MEGAResFrom MEG, the Microbial Ecology Group

PAREF

The PAREF group of genes confer resistance to Fluoroquinolones through the mechanism, Fluoroquinolone-resistant DNA topoisomerases.

References

    Other Groups in Fluoroquinolone-resistant DNA topoisomerases

    Sequences

    Download Sequences

    >>MEG_5394|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PAREF|RequiresSNPConfirmation
    ATGACGCAAACTTATAACGCTGATGCCATTGAGGTACTCACCGGGCTTGAGCCGGTTCGCCGCCGTCCGGGGATGTATAC
    CGATACCACTCGCCCTAACCATTTGGGGCAAGAAGTCATTGATAACAGTGTGGATGAAGCACTGGCGGGTCACGCAAAAC
    GCGTGGACGTTATTTTACATGCTGACCAGTCGTTAGAAGTTATTGACGATGGGCGCGGGATGCCGGTGGATATTCACCCG
    GAAGAGGGTGTACCGGCGGTTGAACTGATTCTTTGCCGTCTGCATGCAGGCGGTAAATTCTCTAACAAAAATTACCAGTT
    CTCTGGCGGCCTGCATGGCGTGGGGATTTCGGTGGTTAACGCCCTGTCGAAGCGCGTAGAAGTTAACGTGCGCCGCGATG
    GTCAGGTTTATAACATCGCCTTTGAAAATGGCGAAAAGGTGCAGGATTTACAGGTTGTCGGCACTTGCGGTAAACGCAAT
    ACTGGTACCAGTGTGCACTTCTGGCCGGATGAAACCTTCTTTGACAGCCCGCGATTTTCTGTTTCACGCCTGACGCATGT
    GCTGAAAGCCAAAGCGGTATTGTGCCCTGGCGTTGAGATCACTTTTAAAGATGAGATCAACAATACCGAACAACGCTGGT
    GCTATCAGGACGGTCTGAATGATTACCTGGCGGAAGCGGTAAATGGTCTGCCGACGCTGCCGGAAAAACCGTTTATCGGT
    AATTTCGCTGGTGATACTGAAGCTGTGGACTGGGCGCTACTGTGGCTGCCGGAAGGCGGTGAACTGCTGACCGAAAGCTA
    CGTCAACCTTATCCCAACGATGCAGGGCGGTACCCATGTTAATGGTCTGCGTCAGGGCCTGTTGGACGCGATGCGTGAGT
    TCTGTGAATACCGCAATATTCTGCCGCGCGGTGTAAAGCTGTCGGCGGAAGATATCTGGGATCGCTGCGCCTATGTGCTG
    TCAGTAAAAATGCAGGATCCGCAGTTTGCCGGGCAGACGAAAGAGCGTCTCTCTTCGCGTCAATGCGCGGCATTCGTTTC
    TGGCGTGGTGAAAGATGCCTTTATCCTGTGGCTGAACCAGAACGTTCAGGCGGCTGAACTGCTGGCGGAGATGGCGATTT
    CCAGCGCCCAGCGCCGTATGCGTGCGGCCAAAAAAGTGGTGCGTAAAAAGCTGACCAGCGGCCCGGCGTTGCCTGGCAAA
    CTGGCTGATTGTACCGCGCAGGACCTTAACCGTACCGAGCTGTTCCTTGTGGAAGGTGACTCCGCAGGCGGATCTGCCAA
    GCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCACTGAAAGGTAAGATCCTTAACACCTGGGAAGTCTCTTCCGACG
    AAGTGCTGGCTTCGCAGGAAGTGCACGATATTTCGGTAGCGATCGGTATCGATCCTGACAGCGACGATCTGAGCCAGCTT
    CGTTATGGCAAAATCTGTATCCTCGCGGATGCGGACTCTGATGGTCTGCACATTGCCACGCTGCTCTGCGCTTTGTTCGT
    AAAACATTTCCGCGCGTTGGTGAAACACGGTCACGTTTACGTCGCACTGCCACCGCTCTACCGTATTGATCTCGGGAAAG
    AGGTTTATTACGCGCTGACGGAAGAAGAGAAAGAGGGCGTACTTGAGCAATTAAAACGCAAGAAAGGCAAGCCGAACGTC
    CAGCGTTTTAAAGGTCTGGGGGAAATGAACCCGATGCAATTGCGCGAAACCACGCTTGATCCGAACACTCGCCGTCTGGT
    GCAGTTGACTATCGATGATGAAGACGATCAGCGTACTGACGCGATGATGGATATGCTGCTGGCGAAGAAACGCTCGGAAG
    ATCGCCGCAACTGGTTGCAAGAGAAAGGCGACATGGCGGAGATTGAGGTTTAA

    >>MEG_5395|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PAREF|RequiresSNPConfirmation
    TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
    TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
    TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
    ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
    ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGCGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
    TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
    GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
    TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
    GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAATTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
    TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
    AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
    CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGACGGTAATGATATTCGT
    GAAGGTTTAACAGCTGTTGTGTCTGTACGTATTCCAGAAGAATTACTACAATTTGAAGGACAAACGAAATCTAAATTGGG
    TACTTCTGAAGCAAGAAGTGCTGTTGATTCAGTAGTTGCAGACAAATTACCATTCTATTTAGAAGAAAAAGGACAATTGT
    CTAAATCACTTGTAAAAAAAGCAATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
    GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAATACAGATAAAAATGA
    ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
    TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTGGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
    ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAACTATAATCGTGTAATTATTATGACTGATGCTGA
    TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
    TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
    GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAGGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
    TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
    CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATTTTGAGTTTGGTATG
    CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG