MEGAResFrom MEG, the Microbial Ecology Group

QEPA

The qepA gene encodes an efflux pump that can act on fluoroquinolones, therefore causing resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2043241/

Sequences

Download Sequences

>>MEG_5858|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttattcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccgatgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctggactggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>>MEG_5859|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>>MEG_5860|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggctggggcagggcctgtggtggctggtgccggccacgatcgtca
tgggcctgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcg
gcctcggccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggt
ctaccggcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggg
gcgccgtgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgat
gcgctgcaggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcg
cccagcgctcgcatctggttga

>>MEG_5861|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccaac
gctcgcatctggttga

>>MEG_5862|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccgtgcacctggccgaca
ccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctgcaggccacggcctgg
gccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagcgctcgcatctggttg
a

>>MEG_5863|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgttcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>>MEG_5864|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>>MEG_5865|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGGCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGA
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>>MEG_5866|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGAGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCTGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGCTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCAAGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGACGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>>MEG_5867|Drugs|Fluoroquinolones|Quinolone_active_efflux|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTATTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGA
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA