MEGAResFrom MEG, the Microbial Ecology Group

MFPA

The mfpA gene encodes a protein that protects the DNA topoisomerases from the mechanism of action of the fluoroquinolone antibiotics. It's exact mechanism of action is not well described.

References

Other Groups in Quinolone resistance protein Qnr

Sequences

Download Sequences

>CARD|phgb|AL123456|3773015-3773567|ARO:3003035|mfpA|Fluoroquinolones|Quinolone_resistance_protein_Qnr|MFPA
CTAGCCCCCTGCCAAGCACAGCCCGTGCGCCGCCGCAAAGGCCACGGCTTGGTCGACGTCGACACGCGCACCCACCAACG
ACGCGGTCCGCCACAATACCGGGTCCACGGTCGCGCCCCGCAAGTCGGCGTCATCCAGCCGGGCGCCCGTGGTACGGGCA
CCACTGAGGTCGGCGCCGCGCAGCACGCACTTGCGCAAGTCGGTATCCACCAGGCTGGTCTCTCGCAACCGGCAGCCGGT
CAAGTTGAGACCACGCAGATCATTTCCGCCGAGCACGGCGAGCGTGAAATCCACGTCGTCCAACGTCAGCGGCCGCAGCC
GGCAAGCCACGAAGACCGAGCCCAACATGCTGCACTGGGCAAATGTGCTGTGCCACAGTGTCGTCCGTTCGAAGGTGCAA
TTACGAAACGCCGACCCTCGGTGTTGTGACTCGGCCAGATTCACGCCGCTGAAATCGCATTCGCTGAACATCGCCCGTTC
GGTGTGCAGGCGGCTAAGGTCCTCGTCGCGGAAGTCTCGACCGGTGAATTCGCAATCAACCCACTGCTGCAAC