MEGAResFrom MEG, the Microbial Ecology Group

QEPA

The qepA gene encodes an efflux pump that can act on fluoroquinolones, therefore causing resistance.

References

Other Groups in Quinolone active efflux

Sequences

Download Sequences

>Flq|QepA2|EU847537|1672-3107|1536|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGGCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGA
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>Flq|QepA|AB263754|7052-8587|1536|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>CARD|phgb|JQ064560|0-1536|ARO:3000448|qepA|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGAGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCTGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGCTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCAAGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGACGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA