MEGAResFrom MEG, the Microbial Ecology Group

PAREF

The PAREF group of genes confer resistance to Fluoroquinolones through the mechanism, Fluoroquinolone-resistant DNA topoisomerases.

Other Groups in Fluoroquinolone-resistant DNA topoisomerases

Sequences

Download Sequences

>MEG_5406|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PAREF|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGCGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAATTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGACGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTACGTATTCCAGAAGAATTACTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCAAGAAGTGCTGTTGATTCAGTAGTTGCAGACAAATTACCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTAAAAAAAGCAATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAATACAGATAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTGGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAACTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAGGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATTTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>MEG_5407|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|PAREF|RequiresSNPConfirmation
ATGACGCAAACTTATAACGCTGATGCCATTGAGGTACTCACCGGGCTTGAGCCGGTTCGCCGCCGTCCGGGGATGTATAC
CGATACCACTCGCCCTAACCATTTGGGGCAAGAAGTCATTGATAACAGTGTGGATGAAGCACTGGCGGGTCACGCAAAAC
GCGTGGACGTTATTTTACATGCTGACCAGTCGTTAGAAGTTATTGACGATGGGCGCGGGATGCCGGTGGATATTCACCCG
GAAGAGGGTGTACCGGCGGTTGAACTGATTCTTTGCCGTCTGCATGCAGGCGGTAAATTCTCTAACAAAAATTACCAGTT
CTCTGGCGGCCTGCATGGCGTGGGGATTTCGGTGGTTAACGCCCTGTCGAAGCGCGTAGAAGTTAACGTGCGCCGCGATG
GTCAGGTTTATAACATCGCCTTTGAAAATGGCGAAAAGGTGCAGGATTTACAGGTTGTCGGCACTTGCGGTAAACGCAAT
ACTGGTACCAGTGTGCACTTCTGGCCGGATGAAACCTTCTTTGACAGCCCGCGATTTTCTGTTTCACGCCTGACGCATGT
GCTGAAAGCCAAAGCGGTATTGTGCCCTGGCGTTGAGATCACTTTTAAAGATGAGATCAACAATACCGAACAACGCTGGT
GCTATCAGGACGGTCTGAATGATTACCTGGCGGAAGCGGTAAATGGTCTGCCGACGCTGCCGGAAAAACCGTTTATCGGT
AATTTCGCTGGTGATACTGAAGCTGTGGACTGGGCGCTACTGTGGCTGCCGGAAGGCGGTGAACTGCTGACCGAAAGCTA
CGTCAACCTTATCCCAACGATGCAGGGCGGTACCCATGTTAATGGTCTGCGTCAGGGCCTGTTGGACGCGATGCGTGAGT
TCTGTGAATACCGCAATATTCTGCCGCGCGGTGTAAAGCTGTCGGCGGAAGATATCTGGGATCGCTGCGCCTATGTGCTG
TCAGTAAAAATGCAGGATCCGCAGTTTGCCGGGCAGACGAAAGAGCGTCTCTCTTCGCGTCAATGCGCGGCATTCGTTTC
TGGCGTGGTGAAAGATGCCTTTATCCTGTGGCTGAACCAGAACGTTCAGGCGGCTGAACTGCTGGCGGAGATGGCGATTT
CCAGCGCCCAGCGCCGTATGCGTGCGGCCAAAAAAGTGGTGCGTAAAAAGCTGACCAGCGGCCCGGCGTTGCCTGGCAAA
CTGGCTGATTGTACCGCGCAGGACCTTAACCGTACCGAGCTGTTCCTTGTGGAAGGTGACTCCGCAGGCGGATCTGCCAA
GCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCACTGAAAGGTAAGATCCTTAACACCTGGGAAGTCTCTTCCGACG
AAGTGCTGGCTTCGCAGGAAGTGCACGATATTTCGGTAGCGATCGGTATCGATCCTGACAGCGACGATCTGAGCCAGCTT
CGTTATGGCAAAATCTGTATCCTCGCGGATGCGGACTCTGATGGTCTGCACATTGCCACGCTGCTCTGCGCTTTGTTCGT
AAAACATTTCCGCGCGTTGGTGAAACACGGTCACGTTTACGTCGCACTGCCACCGCTCTACCGTATTGATCTCGGGAAAG
AGGTTTATTACGCGCTGACGGAAGAAGAGAAAGAGGGCGTACTTGAGCAATTAAAACGCAAGAAAGGCAAGCCGAACGTC
CAGCGTTTTAAAGGTCTGGGGGAAATGAACCCGATGCAATTGCGCGAAACCACGCTTGATCCGAACACTCGCCGTCTGGT
GCAGTTGACTATCGATGATGAAGACGATCAGCGTACTGACGCGATGATGGATATGCTGCTGGCGAAGAAACGCTCGGAAG
ATCGCCGCAACTGGTTGCAAGAGAAAGGCGACATGGCGGAGATTGAGGTTTAA