MEGAResFrom MEG, the Microbial Ecology Group

GYRA

GyrA and B are the two components of the bacterial DNA gyrase (topoisomerase IIa). Mutations in these proteins can cause resistance to fluoroquinolones via evasion of the mechanism of action.

References

Other Groups in Fluoroquinolone-resistant DNA topoisomerases

Sequences

Download Sequences

>Flq|CP001918.1|gene3562|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTTAACATCGAGGAAGAGCTGAAGAGCTCCTATCTGGACTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGACGTCCGCGATGGCCTGAAGCCGGTACACCGTCGCGTACTATACGCCATGAACG
TATTGGGCAATGACTGGAATAAAGCCTACAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGATTCCGCGGTGTACGACACCATCGTTCGTATGGCGCAGCCTTTCTCGCTGCGTTACATGCTGGTAGATGGTCAGGG
TAACTTTGGTTCTATCGACGGCGACTCCGCCGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAGC
TGATGGCCGACCTGGAAAAAGAGACGGTTGATTTCGTTGATAACTACGATGGCACGGAAAAAATTCCTGACGTCATGCCA
ACGAAGATCCCTAACCTGCTGGTGAACGGTTCGTCCGGTATCGCCGTAGGGATGGCGACCAACATTCCGCCGCACAACAT
CACCGAAGTGATCAACGGCTGCCTGGCCTATATCGACGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GCCCGGACTTCCCGACGGCGGCCATCATCAACGGTCGTCGTGGTATTGAAGAAGCGTACCGCACCGGTCGCGGCAAGATT
TACATCCGTGCCCGCGCCGAAGTGGAAGCAGATGCCAAAACCGGCCGTGAAACCATCATTGTTCACGAGATCCCGTATCA
GGTGAACAAAGCGCGACTGATTGAAAAAATCGCCGAGCTGGTAAAAGAAAAACGTGTTGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGATAAAGACGGTATGCGCATCGTGATTGAAATCAAACGCGACGCGGTGGGCGAGGTTGTGCTGAACAACCTG
TACTCTCAGACCCAGCTGCAGGTCTCCTTCGGTATCAACATGGTTGCACTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAAGAGATCCTGAGCGCGTTTGTCCGTCACCGCCGCGAAGTGGTGACCCGTCGTACCATTTTCGAACTGCGCAAAGCGC
GTGACCGTGCCCACATCCTTGAGGCACTGGCCGTGGCGCTGGCCAACATCGACCCGATCATTGAACTGATCCGTCGCGCG
CCAACCCCGGCGGAAGCGAAAACCGCGCTGATTTCCCGTCCGTGGGATCTGGGCAACGTTGCGGCAATGCTGGAGCGTGC
CGGTGATGACGCCGCGCGTCCTGAGTGGCTGGAACCTGAATTCGGCGTGCGTGATGGTCAGTACTACCTGACTGAACAGC
AAGCCCAGGCGATTCTGGATCTGCGTCTGCAGAAACTGACCGGCCTTGAGCATGAAAAACTGCTCGACGAATATAAAGAG
CTGCTGGAGCAGATCGCTGAACTGCTGCACATCCTGGGCAGCGCAGAGCGCCTGATGGAAGTGATCCGCGAAGAGCTGGA
GCTGATCCGCGATCAGTTCGGCGATGAGCGTCGCACCGAAATCACCGCCAACTCCGCAGATATCAACATCGAAGACCTGA
TCAACCAGGAAGACGTTGTTGTGACCCTGTCTCACCAGGGCTACGTGAAGTATCAGCCGTTAACTGACTACGAAGCACAG
CGTCGTGGTGGTAAAGGCAAATCTGCGGCACGTATTAAAGAAGAAGACTTTATTGACCGTCTGCTGGTGGCGAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGTCGTCTGTACTGGATGAAGGTCTACCAGTTGCCGGAAGCGAGCCGTGGTG
CACGTGGTCGTCCGATCGTTAACCTGCTGCCGCTGGAAGCGAACGAACGTATCACCGCCATTCTGCCGGTACGCGAGTAC
GAAGAGGGCGTGAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACCGCGCTGACCGAGTTCAGCCGTCCACG
TTCTGCCGGTATCATCGCGGTGAACCTGAACGAAGGCGATGAGCTGATTGGCGTCGATCTGACTTCAGGCAAAGATGAAG
TCATGCTCTTCTCCGCAGCCGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGCGCAATGGGTCGTACCGCAACGGGC
GTTCGCGGTATCAAACTGGCGGGCGAAGACAGCGTCGTTTCTCTGATTATTCCGCGCGGGGAAGGGGCTATCCTGACCGT
GACGCAGAATGGTTACGGTAAACGTACCGCGGAAGGGGAATACCCAACCAAGTCGCGTGGCACGCAGGGCGTTATCTCTA
TCAAGGTGACCGAGCGCAACGGTTCCGTTGTGGGCGCGGTGCAGGTAGACGATGCCGACCAGATCATGATGATCACCGAT
GCCGGTACGTTGGTGCGTACCCGCGTGTCGGAGATTAGCGTGGTGGGTCGTAATACCCAGGGCGTTATCCTCATCCGTAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGTGTTGCTGAGCCAGTGGACGACGAAGAGCTCGACTCCATCGACGGTA
GCGTCGCGGAAGGTGATGATGATATCGCACCGGAAGTGGACACCGACGATGATGCAGCGGATGATGCTGACGAGTAA

>Flq|NC_009641.5331984|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
TTGAAGGAGGAACTCTTGATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATC
ATTTTTAGATTATGCGATGAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTC
GTATACTATATGGATTAAATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTA
ATGGGTAAATATCACCCTCATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTA
TCCGCTTGTTGATGGCCAAGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTA
TGACTAAAATCACACTTGAACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAA
AGAGAGCCGTCAGTCTTACCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAAC
GAATATTCCACCACATAACTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTG
AGTTAATGGAGGATATTGAAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATAT
GAAACAGGTCGTGGTTCAATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGT
CACTGAAATTCCTTTCCAAGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACG
GTATCACTGATTTACGTGATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCT
AGTGTCATTTTAAATAACTTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGG
TAGACCGAAGCTTATTAATTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGC
AATACAACTTACGTAAAGCTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATT
ATTTCAACGATTCGTGAGTCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACA
AGCTCAAGCTATTTTAGACATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGT
TATTAAATTATATTAGTGAATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACT
GAAATTAGAGATCGTTTCGGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTT
AATTCCAGAAGAACAAATAGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTC
AAAACCGTGGTGGTCGTGGTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACA
CATGACCATGTATTGTTCTTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACA
GTCTAAAGGTATTCCTGTAGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACC
TTGAAAGTGAAGACAACTTCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGA
ATAAATAGAAATGGTAAGATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGA
AGATATCTTGATTGGTACATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAA
CGGGTGTGAAAGGTATTACACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAA
GTATTAGTAGTTACTGAAAATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGG
TATTAAAACAGCTACGATTACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGA
TTGTTACTAATGCAGGTGTCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGC
TTAATTCGCTTAGGTGATGATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGA
TGAGCAATCTACTTCAACTGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAA
ATGCAATTCATACTGAAGTGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGAT
CGTGTTGAAGAAGATATACAACAATCATCAGATGAAGAATAA

>Flq|NC_007793.3912939|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>Flq|NC_008702.1.4606680|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACACAGTTCGCCAAGGAAACGCTGCCGATCAGCCTCGAGGAGGAAATGCGCCACTCCTACCTGGATTACGCCATGAG
CGTGATCGTGGGGCGGGCGCTGCCCGATGCGCGCGACGGCCTGAAGCCGGTGCACCGCCGGGTGCTGTACGCGATGCACG
AGCTTTCCAACGACTGGAACCGCGCCTACAAGAAGTCGGCGCGTATCGTCGGCGACGTCATCGGTAAGTACCACCCGCAT
GGCGACTCGGCGGTGTACGACACCATCGTGCGCATGGCGCAGGATTTCTCGCTGCGCTACATGCTGGTCGACGGCCAGGG
CAACTTCGGCTCGGTCGACGGCGACAACGCCGCGGCGATGCGTTACACCGAAATCCGCATGGCGCGCATCGGTCACGAAC
TGCTGGCCGACATCGACAAGGAAACGGTGGATTTCGGGCCGAACTACGACGGCTCGGAAAAAGAGCCGCTGATCCTGCCG
GCCCGCATCCCCAATCTGCTGATCAACGGTTCCTCCGGTATCGCGGTCGGCATGGCGACCAACATCCCGCCGCACAACCT
GGGCGAAGTGGTCGATGCCTGTCTCAAGCTGCTCGAAGATCCGGAAACCGACCTCGAAGCGCTGATCGAAATCGTCAAGG
CGCCCGACTTCCCCACCGCGGGTCTGATCTACGGCCTGCACGGCGTGCACGAAGGCTATCGCACCGGCCGCGGCCGGGTG
GTGATGCGCGCCCGCACCCATATCGAGCCGATCGGCAAGAACAGCGACCGCGAAGCCATCATCGTCGACGAGCTGCCCTA
CCAGGTGAACAAGCGCACCCTGCTGGAGCGCATCGCCGAGCTGGTCAACGAAAAGAAGGTCGAGGGCATCAGCGAGATCC
GCGACGAGTCGGACAAGTCCGGCATGCGCGTGGTGATCGAACTGAAGCGCAACGAAATGCCCGAGGTGGTGCTCAACAAC
CTGTACAAGCACACCCAGCTGCAGGACACCTTCGGCATGAACATGGTGGCGCTGGTGGACGGCAAGCCCCGCCTGCTCAA
CCTCAAGCAGATGCTGGTGTGCTTCCTCGAGCACCGCCGCGAGGTCGTCACCCGCCGCACCATCTTCGAACTGAAGAAGG
CGCGCGACCGCGGCCACATCCTCGAAGGCCTGGCGGTGGCGCTGTCCAACGTGGACGAGATCATCGCCCTGATCAAGGCC
GCGCCGACGCCGGCGGATGCCAAGCGCGGCCTGATGGAACGCACGTGGCGCTCGCCGCTGGTGGAAGAAATGCTGTCGCG
CGCGCTCGCCGACAGCTACCGCCCGGAAGGGCTGGACCCCGAGTTCGGCTTCTCGGCCCAGGGTTACAAGCTGTCCGACG
CCCAGGCCCAGGCCATCCTGGAACTGCGCCTGCAGCGCCTGACCGGCCTCGAACAGGACAAGATCGTCGGCGAGTACCGC
GAGGTGATGGATCTCATCACCGACCTGCTCGACATCCTGGCCCGTCCCGAGCGCATCACCGCGATCATCGTCGAGGAGCT
GACCGCGATCCGCAACCAGTTCGGCGACCCGCGCCGTTCCGAGATCGTGCTCAGCACCGCCGAGATCAACATCGAGGACC
TGATCACGCCGGAAGACATGGTGGTGACGCTGTCGCACACCGGTTACTTCAAGCGCCAGCCGCTCGCCGACTACCGCGCC
CAGCGTCGCGGCGGCCGCGGCAAGCAGGCCACCTCGATGAAGGACGAGGACTTCATCGACCACCTCTTCGTCGCCAATAC
CCACGACACCGTGCTGTGCTTCTCCAGCCGCGGCCGCGCCTACTGGCTGAAGGTGTACGAGGTGCCCGAAGGCACCCGCA
ACTCGCGCGGCAAGCCGATCGTGAACCTGTTCCCGTTGATCGAGGGCGAGAAGATCACCGCGGTGCTGCCGGTGCAGACC
TTCGATGAAGAGCATTTCGTGTTCATGGCGACTTCGGAAGGCACGGTCAAGAAGACTGCGCTCACCGCTTTCGCCAACCC
GCGCAAGGCCGGCATCATCGCGGTCAACCTCGATGACGGCGACCACCTGATCGGCGTCGCGATCACCGACGGTGAGTGCG
ACGTGATGCTGTTCTCCGACGCCGGCAAGGCCGTGCGCTTTGCCGAGAGCGACGTGCGCCCGATGGGCCGCGAAGCGCGC
GGCGTGCGCGGCATGACGCTGGAAGACGGCCAGCGCGTGATCGCGATGCTGGTCGCCAAGGGCGAAACCCAGTCGGTGTT
GACGGCTACCGAAAACGGTTATGGCAAGCGCACCCCGGTGGCGGAATACACCCGCCACGGCCGCGGCACCAAGGGCATGA
TCGCGATCCAGACCTCGGACCGCAACGGCAAGCTGGTCGGCGCGGTGCTGGTCGATCCGACCGACGAGGTGATGCTGATC
TCCACCGGTGCGGTGCTGATCCGCACCAAGGTGCAGGACATCCGCGAGCTTGGCCGCGCCACCCAGGGCGTGACGCTGAT
CAACCTCGATGAGGGCACGTACCTGGCCGGGATCGAGAAGGTGGCCGAGTCCGGCGCCGAGGCGGACGAACTGGTGGAAG
GTGGCGAAGAGGGCGCCGCGGACGGCGAGGATGCCGGCGCGCCGGGCGCCGCGGGTGAAGGAGAACAGGAATGA

>CARD|pvgb|NC_002952|7004-9665|ARO:3003296|Staphylococcus|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATCTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCACGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTGATCAATGGTGTACTTAGCTTAAGTAAGAATCCTGATATTTCAATTGCTGAGTTAATGGAAGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGCGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTTGTTCGTGACAAGAAAATTGACGGTATTACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCCAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCTCTAGTGAATGGTAGACCGAAGCTGATTAA
TTTAAAAGAAGCGTTAGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGGTTACGTATTGCGTTAGATCATATCGATGAAATTATTTCAACGATTCGTGAA
TCAGAAACAGATAAAGTCGCAATGGAAAGTTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGCTTC
GGTGATGATCGTCGTACTGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAGGACTTAATTCCAGAAGAACAAAT
TGTAATTACTTTGAGCCATAATAACTATATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTAAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAATCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGATAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGCGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAGGATGCAGACGAAGAAAATGAAGATGAACAATCTACTGTATCTGA
AGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAGTGATTGATT
CAGAAGTAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGACCGTGTTGAAGAAGACATACAACAATCA
TCAGATGATGATGAAGAATAAT

>Flq|NC_002516.2.882800|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGGCGAACTGGCCAAAGAAATTCTCCCGGTCAATATCGAAGACGAGCTGAAACAGTCCTATCTCGACTACGCGATGAG
CGTGATCGTCGGGCGGGCCCTGCCGGATGCACGTGACGGCCTGAAGCCGGTGCACCGCCGTGTGCTTTATGCCATGAGCG
AGCTGGGCAACGACTGGAACAAGCCCTACAAGAAATCCGCCCGTGTGGTCGGCGACGTGATCGGTAAGTACCACCCGCAC
GGCGACACCGCGGTCTACGACACCATCGTGCGCATGGCGCAGCCGTTCTCGCTGCGCTACATGCTGGTAGACGGCCAGGG
CAACTTCGGTTCGGTGGACGGCGACAACGCCGCAGCCATGCGATACACCGAAGTGCGCATGGCCAAGCTGGCCCACGAAC
TGCTGGCGGACCTGGAAAAGGAAACCGTCGACTGGGTGCCCAACTACGATGGCACCGAGCAGATCCCGGCGGTCATGCCG
ACCAAGATTCCCAACCTGCTGGTCAACGGTTCCAGCGGTATCGCCGTGGGCATGGCGACCAACATCCCGCCGCACAACCT
CGGCGAAGTGATCGACGGCTGCCTGGCGCTGATGGACAACCCCGACCTGACCGTCGATGAGCTGATGCAGTACATCCCCG
GTCCGGACTTCCCCACCGCCGGCATCATCAACGGCCGCGCCGGGATCATCGAGGCCTACCGCACCGGTCGCGGGCGCATC
TACATCCGTGCCCGCGCCGTCGTCGAGGAGATGGAGAAGGGCGGCGGTCGCGAGCAGATTATCATCACCGAGCTGCCGTA
CCAGTTGAACAAGGCGCGGTTGATCGAGAAGATCGCCGAGCTGGTGAAAGAGAAGAAGATCGAGGGTATTTCCGAGCTGC
GCGACGAGTCTGACAAGGACGGCATGCGCGTGGTCATCGAGCTGCGTCGCGGCGAGGTGGGCGAGGTGGTCCTCAACAAC
CTCTATGCCCAGACCCAGCTGCAGAGCGTGTTCGGCATCAACGTGGTGGCCCTGGTCGACGGCCAGCCGCGCACGCTGAA
CCTGAAGGACATGCTCGAGGTGTTCGTCCGCCACCGCCGCGAAGTGGTGACCCGGCGTACCGTCTACGAGCTGCGCAAGG
CCCGCGAGCGCGGGCACATCCTGGAAGGCCAGGCGGTCGCCCTGTCGAACATCGACCCGGTGATCGAGCTGATCAAGAGT
TCGCCGACCCCGGCCGAGGCCAAGGAACGCCTGATCGCCACTGCCTGGGAGTCCAGCGCGGTGGAAGCGATGGTCGAGCG
TGCCGGCGCCGACGCCTGTCGTCCGGAAGACCTGGATCCGCAGTACGGCCTGCGCGACGGCAAGTACTACCTGTCGCCGG
AGCAGGCCCAGGCGATCCTCGAGCTGCGCCTGCATCGCCTGACCGGCCTGGAGCACGAGAAGCTGCTCTCCGAATACCAG
GAAATCCTCAACCTGATCGGCGAGCTGATCCGCATCCTGACCAACCCGGCGCGCCTGATGGAGGTGATCCGTGAGGAACT
GGAAGCGGTCAAGGCCGAATTCGGCGATGCTCGCCGCACCGAGATCGTGGCTTCCCAGGTCGACCTGACCATCGCCGACC
TGATCACCGAGGAAGACCGCGTGGTGACCATCTCGCACGGCGGCTACGCCAAGTCCCAGCCGCTGGCCGCCTACCAGGCG
CAGCGTCGCGGCGGCAAAGGCAAGTCCGCCACCGGGATGAAGGACGAGGACTACATCGAACACCTGCTGGTGGCCAACAG
CCATGCGACCCTCCTGCTGTTCTCCAGCAAGGGCAAGGTCTACTGGCTGCGTACCTTCGAGATTCCGGAAGCCTCGCGTA
CCGCGCGTGGCCGGCCGCTGGTGAACCTGCTGCCGCTGGATGAGGGCGAGCGGATCACCGCGATGTTGCAGATCGACCTG
GAGGCGCTGCAGCAGAACGGTGGCGCCGATGACGACCTCGACGAAGCCGAAGGCGCGGTGCTCGAGGGCGAGGTGGTCGA
GGCCGCCGAGGTCGAGGAAGTCGAGGGCGAGACCGCCGAGCTGGTGGCCGAGCCGACCGGCGCCTACATCTTCATGGCCA
CCGCCTTCGGTACCGTGAAGAAGACCCCGCTGGTGCAGTTCAGCCGTCCGCGCAGCAGCGGCCTGATCGCGCTCAAGCTG
GAAGAGGGCGACACCCTGATCGCCGCCGCGATCACCGATGGCGCCAAGGAAGTCATGCTGTTCTCCAGCGCCGGCAAGGT
GATCCGCTTCGCCGAGAGCGTGGTGCGCATCATGGGCCGCAACGCCCGCGGCGTACGTGGCATGCGCCTGGGCAAGGGGC
AGCAGCTGATCTCCATGCTGATTCCGGAGTCCGGGGCGCAGATCCTCACCGCCTCCGAGCGCGGCTTCGGCAAGCGTACC
CCGCTGAGCAAGTTCCCGCGTCGCGGCCGCGGCGGCCAGGGGGTGATCGCCATGGTCACCAACGAGCGCAACGGCGCGCT
GATCGCCGCGGTACAGGTCCAGGAAGGCGAGGAGATCATGCTGATTTCCGACCAGGGCACCCTGGTGCGGACGCGTGTCG
ACGAAGTCTCCCTGTCCGGCCGCAATACCCAGGGCGTAACCCTGATCAAGCTCGCCAGCGACGAGGTACTGGTCGGTCTG
GAGCGTGTCCAGGAGCCGTCGGGCGGAGATGACGAGGACCTGCCCGAGGGCGAGGAAGCTGCCGAATCTCTGGGCGAGTC
GGCCGAGTCCGAGTCCGAGCCCGCGGCGGAAGCGGAAGGCAACGAAGAGTAA

>Flq|NC_009487.5169058|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>Flq|NC_002953.2863526|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCTACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAACTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACGCCACTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>Flq|NC_009725.1.5461733|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAAT
GAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACC
CGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGA
CACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAAT
GGAAATCCTCCGGGATATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCA
TGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCAT
CAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGCGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACAT
CCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGAT
CAATCACAATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTAT
CAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACGGATCTGCG
AGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACC
TGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTTGACGGACAGCCGAAGGTACTAAGC
CTGAAACAATGTCTGGAGCATTATCTTGATCACCAAAAGGTTGTGATCCGGCGCAGAACGGCTTACGAACTCCGCAAAGC
GGAAGCGAGAGCTCACATTCTGGAAGGTTTAAGAATTGCTCTCGATCATTTAGATGCCGTTATTTCTCTTATCCGCAATT
CCCAGACGGCTGAAATTGCGAGAACAGGTTTGATCGAACAATTCTCACTGACTGAAAAACAAGCGCAAGCCATTCTGGAT
ATGCGCCTTCAGCGATTAACCGGTCTGGAGCGCGAAAAGATTGAAGAGGAATATCAATCACTTGTTGCGCTTATCGCCGA
GCTGAAAGATATTTTAGCCAATGAAGCAAGAGTTCTTGAGATCATTCGTGAAGAGCTCAATGAAATCAAAGAGCGTTTCA
ATGATGAGAGACGCACTGAAATCGTGACGTCCGGTCTTGAAACAATTGAAGATGAAGATCTTATCGAGAGAGAAAATATC
GTCATCACACTGACCCATAACGGCTATGTTAAACGGCTCCCAGCGTCCACATACCGCAGCCAAAAACGGGGCGGAAAAGG
CGTACAGGGAATGGGAACGAATGAAGATGACTTTGTGGAACATTTAATTTCCACATCAACGCACGATACGATCCTGTTCT
TCTCTAATAAAGGGAAGGTATACCGTTCTAAAGGATATGAAATCCCTGAATACGGCCGTACGGCAAAAGGCATTCCGATT
ATTAACCTTCTGGAGGTTGAAAAAGGCGAATGGATTAATGCCATTATTCCGGTCAGCACGTTTGATGAGGAGCAATACCT
CTTCTTTACGACCAAACAAGGGGTGTCGAAACGTACGGCACTGTCCCAGTTTGCGAATATACGGAATAACGGGCTGATCG
CCCTAGGTCTCCGGGAAGACGATGAACTGATGGCCGTCCGCCTGACTGACGGCAAGAAACAAATCATCATCGGAACGAAG
AACGGTTTGCTGATCCGTTTCCCTGAAGAAGATGTAAGACAAATGGGACGCACAGCTGCGGGTGTTAAAGGCATCACGCT
GACAGACGATGATGTTGTGGTAGGCATGGAGATTCTTGAAGAAGACTCCCACGTCCTCATAGTGACAGAAAACGGCTACG
GCAAACGCACACCGGCTTCAGAATACAGAGTTCAAAGCCGGGGCGGAAAAGGCCTTAAAACATGTAAAATCACTGACAGC
AACGGTCCGTTAGTAACCGTGAAAGCAACAAAAGGCGAAGAGGACTTAATGATTATTACGGCAAGCGGCGTGTTAATCAG
AATGGATATTAATGATATCTCCACTACGGGACGCGTAACACAAGGCGTCCGTCTGATCCGCATGTCTGATCAAGAGCATG
TAGCCACTGTGGCGCTTGTGGAAAAGAATGAAGAAGAGCCGGAAGAAACGGAAGAAGTATAA

>Flq|NC_002163.1.905319|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAGAATATTTTTAGCAAAGATTCTGATATTGAACTTGTAGATATAGAAAATTCTATAAAAAGTAGTTATTTAGACTA
TTCTATGAGTGTTATTATAGGTCGTGCTTTGCCTGACGCAAGAGATGGTTTAAAGCCTGTTCATAGAAGAATTTTATATG
CTATGCAAAATGATGAGGCAAAAAGTAGAACAGATTTTGTCAAATCAGCCCGTATAGTGGGTGCTGTTATAGGTCGTTAT
CACCCACATGGAGATACAGCAGTTTATGATGCTTTGGTTAGAATGGCTCAAGATTTTTCTATGAGATATCCAAGTATTAC
AGGACAAGGCAACTTTGGATCTATAGATGGTGATAGTGCCGCTGCGATGCGTTATACTGAAGCAAAAATGAGTAAACTTT
CTCATGAGCTTTTAAAAGATATAGATAAAGATACGGTCGATTTTGTTCCAAATTATGATGGTTCAGAAAGCGAACCTGAT
GTTTTACCTTCTAGGGTTCCAAATTTATTATTAAATGGTTCAAGTGGTATAGCTGTAGGTATGGCGACAAACATCCCACC
TCATAGTTTAAATGAGTTGATAGATGGACTTTTATATTTGCTTGATAATAAAGATGCAAGCCTAGAAGAGATTATGCAGT
TTATCAAAGGTCCAGATTTTCCAACAGGTGGAATAATTTATGGTAAAAAAGGTATTATAGAAGCTTATCGCACAGGGCGT
GGTCGCGTGAAAGTGCGAGCTAAAACTCATATTGAAAAAAAGACAAATAAAGATGTTATTGTTATCGATGAGCTTCCTTA
TCAAACCAATAAAGCTAGGCTTATAGAGCAGATTGCAGAGCTTGTTAAAGAAAGGCAAATTGAAGGAATATCTGAAGTAA
GAGATGAGAGCAATAAAGAAGGAATCCGCGTTGTTATAGAGCTTAAACGTGAGGCTATGAGTGAAATTGTTTTAAATAAT
CTATTTAAATCTACCACTATGGAAAGTACTTTTGGTGTGATTATGTTGGCAATTCATAATAAAGAACCTAAAATTTTCTC
TTTGTTGGAACTTTTAAATCTTTTCTTAACTCATAGAAAAACAGTTATTATTAGAAGAACGATTTTTGAACTTCAAAAGG
CAAGAGCAAGAGCTCATATTTTAGAAGGTCTTAAAATTGCACTTGATAATATAGATGAAGTGATTGCTTTAATTAAAAAT
AGTTCTGATAATAATACCGCAAGAGATTCTTTAGTAGCTAAATTTGGTCTTAGTGAGCTTCAAGCCAATGCTATTTTAGA
TATGAAACTTGGTCGTTTAACAGGACTTGAAAGAGAAAAAATCGAAAATGAACTTGCAGAATTAATGAAAGAAATTGCAA
GACTTGAAGAAATTTTAAAAAGTGAAACCTTGCTTGAAAATTTAATTCGCGATGAATTAAAAGAAATTAGAAGTAAATTT
GATGTGCCACGTATTACTCAAATTGAAGATGATTACGATGATATTGATATTGAAGATTTGATTCCTAATGAAAATATGGT
TGTAACTATCACACATCGTGGTTATATTAAGCGTGTGCCTAGTAAACAATATGAAAAACAAAAACGAGGTGGAAAAGGAA
AATTAGCCGTTACGACTTATGATGATGATTTTATAGAAAGTTTCTTTACGGCAAATACACATGATACGCTTATGTTTGTA
ACAGATCGTGGACAGCTTTATTGGCTTAAAGTTTATAAAATTCCTGAAGGCTCAAGAACGGCTAAAGGAAAAGCAGTGGT
AAATCTTATCAATTTACAAGCTGAAGAAAAAATCATGGCTATTATTCCAACCACGGATTTTGATGAGAGCAAATCTTTAT
GTTTCTTTACTAAAAATGGTATTGTAAAGCGTACAAATTTGAGTGAATATCAAAATATCAGAAGTGTAGGAGTTAGAGCG
ATCAACTTGGATGAAAATGATGAGTTGGTAACTGCTATTATTGTTCAAAGAGATGAAGATGAAATTTTTGCCACTGGTGG
TGAAGAAAATTTAGAAAATCAAGAAATTGAAAATTTAGATGATGAAAATCTTGAAAATGAAGAAAGTGTAAGCACACAAG
GTAAAATGCTCTTTGCAGTAACCAAAAAAGGTATGTGTATCAAATTCCCACTTGCTAAAGTGCGTGAAATCGGCCGTGTA
AGTCGTGGGGTGACGGCTATTAAGTTTAAAGAGAAAAATGACGAATTAGTAGGTGCAGTTGTTATAGAAAATGATGAGCA
AGAAATTTTAAGCATAAGTGCAAAAGGTATAGGAAAACGCACCAATGCTGGAGAATATAGATTGCAAAGCAGAGGTGGTA
AGGGTGTAATTTGTATGAAACTTACAGAAAAAACCAAAGATCTTATTAGCGTAGTTATAGTAGATGAAACTATGGATTTA
ATGGCTCTTACAAGTTCAGGTAAGATGATACGTGTTGATATGCAAAGCATTAGAAAAGCAGGGCGTAATACGAGTGGTGT
CATTGTAGTTAATGTGGAAAATGACGAGGTGGTTAGCATCGCTAAGTGTCCTAAAGAGGAAAATGACGAGGATGAGTTAA
GCGATGAAAACTTTGGTTTAGATTTGCAATAA

