MEGAResFrom MEG, the Microbial Ecology Group

FOSC

The fosC gene encodes a fosfomycin phosphotransferase that inactivates the antibiotic molecule.

References

Other Groups in Fosfomycin phosphorylation

Sequences

Download Sequences

>CARD|phgb|Z33413|386-935|ARO:3000380|FosC|Fosfomycin|Fosfomycin_phosphorylation|FOSC
ATGATGACATCGATCATGTTTTCGATGTTGTCGGACATCACGCGGATTTTTGTCGAGCAGGGGCTACGGGTCTATCCCTT
TCAAAGCAGTGCCTTGCTGGGCGTCGATGAAGAGGGGCGTGTCACGCTTCATGCGCGCCAGCTGGCAACGGCCATGGCAT
CGGGTTACATGCCCTTGCTCACTGGGGATCTGCTGCTGCGCGGCGAGCAGGAGGCGCAGGTCTTTTCAAGTGACAATATC
GCCCCGTTGCTCGCTGCGGACTTCGAAGTGCGTCGGGTCTTGTATTACTCCGATGTGGCCGGTGTCTACGACCAGGGCAA
TGCCTTGGTCCCTTGGGTTGGCAATGCCAACGCCGCGTGCATGGAGGCTTGTGTGGGGGCGTCGTCGATGACGGACCTGA
CCGGTGGCATGCGCAACAAGTTCATGCAGCAGCGCCAGTTGGCACGCCTGGGCGTGGTTTCGGAGGTCTTGTCATTCGAG
TGCTTCGACAGGGTGCATCTGTCGTTGTGCGGGTTGCGTCAATTTGGAACCGTGTTCTTGAGCGAGTGAT