MEGAResFrom MEG, the Microbial Ecology Group

FOMA

The fomA gene encodes an enzyme that phosphorylates the fosfomycin molecule, rendering it ineffective as an antibiotic.

References

Other Groups in Fosfomycin phosphorylation

Sequences

Download Sequences

>385|AB016934.1|AB016934|Fosfomycin|Fosfomycin_phosphorylation|FOMA
ATGACGCCCGATTTCTTGGCCATCAAGGTTGGCGGCAGCCTGTTCTCCCGCAAGGACGAACCCGGCAGCCTGGACGACGA
CGCGGTGACGCCGTTCGCCAGGAACTTCGCCCGGCTCGCCGAGACCTACCGGGGCCGGATGGTTCTCATCAGCGGCGGCG
GCGCCTTCGGCCACGGGGCCATCCGTGACCACGACAGCACGCACGCGTTCTCCCTCGCCGGCCTGACCGAGGCCACCTTC
GAGGTGAAGAAGCGGTGGGCCGAGAAGCTCCGCGGGATCGGCGTGGACGCCTTCCCGCTCCAGCTGGCGGCCATGTGCAC
GCTCCGCAACGGCATACCGCAGCTCCGGTCCGAGGTCCTCCGGGACGTCCTCGACCACGGCGCGCTGCCCGTCCTCGCCG
GCGACGCCCTGTTCGACGAGCACGGAAAGCTGTGGGCGTTCTCCAGCGACCGCGTCCCCGAGGTCCTCCTGCCCATGGTC
GAGGGGCGCCTCCGGGTCGTCACCCTGACCGACGTCGACGGCATCGTGACCGACGGCGCCGGCGGCGACACGATCCTGCC
CGAGGTCGACGCCCGGTCCCCCGAGCAGGCGTACGCCGCGCTCTGGGGCAGCAGCGAATGGGACGCCACCGGCGCCATGC
ACACCAAGCTCGACGCACTGGTCACCTGCGCCCGCCGCGGTGCCGAGTGCTTCATCATGCGGGGCGACCCCGGCAGCGAC
CTGGAGTTCCTGACCGCCCCCTTCTCCTCCTGGCCGGCGCACGTGCGGTCCACCAGGATCACCACGACTGCTTCTGCGTA
A