MEGAResFrom MEG, the Microbial Ecology Group

QNRA

The Qnr peptides bind to the topoisomerases and directly prevent the action of the fluoroquinolone class of antibiotics.

References

Other Groups in Quinolone resistance protein Qnr

Sequences

Download Sequences

>Flq|QnrA4|DQ058662|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGCGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGCAACCTGGCCTATGCCAATTTGAACGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
CGCGGCACCTTCTCCCGCGACTGCTGGCAGCAGGTAAACCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCT
CGATCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTCA
TAGTGCTGCCGGATTAG

>Flq|QnrA6|DQ151889|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCA
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGTAACCTGGCCTATGCCAATTTGAGCGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
CACGGCACCTTCTCCCGCGACTGCTGGCAACAGGTAAACCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCT
CGACCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTAA
TAGTGCTGCCGGATTAG

>Flq|DQ435306.1|orf0|gene|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGCGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGTGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGCAACCTGGCCTATGCCAATTTGAGCGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
CGCGGCACCTTCTCCCGCGACTGCTGGCAACAGGTAAACCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCT
CGACCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTAA
TAGTGCTGCCGGATTAG

>Flq|QnrA5|DQ058663|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGCAACCTGGCCTATGCCAATTTGAGCGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
TGCGGCACCTTCTCCCGCGACTGCTGGCAGCAGGTAAACCTGCGGGGCTGTGACCTGACTTTTGCCGATCTGGATGGGCT
CGATCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTCA
TAGTGCTGCCGGATTAG

>Flq|QnrA3|DQ058661|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGTCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGCAACCTGGCCTATGCCAATTTGAGCGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
CGCGGCACCTTCTCCCGCGACTGCTGGCAACAGGTAAACCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCT
CGATCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTCA
TAGTGCTGCCGGATTAG

>Flq|Qnr-A2|AY675584|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATCGATAAAGTTTTTCAACAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCG
CTTCTATCAGTGTGACTTCAGCCACTGTCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TTGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCTTGCCGTCTGTCTTTGGCTAACTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAATGCGATCTCAAGGGCGCCAACTTTTCCCGGGCCCGCTTTTACAATCA
AGTCAGCCATAAAATGTACTTTTGTGCGGCTTATATCTCAGGCTGCAACCTGGCCTATGCCAATTTGAGTGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAATAACTGGAGCAATGCCAATCTCAGCGGTGCTTCCTTGATGGGCTCCGACCTCAGC
CGCGGCACCTTCTCCCGCGACTGTTGGCAACAGGTCAATCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGACT
CGATCCCAGGCGGGTCAACCTCGAGGGGGTCAAGATCTGTGCCTGGCAACAGGAGCAACTGTTAGAGCCTCTGGGGATAA
TAGTGCTTCCGGATTAG

>Flq|Qnr-A1|AY070235|303-959|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGTGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCACTGTCAGCTGCAGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TTGAAGGGTGTCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGTCTGTCTTTGGCCAACTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAACTTTTCCCGGGCCCGCTTCTACAATCA
AGTCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGTTGCAACCTGGCCTATACCAACTTGAGTGGCCAATGCC
TGGAAAAATGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAATCTCAGCGGCGCTTCCTTGATGGGCTCAGATCTCAGC
CGCGGCACCTTCTCCCGCGACTGTTGGCAACAGGTCAATCTGCGGGGCTGTGACCTAACCTTTGCCGATCTGGATGGGCT
CGACCCCAGACGGGTCAACCTCGAAGGAGTCAAGATCTGTGCCTGGCAACAGGAGCAACTGCTGGAACCCTTGGGAGTAA
TAGTGCTGCCGGATTAG

>Flq|QnrA7|GQ463707|1-657|657|Fluoroquinolones|Quinolone_resistance_protein_Qnr|QNRA
ATGGATATTATTGATAAAGTTTTTCAGCAAGAGGATTTCTCACGCCAGGATTTGAGCGACAGCCGTTTTCGCCGCTGCCG
CTTTTATCAGTGTGACTTCAGCCATTGCCAGCTAAGGGATGCCAGTTTCGAGGATTGCAGTTTCATTGAAAGCGGCGCCG
TCGAAGGGTGCCACTTCAGCTATGCCGATCTGCGCGATGCCAGTTTCAAGGCCTGCCGCCTGTCTTTGGCCAATTTCAGC
GGTGCCAACTGCTTTGGCATAGAGTTCAGGGAGTGCGATCTCAAGGGCGCCAATTTTTCCCGGGCCCGTTTTTACAATCA
AATCAGCCATAAGATGTACTTCTGCTCGGCTTATATCTCAGGCTGTAACCTGGCCTATGCCAATTTGAGCGGCCAATGCC
TGGAAAAGTGCGAGCTGTTTGAAAACAACTGGAGCAATGCCAACCTCAGCGGCGCTTCCTTGATGGGCTCCGACCTCAGC
CACGGCACCTTCTCCCGCGACTGCTGGCAACAGGTAAACCTGCGGGGCTGTGACCTGACCTTTGCCGATCTGGATGGGCT
CGACCCCAGACGGGTCAACCTCGAAGGGGTCAAGATCTGTGCCTGGCAGCAGGAGCAACTGCTGGAACCCTTGGGAGTCA
TAGTGCTGCCGGATTAG