>Flq|CP000647.1|gene2640|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTTAAGAACTCTTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCAGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCACCCGCAC
GGCGACTACGCGGTATACGACACCATCGTGCGTATGGCGCAGCCGTTCTCGCTGCGTTACATGCTGGTGGACGGCCAGGG
TAACTTTGGTTCCATCGACGGCGACTCCGCCGCGGCGATGCGTTATACCGAAATTCGTCTGGCGAAAATCGCTCATGAGC
TGATGGCCGATCTTGAAAAAGAGACGGTCGATTTCGTCGACAACTATGACGGTACGGAGCGTATTCCGGACGTCATGCCG
ACCAAAATTCCTAACCTGCTGGTGAACGGCGCCTCCGGGATCGCCGTAGGGATGGCCACCAACATACCGCCACATAACCT
GACGGAAGTGATTAACGGCTGTCTGGCGTATGTTGACGATGAAGACATCAGCATTGAAGGGCTGATGGCGCATATTCCTG
GCCCTGATTTCCCGACCGCCGCCATTATCAATGGCCGTCGCGGCATCGAAGAGGCCTATCGCACCGGTCGCGGTAAAGTG
TACATTCGCGCGCGCGCGGAAGTGGAAGTGGACGCGAAATCCGGCCGCGAAACCATCATCGTGCACGAAATTCCGTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTCAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGATAAAGACGGGATGCGCATCGTGATTGAAGTGAAGCGCGATGCGGTAGGGGAAGTGGTGCTTAACAACCTC
TATTCCCAGACCCAGCTGCAGGTCTCCTTCGGCATCAACATGGTAGCTCTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAGGACATCATCGCCGCGTTTGTACGCCACCGCCGTGAAGTGGTGACCCGTCGTACGATTTTCGAACTGCGCAAAGCGC
GCGACCGGGCGCATATCCTCGAAGCGCTGGCCGTTGCGCTGGCCAACATCGACCCGATTATCGAACTGATCCGTCGCGCG
CCGACCCCGGCAGAAGCGAAAACGGCGCTGGTTGCCCAGGCGTGGGATCTCGGTAACGTTGCGGCGATGCTGGAGCGCGC
CGGGGATGACGCCGCGCGTCCGGAATGGCTGGAACCAGAGTTCGGCGTGCGCGACGGTAAATACTACCTGACCGAGCAGC
AGGCTCAGGCGATTCTGGATCTGCGTCTGCAGAAACTGACCGGCCTTGAGCATGAAAAACTGCTCGACGAATATAAAGAG
CTGCTGGAGCAGATCGCAGAGCTGCTGCACATTCTCGGCAGCGCCGACCGTCTGATGGAAGTGATTCGCGAAGAGCTGGA
GCTGATCCGCGACCAGTTCGGCGACGAACGTCGTACCGAAATCACCGCCAACAGCGCTGATATTAACATCGAAGATCTGA
TCAACCAGGAAGATGTGGTGGTCACCCTGTCGCATCAGGGGTATGTGAAGTATCAGCCGCTGACCGACTACGAAGCACAG
CGTCGTGGCGGTAAAGGCAAATCGGCAGCGCGCATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCTAACACCCA
TGACACCATCCTCTGCTTCTCAAGCCGCGGCCGTCTGTACTGGATGAAGGTCTATCAGCTGCCGGAAGCCAGCCGCGGCG
CGCGCGGTCGGCCGATCGTCAACCTGCTGCCGCTGGAAGCCGATGAGCGCATTACCGCCATCCTGCCGGTCCGCGAGTAC
GAAGAGGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACCGCGCTGACCGAGTTCAGCCGTCCGCG
TTCCGCCGGTATCATCGCGGTCAACCTGAACGAAGGCGATGAGCTGATCGGCGTCGATCTGACCTCTGGTCAGGATGAAG
TGATGCTGTTCTCCGCGGCCGGTAAGGTTGTACGCTTCAAAGAAGACGCCGTTCGCGCCATGGGCCGTACCGCCACCGGC
GTACGCGGTATTAAGCTTGCGGAAAACGACAGCGTCGTCTCGCTGATTATTCCACGCGGCGAAGGCGCGATCCTGACGGT
GACGCAAAACGGTTACGGTAAACGTACCGCGGCGGCGGAGTATCCGACCAAGTCGCGTGCCACCCAGGGCGTTATTTCGA
TCAAAGTCACCGAGCGTAACGGTTCCGTGGTCGGCGCCGTGCAGGTGGATGACTGCGATCAGATCATGATGATCACCGAC
GCCGGGACGCTGGTGCGTACCCGCGTTTCCGAAGTGAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGCAC
CGCGGAAGATGAAAACGTGGTAGGTCTGCAGCGCGTGGCTGAGCCGGTGGATGATGAAGAGCTGGATGCCATCGACGGTA
GCGCGGCAGAAGGCGATGATGATATCGCCCCGGAAGCGGATACCGATGACGACATCGCCGAAGACGAAGAATAA

>Flq|HE999704.1|gene7|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCAGAAACACCAAATCAACGAATAACAGAGATAAACTTAAATAAAGAAATGCGGACATCATTCCTAGACTATGCGAT
GAGTGTAATTGTTGCCCGTGCCCTACCTGATGTTCGTGACGGGTTAAAACCAGTTCACCGTCGTATTCTATATGCGATGA
ATGACTTAGGTATGACTTCTGATAAAGCCTATAAAAAATCGGCTCGTATCGTTGGTGAAGTAATTGGTAAGTATCACCCC
CACGGCGATACAGCGGTTTATTTTACAATGGTTCGTATGGCGCAAGATTTTAGTTATCGTAATATGCTAGTTGATGGACA
TGGTAACTTTGGTTCGGTCGATGGCGATATGGCGGCAGCGATGCGTTATACAGAAGCACGTATGTCAAAAATTTCGATGG
AACTACTGCGCGATATTAATAAAGACACAATTGATTACGCTGATAACTACGATGGTTCTGAACGTGAGCCAGTTATTTTA
CCAGCGCGTTTCCCTAACTTATTAGTCAATGGTTCGTCAGGTATCGCGGTTGGTATGGCAACAAATATTCCTACCCACCA
TCTTGGTGAAGTAATTGACGGCGTTTTAGCACTTAGTCACGATCCAGAAATTACTATTCGTGATTTAATGGAATATATTC
CAGGCCCTGACTTCCCAACTGCTGGGATGATTATGGGACGTAGCGGAATCCGTCGCGCTTACGAAAGTGGCCGTGGTTCG
ATTACTGTTCGTGGTCGTGTCGATATTGAAGAAAAGAAAAATGGTAAAGAAACTATCGTTATTACCGAAATTCCTTACCA
AGTGAATAAAGCACGCCTAGTTGAACGTATTGCCGAACTAGCTCGTGAGAAGAAAATCGACGGCATCACTTCCCTAAATG
ATGAGTCTGACCGTTCAGGAATGCGGATTGTTATTGAGGTTCGTCGTGATATTAGCGCCAGTGTTATCGTGAATAATTTA
TTCAAAATGACAGCACTTCAAACTACTTTTGGTATTAATATGCTTGCACTTGTCGATAACCATCCAAAAGTGCTTAATTT
AAAAGAAATTCTTTATTATTATTTGGAACATCAAAAAGTAGTTATTCGTCGACGTACAGAATTTGAGCTTCGTAAAGCAG
AAGCACGCGCACATATTTTAGAAGGTTTACGAATCGCTCTTGATAACATTGACGCGATTATTAAATTAATTCGTGGATCA
AAAACTTCCGATGTTGCTAAAGAAGGCTTGATGACACAATTCAACCTTTCTGACAAACAAGCGCAAGCCATTCTGGACAT
GCGTTTGCAACGTTTAACAGGTTTAGAACGCGAAAAAATTGAAGAAGAATATCAAAACTTAGTAGCATTAATTAATGATT
TAAAAGCTATTTTAGCTGATGATGAGCGTATTCTTGAAATTATTCGTGAAGAATTAGAAGAAATCAAAGTTAAATATGCG
GATAAACGTCGTACAGAAATCTTGGCTGGTGATTTAGTAAGCCTTGAAGATGAAGACTTAATCCCTGAAGAAGAAGTAGC
AATTACGCTAACTAAACGTGGTTATATTAAACGTTTACCACTGTCGACTTATCGTAGTCAGCGTCGAGGTGGTCGTGGTA
TTCAAGGTATGTCAACACATGAAGATGACTTCGTAGAACACCTAGTTGCAACGAGCACGCATGATACGTTACTATTCTTC
ACTAACACTGGTAAAGTTTACCGTTCGAAAGGTTATGAAGTACCTGAATACGGTCGTACCGCCAAAGGTATCCCAATAAT
CAACTTACTTGGAATCGAAAGCCAAGAACAAGTGAATGCCGTGATAAATCTATCCGAATTCACCGATGATAGCTACCTAT
TCTTCACGACGAAACATGGTGTCGTGAAGCGTACAACCCTTTCTCAATTTGCGAAAATCCGTCAAAGTGGCCTTCGTGCT
GTAGAACTTCGTGAAAACGATGAACTCATTTCTGTTCAAATGACAGATGGTAGCAAAAACATGATTATCGCAACGAAACA
TGGTCAATCTATCTACTTCCCAGAAGAAAATATCCGTGTAATGGGCCGTACAGCTGCTGGTGTTCGTGGTATTAGACTTC
GTGAAGACGATGAAGTTATCGGCATGGAAGTACTGGAGGACGATGAAAAAGTACTCGTTGTAACGGAAAAAGGTTATGGT
AAACAAACGCCAGCCTCCCAATATCCGCTTCGTAATCGTGGTGGTATGGGTGTTAAAACCGTTACAATCACAGAGAAAAA
TGGTAACTTAGTAGCAATGAAAACTGTTACTGGTGAAGAGGACTTAATGCTAATGACAGTAAGTGGCGTATTAATTCGTT
TCGAAATTGATACAGTATCACAAACTGGTCGTAGCGCAATGGGTGTTAAACTAATTCGTCTTGATGAAGATGAAAAAGTA
GCCACTGTTGCAAAAGTACCAAAAGAAGAAGATGAAGTTGAGCTTGAGGAAGAAATCGACGAAACATTAATCACGCAAGT
TCCTGATGAAAGTTTTGAAGATGCTCCTGGAAGCGACATAGAAGAATAA

