MEGAResFrom MEG, the Microbial Ecology Group

FOSX

The fosX gene encodes a hydrase that acts on fosfomycin, rendering it ineffective as an antibiotic.

References

Sequences

Download Sequences

>Fos|AP010904.1|gene1560|Fosfomycin|Fosfomycin_hydrases|FOSX
ATGATTACGGGCCTTAGCCACATCACGTTTATCTGCCGCGACCTCGACCGCATGGAAGCCGTGCTGACCGGCGTCCTGGG
GGCGCGGCGGGTCTACGACAGCGGCGAGGCCACGTTTTCCCTGTCCCGGGAGCGGTTTTATCTGGTCGGCGGGGAGGGTG
ACGACGGGCTGTGGCTGGCGGTCATGGAAGGCGAGCCCCTGGCCGAGCCGACCTACAACCACGTGGCCTTTGCCGTGGAC
GAAGCGGACTTCGAGGCCTGTCTGGCCCGCGTCCAGGCCCTGGGACTGACCTTTCGCCCGCCGCGCCTCCGGGTGGCCGG
TGAGGGCCGGTCGCTATATTTTTACGACCACGACAACCATCTTTTCGAACTGCATACCGGAACCTTGCCGGAGCGGCTGG
CCCGCTACCGCCAGGGACGCGCCGCCGCCCCGGCCCCAACGCCCGACAACCCCGAAACCCCGTAA