MEGAResFrom MEG, the Microbial Ecology Group

parE

The parE gene encodes a topoisomerase type IV subunit E, which aids in the decatenation (detangling) of DNA after replication and recombination but before segregation. DNA topoisomerase IV is related in structure to DNA topoisomerase II in that the parE subunit binds strongly to ATP; specific mutations in the parE gene often confer resistance to fluoroquinolones, and some have been shown to confer resistance to aminocoumarins.

References

Other Groups in Fluoroquinolone-resistant DNA topoisomerases

Sequences

Download Sequences

>CARD|pvgb|NC_007779|3172159-3174052|ARO:3003316|Escherichia|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|parE|RequiresSNPConfirmation
TTAAACCTCAATCTCCGCCATGTCGCCTTTCTCTTGCAACCAGTTGCGGCGATCTTCCGAGCGTTTCTTCGCCAGCAGCA
TATCCATCATCGCGTCAGTACGCTGATCGTCTTCATCATCGATAGTCAACTGCACCAGACGGCGAGTGTTCGGATCAAGC
GTGGTTTCGCGCAATTGCATCGGGTTCATTTCCCCCAGACCTTTAAAACGCTGGACGTTCGGCTTGCCTTTCTTGCGTTT
TAATTGCTCAAGTACGCCCTCTTTCTCTTCTTCCGTCAGCGCGTAATAAACCTCTTTCCCGAGATCAATACGGTAGAGCG
GTGGCAGTGCGACGTAAACGTGACCGTGTTTCACCAACGCGCGGAAATGTTTTACGAACAAAGCGCAGAGCAGCGTGGCA
ATGTGCAGACCATCAGAGTCCGCATCCGCGAGGATACAGATTTTGCCATAACGAAGCTGGCTCAGATCGTCGCTGTCAGG
ATCGATACCGATCGCTACCGAAATATCGTGCACTTCCTGCGAAGCCAGCACTTCGTCGGAAGAGACTTCCCAGGTGTTAA
GGATCTTACCTTTCAGTGGCATGATCGCCTGATATTCGCGATCGCGCGCCTGCTTGGCAGATCCGCCTGCGGAGTCACCT
TCCACAAGGAACAGCTCGGTACGGTTAAGGTCCTGCGCGGTACAATCAGCCAGTTTGCCAGGCAACGCCGGGCCGCTGGT
CAGCTTTTTACGCACCACTTTTTTGGCCGCACGCATACGGCGCTGGGCGCTGGAAATCGCCATCTCCGCCAGCAGTTCAG
CCGCCTGAACGTTCTGGTTCAGCCACAGGATAAAGGCATCTTTCACCACGCCAGAAACGAATGCCGCGCATTGACGCGAA
GAGAGACGCTCTTTCGTCTGCCCGGCAAACTGCGGATCCTGCATTTTTACTGACAGCACATAGGCGCAGCGATCCCAGAT
ATCTTCCGCCGACAGCTTTACACCGCGCGGCAGAATATTGCGGTATTCACAGAACTCACGCATCGCGTCCAACAGGCCCT
GACGCAGACCATTAACATGGGTACCGCCCTGCATCGTTGGGATAAGGTTGACGTAGCTTTCGGTCAGCAGTTCACCGCCT
TCCGGCAGCCACAGTAGCGCCCAGTCCACAGCTTCAGTATCACCAGCGAAATTACCGATAAACGGTTTTTCCGGCAGCGT
CGGCAGACCATTTACCGCTTCCGCCAGGTAATCATTCAGACCGTCCTGATAGCACCAGCGTTGTTCGGTATTGTTGATCT
CATCTTTAAAAGTGATCTCAACGCCAGGGCACAATACCGCTTTGGCTTTCAGCACATGCGTCAGGCGTGAAACAGAAAAT
CGCGGGCTGTCAAAGAAGGTTTCATCCGGCCAGAAGTGCACACTGGTACCAGTATTGCGTTTACCGCAAGTGCCGACAAC
CTGTAAATCCTGCACCTTTTCGCCATTTTCAAAGGCGATGTTATAAACCTGACCATCGCGGCGCACGTTAACTTCTACGC
GCTTCGACAGGGCGTTAACCACCGAAATCCCCACGCCATGCAGGCCGCCAGAGAACTGGTAATTTTTGTTAGAGAATTTA
CCGCCTGCATGCAGACGGCAAAGAATCAGTTCAACCGCCGGTACACCCTCTTCCGGGTGAATATCCACCGGCATCCCGCG
CCCATCGTCAATAACTTCTAACGACTGGTCAGCATGTAAAATAACGTCCACGCGTTTTGCGTGACCCGCCAGTGCTTCAT
CCACACTGTTATCAATGACTTCTTGCCCCAAATGGTTAGGGCGAGTGGTATCGGTATACATCCCCGGACGGCGGCGAACC
GGCTCAAGCCCGGTGAGTACCTCAATGGCATCAGCGTTATAAGTTTGCGTCATG