>Flq|NC_003197.1.1253794|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAGGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGCGATTCCGCAGTGTATGACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGG
TAACTTCGGTTCTATTGACGGCGACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGGCGAAAATCGCCCACGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTGGATTTCGTGGATAACTATGACGGTACGGAAAAAATTCCGGACGTCATGCCG
ACCAAAATTCCGAATCTGCTGGTGAACGGTTCTTCCGGTATCGCAGTAGGTATGGCGACGAATATCCCGCCGCACAACCT
GACGGAAGTGATTAACGGCTGCCTGGCGTATATCGACAACGAAGACATCAGCATTGAAGGGCTGATGGAACATATTCCGG
GGCCGGACTTCCCGACCGCCGCGATCATCAACGGTCGTCGTGGTATCGAAGAAGCCTACCGCACCGGTCGTGGCAAAGTG
TACATTCGCGCCCGCGCGGAAGTTGAAGCTGACGCCAAAACGGGCCGTGAAACCATCATCGTCCATGAAATTCCCTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGATAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAATCCGACAAAGACGGGATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTGGGCGAGGTGGTGCTTAATAATCTC
TACTCCCAGACCCAGCTACAGGTTTCCTTCGGTATTAACATGGTGGCGCTGCATCACGGCCAGCCGAAGATCATGAACCT
GAAAGATATCATTTCAGCGTTCGTGCGCCACCGCCGTGAAGTGGTGACGCGTCGGACTATTTTTGAACTGCGTAAAGCCC
GTGACCGTGCGCATATCCTTGAAGCTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATCGAACTGATTCGCCGCGCG
CCAACGCCGGCGGAAGCAAAAGCGGCGCTGATTTCGCGTCCGTGGGATCTGGGCAACGTTGCTGCGATGCTGGAGCGCGC
TGGTGATGACGCCGCGCGTCCGGAATGGCTGGAGCCAGAATTTGGCGTGCGTGACGGTCAGTACTACCTGACTGAACAGC
AGGCGCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTGGAGCATGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGAGCAGATTGCTGAATTGCTGCACATTCTGGGCAGCGCCGATCGCCTGATGGAAGTGATCCGCGAAGAGATGGA
GTTAATTCGCGATCAGTTCGGCGATGAGCGTCGTACCGAAATCACCGCCAACAGCGCCGATATTAATATCGAAGATCTGA
TTAGCCAGGAAGATGTTGTCGTGACGCTGTCTCACCAGGGTTACGTCAAATATCAACCGCTGACAGATTACGAAGCGCAA
CGTCGTGGTGGGAAAGGTAAATCTGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCTAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGCCGTCTGTACTGGATGAAGGTCTATCAGCTGCCGGAAGCCAGCCGCGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTGCCGCTGGAAGCCAACGAACGTATCACCGCGATTCTGCCGGTTCGTGAGTAT
GAAGAAGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACGGCGCTGACCGAATTCAGCCGTCCGCG
TTCCGCCGGTATTATCGCGGTGAACCTCAACGACGGCGACGAGCTGATTGGCGTTGACCTGACTTCTGGTTCTGACGAAG
TCATGCTGTTCTCGGCCGCGGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGTGCGATGGGGCGTACCGCGACCGGT
GTGCGCGGTATTAAGCTGGCGGGAGACGATAAAGTCGTCTCTCTGATCATCCCACGCGGCGAAGGCGCTATTCTGACCGT
AACGCAAAACGGCTACGGGAAGCGTACCGCAGCGGACGAGTACCCGACCAAGTCTCGTGCGACGCAGGGCGTTATCTCTA
TCAAAGTGACCGAGCGCAACGGTTCCGTTGTCGGTGCGGTACAGGTAGACGATTGCGACCAGATCATGATGATCACGGAT
GCCGGTACTCTGGTGCGTACCCGTGTGTCCGAGATCAGCGTAGTGGGACGTAATACCCAGGGCGTTATCCTTATCCGCAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGCGTTGCTGAACCGGTAGATGACGAAGAACTCGACGCTATCGACGGCA
GCGTGGCGGAAGGGGATGAGGATATCGCCCCGGAAGCGGAAAGCGATGACGACGTTGCGGATGACGCTGACGAGTAA

