MEGAResFrom MEG, the Microbial Ecology Group

NORA

The norA gene encodes a multi-drug efflux pump that, when overexpressed, can act effectively on fluoroquinolones, therefore causing resistance.

References

Other Groups in Quinolone active efflux

Sequences

Download Sequences

>199|AY566250.1|AY566250|Fluoroquinolones|Quinolone_active_efflux|NORA
ATGAAAAAACAATTATTCATTCTTTATTTTAATATATTTCTTATATTTTTAGGGATTGGATTAGTTATTCCTGTACTTCC
TGTATATTTGAAGGATTTAGGATTAAAAGGTAGTGACTTAGGAATGCTAGTTGCTGCTTTTGCATTATCACAAATGATTA
TTTCACCATTTGGTGGGACACTAGCTGATAAATTGGGTAAAAAATTAATTATATGTATCGGTTTAGTATTCTTTGCTGTC
TCTGAATTTATGTTCGCAGCCGGTCAAAGTTTTACCATTTTAATCATTTCACGTGTTTTAGGTGGCTTTAGTGCAGGCAT
GGTCATGCCTGGTGTAACAGGTATGATTGCAGATATTTCTCCAGGAGCTGATAAAGCTAAAAACTTTGGTTACATGTCGG
CAATTATTAATTCAGGTTTTATATTAGGACCTGGATTTGGAGGCTTTTTAGCTGAAATTTCACATAGATTACCTTTCTAT
GTTGCTGGAACATTAGGTGTTGTTGCATTCATTATGTCAGTTTTATTAATTCATAATCCTCAAAAAGCAACTACAGATGG
ATTCCACCAATATCAACCTGAATTATTCACTAAAATTAATTGGAAAGTATTTATTACTCCAGTCATATTAACACTTGTAT
TAGCATTTGGTTTATCTGCTTTTGAAACATTATTTTCTTTATATACAGCTGACAAAGTAAATTATACTCCTAAAGATATT
TCGATAGCTATTATCGGTGGAGGCGTGTTTGGCGCATTATTCCAAGTATTCTTCTTTGATAAATTTATGAAATATATGAG
TGAACTTAATTTTATTGCATGGTCATTACTATATTCAGCCATTGTTCTCGTTATGTTAGTGCTTGCAAACGGTTATTGGA
CGATTATGATTATTAGCTTTGTTGTTTTTATAGGTTTTGATATGATTAGACCAGCTTTAACCAATTACTTCTCGAATATA
GCAGGCAAACGGCAAGGTTTTGCAGGTGGATTGAATTCAACTTTTACCAGTATGGGTAACTTTATAGGTCCTCTTGTAGC
TGGTGCATTATTCGATGTTAATTTAGAGTTTCCTTTATATATGGCTATTGCGGTTTCATTAAGTGGAATTATCATTATTT
TTATTGAAAAAGGACTTAAGTCACGCCGTAAAGAAGCAAATTAA

>Flq|norA|D90119|478-1644|1167|Fluoroquinolones|Quinolone_active_efflux|NORA
ATGAATAAACAGATTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTAGTAATACCAGTCTTGCC
TGTTTATTTAAAAGATTTGGGATTAACTGGTAGTGATTTAGGATTACTAGTTGCTGCTTTTGCGTTATCTCAAATGATTA
TATCGCCGTTTGGTGGTACGCTAGCTGACAAATTAGGGAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCAGTTGGCCACAATTTTTCGGTATTGATGTTATCGAGAGTGATTGGTGGTATGAGTGCTGGTAT
GGTAATGCCTGGTGTGACAGGTTTAATAGCTGACATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCTGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAC
TTTGCAGGAGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGATCCGAAAAAGTCTACGACAAGTGG
TTTCCAAAAGTTAGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTTTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAAATCTATTTCTTCGATAAATTTATGAAGTATTTCTC
AGAGTTAACATTTATAGCTTGGTCATTATTATATTCAGTTGTTGTCTTAATATTATTAGTTTTTGCTAATGGCTATTGGT
CAATAATGTTAATCAGTTTTGTTGTCTTCATAGGTTTTGATATGATACGACCAGCCATTACAAATTATTTTTCTAATATT
GCTGGAGAAAGGCAAGGCTTTGCAGGCGGATTGAACTCGACATTCACTAGTATGGGTAATTTCATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTACACATTGAAGCACCAATTTATATGGCTATAGGTGTTTCATTAGCAGGTGTTGTTATTGTTT
TAATTGAAAAGCAACATAGAGCAAAATTGAAAGAACAAAATATGTAG

>Flq|norA_1_M97169|Fluoroquinolones|Quinolone_active_efflux|NORA
ATGAATAAACAGATTTTGGTATTATATTTTAATATTTTCTTAATTTTTTTAGGTATCGGTCTAGTGATACCAGTCTTACC
TGTTTATTTAAAAGATTTGGGGTTAACTGGTAGTGATTTAGGATTATTAGTTGCTGCTTTCGCCTTATCTCAAATGATTA
TATCGCCATTCGGTGGTACGTTAGCTGATAAATTAGGAAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCTATCGGTCAGAATTTTTTAATTTTGATGTTATCAAGGGTTATCGGTGGTATGAGTGCTGGTAT
GGTTATGCCTGGGGTGACAGGTTTAATAGCTGATATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCAGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAT
TTTGCAGGTGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGACCCTAAAAAAGTTTCGACAAATGG
ATTCCAAAAGTTGGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTCTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCAATTACAGGTGGCGGTATCTTTGGTGCACTTTTCCAAATTTATTTCTTTGATAAATTTATGAAATACTTCTC
TGAGTTAACATTTATTGCATGGTCATTAATATATTCAGTTATTGTATTAGTGCTATTAGTTATTGCCGATGGTTACTGGA
CAATTATGGTAATAAGCTTTGTTGTCTTTATCGGGTTCGATATGATAAGACCTGCTATTACAAATTATTTTTCAAATATT
GCTGGTGATAGACAGGGATTTGCAGGTGGGTTAAACTCAACATTCACTAGCATGGGGAATTTTATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTGCACATTGAAGCCCCAATTTATATGGCTATAGGTGTGTCATTAGCTGGTGTTGTCATTGTTT
TAATTGAAAAGCAACATAGAGCTAAGTTAAAACAACAAGATTTGTAA