCGGAAGGGACGACGGTGGTTGATCGTATTTATCACATCGATCGTGGCTACGAA
    CGCATTGAAGACAAACTACGCGCTTTAGGTGCAAATATTGAGCGTGTGAAAGGCGAGTAA

    >>MEG_4096|Drugs|Fosfomycin|Fosfomycin_target_mutation|MURA|RequiresSNPConfirmation
    GTGGCCGAGCGTTTCGTCGTGACTGGGGGCAACCGGTTATCAGGCGAAGTGGCCGTCGGCGGCGCCAAGAACAGCGTGCT
    CAAGCTCATGGCTGCGACGTTGTTGGCCGAGGGCACCAGCACGATCACCAACTGTCCCGACATCCTCGATGTGCCGCTGA
    TGGCGGAGGTACTGCGTGGTCTGGGCGCCACCGTCGAACTCGACGGTGACGTGGCCCGGATCACCGCACCTGACGAGCCG
    AAGTACGATGCCGACTTCGCTGCGGTGCGGCAATTCCGCGCCTCGGTCTGTGTGCTGGGACCGCTGGTCGGGCGGTGCAA
    ACGGGCCAGGGTCGCGCTGCCGGGCGGTGACGCGATCGGGTCGCGTCCGTTGGATATGCACCAGGCGGGCCTACGGCAAT
    TGGGTGCCCACTGCAACATCGAGCACGGCTGCGTGGTAGCCCGAGCGGAAACGTTGCGCGGTGCGGAGATTCAGTTGGAG
    TTCCCCTCGGTGGGAGCCACCGAGAACATCTTGATGGCCGCCGTGGTGGCCGAGGGAGTCACCACTATTCACAATGCGGC
    TCGAGAACCCGACGTCGTCGACTTGTGCACGATGTTGAACCAGATGGGCGCACAGGTCGAAGGTGCGGGTTCGCCGACAA
    TGACCATCACCGGTGTCCCGCGGCTGCATCCAACCGAGCACCGGGTGATCGGAGACCGTATCGTTGCCGCCACATGGGGC
    ATCGCTGCCGCAATGACCCGTGGTGATATATCAGTGGCGGGCGTAGACCCGGCGCATCTGCAGCTGGTGCTGCACAAATT
    GCACGACGCGGGCGCAACCGTCACCCAGACTGACGCCAGCTTCCGGGTGACCCAGTACGAGCGTCCGAAGGCTGTCAACG
    TTGCGACCTTGCCGTTCCCCGGGTTTCCCACGGATCTGCAGCCGATGGCTATCGCTTTGGCGTCGATCGCCGACGGCACA
    TCGATGATCACGGAGAACGTGTTCGAGGCGCGGTTCCGCTTCGTTGAAGAGATGATCCGGCTCGGTGCAGACGCTCGGAC
    CGACGGGCACCACGCCGTGGTGCGGGGCCTCCCGCAGCTGTCGAGCGCTCCGGTGTGGTGTTCGGACATCCGTGCCGGGG
    CCGGCTTGGTGCTGGCGGGGCTCGTTGCCGACGGCGACACCGAGGTCCACGATGTATTCCACATCGATCGCGGATATCCG
    TTGTTCGTGGAGAACCTGGTGAGTCTCGGTGCCGAGATCGAACGGGTATGCTGTTAG