>CARD|pvgb|NC_002952|1417762-1419760|ARO:3003315|Staphylococcus|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|parE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGCGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAATTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGACGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTACGTATTCCAGAAGAATTACTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCAAGAAGTGCTGTTGATTCAGTAGTTGCAGACAAATTACCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTAAAAAAAGCAATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAATACAGATAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTGGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAACTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAGGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATTTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAGT

>CARD|pvgb|110645304|5576027-5577917|ARO:3003685|Pseudomonas|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|parE|RequiresSNPConfirmation
TCAGACCAGCACCTCGGCCAGGTTGCCCTTGCTTTCCAGCCAGGACTTGCGGTCACCGGCGCGCTTCTTGGCCAGCAGCA
TGTCCATGATCTCCAGGGTACCGGTGGCGTCCTCCAGGGTGAGCTGGACCAGCCGCCGGGTATTCGGATCCATGGTGGTC
TCGCGCAGTTGCAACGGATTCATTTCGCCAAGGCCCTTGAAGCGGGTGACCTGCGGCTTGCCGCGCTTCTTCTCTGCGGC
CAGGCGCTCGAGGATGCCGTCGCGCTCGGCTTCGTCGAGGGCGTAGTAGATGTCCTTGCCGAGGTCGATGCGGTACAGCG
GCGGCATCGCCACGTAGACGTGGCCGGCTTCCACCAGCGGGCGGAAATGGCGGACGAACAGCGCGCAGAGCAGCGTGGCG
ATGTGCAGCCCGTCGGAGTCGGCATCCGCGAGGATACAGATCTTGCCGTAGCGCAGCTGGGCCAGGTCACTGGCACCCGG
ATCGACGCCGATGGCCACCGCGATGTCGTGGACCTCCTGGCTGGCGAGCACCTCGCCGCCGTCCACTTCCCAGGTGTTCA
GGATCTTTCCGCGCAGCGGCATGATCGCCTGGAATTCCTTGTCCCGCGCCTGCTTCGCCGAGCCGCCGGCGGAGTCGCCC
TCGACCAGGAACAGTTCCGCGCGCATCGGTTCCTGTCCGGCGCAGTCGGCCAGTTTGCCGGGCAGCGCCGGCCCCTGGGT
GATCTTCTTGCGCTCGACCTTCTTGCCCGCCTTGAGGCGACGCCCGGCGTTGCTGATCGCCAGTTCCGCCAGTTGCAGGC
CGATTTCGGCGTGCTCGTTGAGCCACAGGCTGAAGGCGTCCTTCACCACGCCCGAGACGAACGCCGCCGCCTCGCGGGAC
GACAGGCGCTCCTTGGTCTGCCCGGAGAACTGCGGCTCCTGCATCTTCATCGAGAGGACGAAGGCGATCCGCTCCCAGAC
GTCCTCGGGCGCCAGCTTGACGCCGCGCGGCAACAGGTTGCGGAACTCGCAGAACTCGCGCATGGCGTCGAGCAGGCCCT
GGCGCAGGCCGTTCACATGGGTGCCGCCCTGGGCCGTGGGAATCAGGTTGACGTAGCTTTCCTGCACCGACTCACCGCCC
TCGGGCAGCCACAGCAGGGCCCAGCTCACCGCTTCCTTGGAACCTTCGAGGTTGCCGCAGAAGGGTTCATCGGGCAGGCG
CGGCAGCTCGGCGACCGCGTCGGTCAGGTAGGAGCGCAGGCCGTCCTCGAAGTGCCACTCGACGCGCTCGCCGGTGTTCT
TGTCCTCGAACACCACGCTCAGGCCCGGGCACAGCACCGCCTTGGCCTTGAGCACATGCTTGAGGCGGCTGACCGAGAAC
TTCGCCGAATCGAAATACTTCGGATCCGGCCAGAAATGCACGCTGGTACCGGTATTGCGCTTGCCGACCGTGCCGATGAC
TTCCAGATCGCTGTCCTTGAAGCCGTCGGCGAAGGTCATCCGGTACTCGTTGGCGTCGCGCTTGACGCGTACCTCGACCC
GGGTCGAGAGCGCGTTCACCACCGAGATGCCGACCCCGTGCAAGCCGCCGGAGAACTGGTAGTTCTTGTTCGAGAACTTG
CCGCCGGCATGCAGCTTGGTAAGGATCAGCTCGACGCCCGGCACGCCCTCTTCCGGGTGGATGTCCACCGGCATGCCGCG
GCCATCGTCGATGACTTCCAGCGAGTTGTCCTGGTGCAGGATCACCTGCACGCTCTTCGCATGGCCGGCCAGGGCTTCGT
CGACGCTGTTGTCGATGACTTCCTGGGCCAGATGGTTGGGGCGGGTGGTGTCGGTGTACATCCCCGGGCGCTTGCGCACC
GGGTCGAGGCCGGAAAGGACTTCGATGGCGTCTGCGTTGTAAGTAGCCAT

