MEGAResFrom MEG, the Microbial Ecology Group

GYRC

The GYRC group of genes confer resistance to Fluoroquinolones through the mechanism, Fluoroquinolone-resistant DNA topoisomerases.

References

    Other Groups in Fluoroquinolone-resistant DNA topoisomerases

    Sequences

    Download Sequences

    >>MEG_3251|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRC|RequiresSNPConfirmation
    ATGAGCAATATTAATTACGAAGGCATCGAGCAGATGCCACTTCGCACCTTTACAGAAAAGGCTTACCTTAATTATTCAAT
    GTACGTCATCATGGATCGTGCATTGCCTTTTATTGGCGATGGCTTAAAGCCTGTTCAACGTCGTATTGTCTATGCGATGT
    CTGAACTGGGTTTAAATGCCGCGGCAAAATTTAAAAAGTCCGCGCGTACCGTCGGTGATGTGTTAGGTAAATTCCATCCA
    CATGGTGACTCTGCTTGTTATGAAGCCATGGTATTAATGGCTCAGCCTTTTTCTTATCGTTATCCTTTGGTAGATGGGCA
    AGGAAACTGGGGGGCGCCAGATGATCCTAAATCATTTGCGGCAATGCGTTATACAGAATCTCGCCTGTCCAAAATCTCTG
    AAATTTTATTATCTGAATTAGGCCAAGGCACTGTTGATTTCCAACCGAACTTTGATGGTACCTTAGAAGAACCTCAATAT
    TTGCCTGCACGTTTGCCTCATATTCTGTTAAACGGCACCACCGGGATTGCCGTCGGGATGGCAACCGATATTCCACCACA
    TAATATTAATGAAGTGGCGGATGCCGCTGTTATGCTATTAGATAATCCAAAAGCAGGATTAGATGATGTACTCAATATCA
    TTCAAGGCCCGGATTTCCCAACTGAAGCGGAAATTATTTCACCAAAAGATGATATTCGCAAAATGTATGAAACCGGTCGT
    GGTTCTATCAAAATGCGTGCAACATGGCATAAAGAAGACGGTGAAATCATCATTAGTGCACTTCCTCATCAATCTTCACC
    ATCAAAAATCATTGCGCAAATTGCTGAACAAATGACAGCAAAAAAATTGCCAATGGTGGAAGATATTCGTGATGAAGCAG
    ATTATGAAAACCCTGTACGTATCGTGCTTGTGCCACGTTCAAATCGTGTTGATACGGATGCCTTAATGGCGCATTTATTT
    GCGACGACTGATCTCGAAAAAAGCTATCGTGTAAATATGAATATGATCGGACTTGATCATAAACCAGCCGTAAAAGGCCT
    ACTTCAAGTTCTTATCGAATGGCTGACATTCCGTCGTACTACCGTGACACGTCGTTTACAACATCGTTTAGATAAAGTAC
    TCGCTCGTTTGCACATTTTAGATGGTTTGATGATTGCCTTCCTCAATATTGACGAAGTGATTGAGATTATTCGTACTGAA
    GATGAACCAAAACAAGTTTTAATGGCTCGCTTTAACTTAAGTGATGAACAGGCAGAAGCCATTTTAAACTTACGTTTACG
    CCATTTGGCCAAATTAGAAGAACATCAATTACAAGCTGAAAAAGATAAACTCGAAGAAGAGCGGTCAAATTTAGAGTTAA
    TTTTAGGATCTGAACGTCGCTTAAATACCTTGATCAAAAAAGAAATTCAAGAAGATGCGAAAAAATACGCCAGCCCTAGA
    ATGTCTCAATTAGTTGAACGTGAAGAAGCGAAAGCCATTTCTGAAAGTGAAATGACTCCGGCTGAACCCGTTACCGTTAT
    CTTATCTGAAATGGGCTGGGTACGCTGTGCAAAAGGTCATGACATTGATCCGGAAGGATTAAGCTATAAAGCAGGCGATA
    AATATCTGGCTCACGCTTGCGGTAAAAGTAATCAGCCTGTAATCTTTATTGACAGCACGGGGCGTAGCTATGCTTTAGAT
    CCATTAAGCTTGCCTTCTGCGCGTTCACAAGGTGAACCACTCACCGGTAAACTGACATTACCGGCCGGTGCGACCATTGA
    ACAGGTTATTATGGAACCTGAAAAACAAGAATTATTGATGGCATCAGATGCAGGATATGGTTTTATTTGCAAATTTGAAG
    ATTTAATTGCGCGTAATAAAGCAGGAAAAGCCTTGATTTCTTTGCCAGAAAATGCGAAAGTCTTGAAACCTGAGACACTT
    TCCGAGTCGACCTCACTTCTTGTGTCCCTCACTTCAGCGGGTCGAATGCTGATTTTTCCGGTACGGGATTTACCGGCATT
    ATCAAAAGGGAAAGGCAACAAAATCATCAGTATTCCAGCAGCGAATGCAAAAGCGCGGTCAGAATTATTAGTGAAATTGT
    TCTTAATTTCAGAGCAAGCTAGCCTTGAGTTCCATTCCGGTAAACGAAAAATCACATTAAAACCGGAAGATCTGCAAAAA
    TTCCGAGCGGAACGCGGCAGAAAAGGCTCCCAATTACCACGTGGATTACATAGCAATGTTGATATTGTGGTAGTTGAACC
    CGAACACAACTCATAA