MEGAResFrom MEG, the Microbial Ecology Group

FOMB

The fomB gene encodes an enzyme that phosphorylates the fosfomycin molecule, rendering it ineffective as an antibiotic.

References

Other Groups in Fosfomycin phosphorylation

Sequences

Download Sequences

>386|AB016934.1|AB016934|Fosfomycin|Fosfomycin_phosphorylation|FOMB
ATGCTGGAAAACCTCACGATCCGCAGCAGCCGCGTCGTCGACCTCAACCTGGTCAAGGTCAGGCTGTCCACCAACCTCGA
GGACTTCGCGGCGTACTCCTACTTCTCGGCCTTCGCCGAGGACGAGTCCGCGCCCGCCGACTACGAGGTCGTCTGCGTCG
ACCTGGACCGGGACGACATCCCGGCCGAGCTGTACGCCGACCGGACCGACCGGACCTTCCGCGGCAAGCGGTTCAAGGGC
GGCTACTACCTCGTCCACTACTTCGGGGAGCCCGCCCACCTCATCACGGTGGGCCGCACGTTCTACGTGTTCGGCAGGTC
CCTCGAGAAGACCGTCTGGCCCTACTTCGTCAAGCACATCCTGACCGTCCACTCCGCGGACCACGGCTTCCTGCACCTGA
AGGCGGCGGGCTTCGAACTGCCCGGCGCCGGAGCCACCCTGCTCGTCGGGCGCAACGGCGCGGGGAAGACCGTCTTCCTG
GCCCAGGCGTGCCTCAACGGCGCCCGGTTCCTCAGCAACACCCACACGCTGGTCCGGGACGGGGTCGCGCACGGCGTCCC
CTCCTCGATCCGGGTGCGCCGCGACCAGTGCTTCGGTGAACTCATCGACAAGCACGACCTGACGGCGCACATGGAGTCGG
GCGACTACGTCACCGACTCCTCGACTCTCTTCGAGAGTCCGCAGATCAGCACGGCACGCGTCCGGAACGTCGTCATCGTC
GACTACGACCCCGCACGCCCCCAGGGCCTCATGCCGATCTCGCCGGCCGCGGCCGGCACCTTCATGGAGCAGTTCTCCTT
CGCGGTCACCACCTACGGCCTCAAGGACGATCTGCTCGCCCACCACGGGGACTTCGACACCTACGTCGACTCCCTGGCCC
GGATGCGGGCGCAGCTGACCGAACTGGTCGAGGGCGCGCGCTGCTACCGGGCCAACGCAGACATGCTGGCCAAGGAAGTC
CGGGATTCGACGCTCAAGCAGCTTGCCGAATGA