>Flq|CP000675.2|gene1514|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGTATACCTAGCCAAAGAAGTCTTACCAGTCAACATAGAAGACGAATTGAAGCAATCCTATTTGGATTATGCGATGAG
TGTCATTGTAGGCCGAGCATTGCCTGATGTACGTGATGGTTTAAAACCGGTGCATAGGCGAGTTCTTTTTGCGATGAGCG
AGTTGGGTAATGATTGGAATAAACCTTATAAAAAATCTGCTCGTGTAGTAGGGGATGTCATCGGTAAATACCATCCTCAC
GGGGATACAGCTGTTTATGACACTATTGTCCGTATGGCCCAACCTTTTTCCATGCGCTACCTTTTAATCGATGGACAGGG
TAATTTTGGCTCTGTAGATGGAGATGCTCCAGCTGCTATGCGTTACACTGAAGTAAGAATGTCCAAAGTGGCACATGCTT
TACTGGCTGACTTGGATAAGGAAACCGTTGATTTTAGTCCTAACTATGATGAAACAGAATTTGCTCCAGTGGTATTGCCA
TCGAGAATTCCCAATTTGCTAGTTAATGGCTCTTCCGGTATTGCGGTAGGGATGGCTACTAATATTCCACCACATAATCT
TACTGAAGTAATCAATGCATGTATTGCCTTAGTGGATGAACCTGACACGAGTCTTGAAGATTTAATGGAAATTATTCCTG
GCCCTGATTTTCCTACAGCAGCAATTATTAATGGTCGTGCTGGAATTATTGAAGGTTATCGTACTGGAAAAGGGCGGGTT
GTTATCAGGGCACGCACAGAAATTGAAACGGATGAAAATTCAGGCCGTCAGTCAATTATTATTCAGGAATTACCTTATCA
GGTGAATAAAGCGCGTTTGATCGAGCGTATCGCTGAATTGGTAAGGGACAAGAAAATCGAGGGAATTTCCGGCTTGAGGG
ATGAGTCAGACAAGCAGGGAATGAGAGTAGTCATTGAATTAAAACGCAATGAAGTAGCAGATGTGGTATTGAATAACCTG
TTCGCTCATACTCAAATGCAAAATGTATTCGGGATTAATATGGTTGCCCTGGTAGATGGCCAACCGCGTACTTTGAATTT
GAAGCAAATACTGGAATATTTTATAAAACATCGAAGAGAGGTTGTTACCAGGCGCACAATATTTGAGTTGAAAAAAGCCA
GAAATCGAGCCCATTTATTGGAGGGCTTGGGAATCGCCTTAGCTAATATCGATGAAATGATCGCGTTAATTAAGCAATCT
CCTACTCCTCAAGACGCAAAAAATGCTTTATTAAGCAAAATATGGCAACCTGGCTTGGTAAAGGCTATGTTGGAAAAGGC
TGGCTCAAACGCGTCAAGGCCTGATGATTTAACTGAAGAGTATGGTTTGCATGAGAACGGATATAAATTATCTGAAGCAC
AGGCACAAGCAATACTTGAATTAAGATTACATAGGCTAACAGCTCTTGAACAAGATAAAATAATTAACGAATTTGAAGAG
CTATTGAATTTAATTAAAGAATTGCTTGATATATTGGCTTCACCTGAAAGACTTATGCAAGTTATTCGTGATGAATTGAT
AGAGATTAAATCCCAATTTGGTGATGAGAGACGAACGGAAATAACAGCCTCACAAGAAGATTTGACTATTGAAGATTTGA
TTACCGAAGAAGACGTTGTGGTCACTTTATCTCATCAAGGTTATGTAAAATATCAGCCCATTACAGCCTATCAGGCTCAG
CGCCGAGGTGGCAAAGGCAAATCAGCAACTCATGTCAAGGATGAGGATTTTGTTGAGCGTTTGGTTATTGCGAGTACTCA
TGACACCTTATTATGTTTCTCCAATCATGGCAAATTATATTGGCTAAAAGCGTATCAATTGCCTCAAGCAAGCCGCACTT
CGAGAGGAAGGCCTATAATTAATATTCTTCCTTTGGCAGAAGGTGAAGAGATTAATGCTATGCTCCCTGTTCGTGAGTAT
AAAGACGGCAGCTATGTGTTTATGGCAACCAAGAAGGGAACAGTTAAAAAAGTACCTTTAAACGCATTTAGCAGGCCGCG
TTCCAATGGTATTATTGCTGTGGACCTGGAAGAAGATGACAGTCTCGTTGGAGTCGATATTACTGATGGTGCTCGCGATA
TTATGTTGTTTACCGATGCAGGCAAAGTAATCCGCTTTGATGAAAGTAAAGTGCGACCTATGGGACGCACGGCTCGAGGA
GTTCGCGGAATTAGGGTAGAAAAGGATCAAGCCGTTAAATCCCTTGTGGTAGTCGACCCAAGTGGAGGTACCATTTTGAC
GGCAACTGAAAACGGCTACGGCAAGAGAACTCATATTGATGAATACCGAGTGTCAGGAAGGGGGGGGCAAGGCGTTATTT
CCATTCAGGTTACTGAACGAAATGGTAAAGTGGTCCGCTCCCTACAGGTTACAGATAATGACGAAGCCATGTTAATTACA
GATAAAGGAACTTTGGTTCGTTTTAAAGTTAATGAATTATCTGTGATAGGCAGAAATACACAAGGAGTTCGCCTGATTAA
TGTCAGTTCTGGTGAGACAGTTGTTGGAATGCAAAAAATTGTAGATCTTGGAGAAGAGTTAGAAGAATCAGAAGATTCAT
CCCTTAATGCTGATGACAACAGTGATGAATAG

>Flq|NC_002952.2859949|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATCTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCACGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTGATCAATGGTGTACTTAGCTTAAGTAAGAATCCTGATATTTCAATTGCTGAGTTAATGGAAGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGCGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTTGTTCGTGACAAGAAAATTGACGGTATTACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCCAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCTCTAGTGAATGGTAGACCGAAGCTGATTAA
TTTAAAAGAAGCGTTAGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGGTTACGTATTGCGTTAGATCATATCGATGAAATTATTTCAACGATTCGTGAA
TCAGAAACAGATAAAGTCGCAATGGAAAGTTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGCTTC
GGTGATGATCGTCGTACTGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAGGACTTAATTCCAGAAGAACAAAT
TGTAATTACTTTGAGCCATAATAACTATATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTAAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAATCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGATAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGCGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAGGATGCAGACGAAGAAAATGAAGATGAACAATCTACTGTATCTGA
AGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAGTGATTGATT
CAGAAGTAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGACCGTGTTGAAGAAGACATACAACAATCA
TCAGATGATGATGAAGAATAA