>CARD|pvgb|NC_003197|3343961-3345854|ARO:3003317|Salmonella|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|parE|RequiresSNPConfirmation
TTACACGTCGAGATCCGCGAGATCGCCTTTTTCCTGTAGCCAGTTGCGTCGATCTTCAGAACGTTTCTTCGCCAGCAGCA
TATCCATCATCGCATTAGTACGCTGATCGTCTTCATCGCTAATGGTGAGCTGCACCAGGCGGCGAGTATTCGGATCAAGC
GTGGTTTCGCGTAACTGCATCGGGTTCATTTCTCCCAGGCCTTTGAAACGCTGTACGTTCGGCTTGCCTTTCTTACGCTT
CAGTTGTTCCAGTACGCCCGCCTTCTCTTCTTCCGTCAGCGCGTAATAGACCTCTTTACCCAAATCGATACGGTATAGCG
GCGGTAGCGCGACGTAGACATGACCATTCTTCACCAGCGCGCGGAAGTGTCTGACAAACAGCGCGCAAAGCAGAGTAGCG
ATATGCAAACCATCGGAGTCCGCATCCGCCAGGATACAGATCTTGCCGTAGCGCAGCTGACTCAGATCGTCGCTGTCCGG
ATCGATACCGATCGCCACGGAAATATCATGCACTTCTTGCGAGGCCAGCACTTCATCGGAAGAGACCTCCCAGGTGTTAA
GGATCTTACCTTTGAGCGGCATGATCGCCTGATATTCGCGATCGCGCGCCTGCTTGGCGGAACCGCCCGCCGAATCCCCT
TCCACAAGGAACAGCTCGGTCCGATTAAGATCCTGCGCGGTACAGTCCGCCAGTTTCCCCGGCAACGCCGGGCCGCTGGT
GAGCTTTTTGCGCACCACTTTTTTTGCGGCGCGCAGTCGCCGCTGCGCGCTGGCAATCGCCATCTCTGCCAGTTGTTCCG
CCGCCTGCACGTTCTGGTTCAGCCACAGGCTGAAGGCATCTTTCACCACGCCGGAAACAAATGCCGCACATTGACGCGAC
GACAGACGCTCTTTGGTCTGCCCGGCAAATTGCGGGTCCTGCATTTTCACGGAAAGCACATAAGCGCAGCGATCCCAGAT
ATCTTCCGCCGACAGTTTGACGCCGCGCGGCAGAATATTGCGGTATTCGCAAAATTCGCGCATCGCGTCGAGCAGGCCCT
GGCGCAGACCGTTGACGTGCGTCCCCCCCTGCATGGTCGGGATCAGGTTGACGTAGCTTTCCGTCAGTAATTCGCCGCCT
TCCGGCAGCCACAATAGCGCCCAGTCAACCGCTTCCGTTTCACCGTTAAAATTACCGATAAACGGCTTTTCCGGCAGCGT
CGGCAGGCCGTTTACCGCTTCGCCCAGATAGTCGTTCAGACCATCCTGGTAGCACCAGCGCTGCTCGCTGTTATTCACTT
CATCTTTAAAAGTGATTTCCACGCCGGGACACAGCACCGCTTTTGCTTTCAGAACGTGCATTAAGCGAGAGACAGAAAAA
CGCGGGCTGTCGAAGAAACTTTCGTCCGGCCAGAAATGGACGCTGGTTCCAGTATTACGTTTACCGCAGGTGCCGACAAC
CTGCAAATCCTGCACTTTTTCGCCGTTTTCAAACGCGATGTTATAGACCTGACCGTCGCGGCGCACGGTCACTTCCACGC
GCTTTGACAGGGCATTTACTACCGAAATCCCCACCCCATGCAGACCACCAGAGAACTGATAGTTCTTATTGGAGAATTTA
CCGCCGGCATGAAGCCGACAGAGGATCAGTTCTACCGCCGGAACCCCCTCTTCCGGATGGATATCCACCGGCATCCCGCG
TCCGTCGTCAATCACTTCCAGCGATTGATCGGCATGTAAAATGACATCCACGCGTTTGGCGTGACCTGCCAGTGCTTCAT
CCACACTATTATCAATCACTTCCTGACCCAAATGGTTGGGGCGGGTCGTATCGGTGTACATCCCCGGGCGGCGGCGTACC
GGCTCAAGCCCAGTGAGTACCTCAATGGCATCAGCGTTATAAGTTTGCGTCATG