>Flq|NC_002695.1.916822|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCAGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGCGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTA
TATATCCGCGCCCGTGCTGAAGTGGAAGTTGACGCCAAAACCGGACGTGAAACCATTATCGTCCACGAAATCCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCAAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTGGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCGATGCTCGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCAATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGCTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGTGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAATATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGCGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACGCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTACCAGTTGCCGGAGGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTGCCGCTGGAGCAGGACGAACGTATCACCGCGATCCTGCCGGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACTGTGAAGAAAACCGTCCTCACCGAGTTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGAAGGCGATGAGCTGATCGGCGTTGACCTGACCAGCGGCGAAGACGAAG
TAATGCTGTTCTCCGCCGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAACACCACCGGT
GTTCGCGGTATTCGTTTAGGCGAAGGTGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAGAACGGTTATGGTAAACGTACCGCAGTGGCGGAATACCCGACTAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCAGAAATCAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAACGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>Flq|NC_002758.1119966|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGAAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>Flq|CP000308.1|gene965|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCCAGAGAAATAACACCGGTCAACATCGAGGAAGAGCTGAAAAGCTCCTATCTGGATTATGCGATGTC
CGTTATTGTCGGACGTGCGTTACCAGATGTCCGTGATGGACTGAAACCGGTGCACCGTCGCGTACTGTTTGCGATGAATG
TACTGGGTAATGACTGGAATAAACCATACAAAAAATCGGCCCGTGTAGTCGGGGACGTTATCGGTAAATACCACCCGCAT
GGTGACAGCGCGGTCTACGACACTATCGTGCGTATGGCCCAGCCGTTCTCACTGCGCTATATGCTGGTGGATGGGCAGGG
TAACTTCGGTTCCGTCGATGGTGACTCCGCCGCGGCGATGCGTTATACCGAAATCCGTATGTCTAAAATTGCTCACGAAT
TGTTAGCGGATTTAGAAAAAGATACCGTTGACTTCGTGCCTAACTATGATGGTACGGAACAAATTCCGGCTGTTATGCCG
ACCAGAATCCCTAACCTGCTGGTAAACGGTTCGTCGGGTATTGCGGTAGGGATGGCAACCAATATTCCGCCACATAATCT
TTCTGAGGTTATTGATGGCTGTCTGGCTTATATAGAAGATGAAAACATCAGCATTGAAGGGCTGATGGAGTATATCCCTG
GCCCAGACTTCCCAACAGCAGCCATTATTAATGGCCGCCGTGGTATTGAAGAGGCTTATCGTACTGGTCGCGGTAAGGTC
TATATCCGCGCACGTGCTGAAGTCGAAGCGGATGCCAAAACGGGCCGTGAAACCATTATTGTTCATGAGATCCCGTATCA
GGTGAACAAAGCACGGTTGATTGAGAAAATCGCCGAGCTGGTAAAAGAAAAACGTGTCGAAGGCATCAGCGCGTTACGCG
ATGAGTCTGATAAAGACGGCATGCGCATCGTGATTGAAATCAAACGTGATGCGGTCGGGGAAGTGGTGCTGAATAACCTC
TACTCTCTGACACAATTGCAGGTGACTTTCGGTATCAATATGGTGGCCTTGTCTCAGGGGCAACCGAAGCTGCTTAACCT
GAAAGACATTCTGGTTGCTTTTGTTCGTCACCGTCGTGAAGTGGTGACTCGCCGTACCATTTTTGAACTGCGTAAAGCAC
GTGATCGCGCCCATATCCTTGAAGCGTTGGCGATTGCACTGGCTAACATTGATCCGATTATCGAATTGATTCGCCGTGCA
TCGACCCCTGCGGAAGCAAAAGCCGGTTTGATTGCCAGTCCTTGGGAGTTAGGTAACGTTGCTTCCATGCTGGAACGTGC
TGGTGATGACGCGGCCCGCCCTGAGTGGCTGGAAGCGGAATTTGGTATCCGTGACGGTAAATATTACCTTACCGAGCAAC
AGGCTCAGGCTATTTTGGATCTGCGTTTGCAGAAACTGACAGGTCTGGAGCATGAGAAACTGCTGGATGAGTATAAAGAG
CTGCTCACCTTAATTGGCGAGCTGATCTTTATTCTAGAAAATCCGGATCGCCTGATGGAGGTTATCCGCGAAGAATTAGT
GGCGATCAAAGAGCAATATAACGATCTTCGTCGCACTGAGATCACCGCGAATACCTCTGATATCAATATTGAAGACCTGA
TTAATCAAGAAGATGTGGTTGTGACGTTGTCCCATCAGGGCTACGTCAAATACCAGCCGTTGAGTGATTACGAAGCTCAG
CGTCGTGGTGGTAAAGGTAAATCTGCTGCACGTATCAAAGAAGAAGACTTTATTGATCGCCTGCTCGTTGCCAATACCCA
CGATACCATCTTGTGCTTCTCCAGCCGTGGCCGTCTCTATTGGATGAAGGTCTATCAACTGCCGGAAGCCAGCCGTGGGG
CTCGTGGCCGTCCCATCGTCAACTTGTTGCCGCTTGAGCCAAATGAGCGTATTACCGCCATTCTGCCTGTGCGCGAATAT
GAAGAAGGCTGTCATGTCTTTATGGCTACCGCCAGCGGTACTGTGAAGAAAACGGCATTGACGGAGTTCAGTCGCCCACG
TAGCGCCGGTATTATCGCCGTTAATTTGAACGAAGGTGATGAGCTTATCGGTGTGGATCTGACGGATGGCAGCAATGAAG
TTATGCTGTTCTCAGCATTGGGTAAAGTGGTTCGTTTCCCAGAAGGGCAGGTTCGCTCTATGGGCCGTACCGCAACCGGT
GTCCGTGGGATCAACCTCAATGGCGATGATCGGGTTATTTCTCTGATCATTCCTCGTGGTGATGGTGAAATCCTGACCGT
AACTGAAAACGGTTATGGTAAGCGTACTGCAGTGGCAGAATATCCAACCAAGTCCCGTGCGACTCAGGGGGTTATCTCCA
TTAAAGTCAGTGAGCGTAATGGTAAGGTTGTCGGTGCTGTTCAAGTTGCACCAACTGACCAAATCATGATGATCACTGAT
GCTGGCACACTGGTACGTACTCGCGTATCCGAAGTGAGTGTCGTAGGGCGTAATACCCAAGGTGTGACCCTGATCCGTAC
CGCAGAAGATGAACATGTTGTTGGTTTGCAACGTGTCGCTGAACCTGAAGAGGATGATGATATCCTTGATGGCGAATCAT
CAGAAGGTGAAGAGGGCAGCGAAGAAAACGCGGCACTAAATGCACCATCAGATGATGTTGCCGATGAAGACACTGATGCA
GAAGACGACACTGATGTAGAAGACGACAACGCATAA

>Flq|CP002332.1|gene704|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAAGATCATTTAGTCAATGAAACAAAAAATATTGTAGAAGTGGGGATTGATTCTTCTATTGAAGAGAGCTATTTGGC
TTATTCCATGAGCGTGATCATAGGGCGCGCCTTACCGGACGCTAGAGACGGCTTAAAGCCTGTGCATAGGCGTATTTTGT
ATGCGATGCATGAATTAGGCCTTACTTCCAAAGTCGCTTATAAAAAAAGCGCTAGGATCGTGGGTGATGTGATTGGTAAA
TACCACCCTCATGGCGATAACGCAGTTTATGATGCGTTGGTGAGAATGGCGCAAGATTTTTCTATGCGCTTGGAATTAGT
GGACGGGCAGGGCAACTTTGGCTCTATTGATGGCGATAACGCCGCAGCGATGCGTTACACTGAAGCCAGAATGACCAAGG
CGAGTGAAGAAATTTTAAGGGATATTGATAAAGACACCATTGATTTTGTACCTAATTACGATGACACTTTAAAAGAGCCG
GATATTCTACCAAGCCGTCTGCCTAACCTTTTAGTCAATGGGGCTAATGGGATCGCCGTAGGGATGGCGACTTCTATCCC
CCCCCACAGGATTGATGAAATCATAGACGCTTTAGCGCATGTCTTAGAAAACCCTAACGCTGAATTAGATGAAATCTTAG
AATTTGTCAAAGGGCCTGACTTTCCTACTGGTGGGATCATCTATGGCAAGGCGGGTATTGTTGAAGCCTATAAAACGGGG
CGAGGGCGCGTGAAAGTGCGGGCCAAAGTGCATGTGGAAAAGACAAAAAATAAAGAAATCATCGTTTTAGATGAAATGCC
TTTTCAAACCAATAAAGCCAAATTAGTGGAACAAATCAGCGATTTAGCACGAGAAAAACAAATTGAAGGCATTAGCGAAG
TGCGCGATGAGAGCGATAGAGAGGGAATTAGAGTGGTGATTGAATTAAAAAGAGACGCGATGAGTGAAATTGTCTTAAAC
CACCTTTACAAACTCACCACCATGGAGACCACTTTTAGCATCATTTTACTCGCTATTTACAATAAAGAGCCTAAGATTTT
CACGCTTTTAGAGTTGTTGCGCCTTTTCTTAAACCACAGAAAGACCATTATTATAAGACGCACGATTTTTGAATTAGAAA
AGGCTAAGGCCAGAGCGCATATTTTAGAGGGCTATCTGATCGCCTTGGACAATATTGATGAAATCGTGCGACTCATTAAA
ACAAGCCCAAGCCCAGAAGCGGCTAAAAACGCCTTAATGGAGCGTTTTAGTTTGAGCGAGATCCAAAGCAAAGCCATTTT
AGAAATGCGTTTGCAACGCTTGACAGGCCTTGAAAGGGATAAGATCAAAGAAGAATACCAAAACTTATTAGAGCTTATTG
ATGATCTCAATGGGATTTTAAAGAGCGAAGATCGCTTGAATGAAGTCGTCAAAACAGAGCTTTTAGAAGTCAAAGAGCAG
TTTTCTTCTCCAAGGCGCACTGAAATTCAAGAATCTTACGAAAGCATTGACACAGAAGATTTGATCGCTAATGAGCCTAT
GGTAGTGAGCATGAGCTATAAAGGCTATGTGAAAAGAGTGGATTTAAAAGCCTATGAAAGGCAAAATCGTGGCGGTAAAG
GCAAGCTTTCAGGCAGCACTTATGAAGACGATTTCATTGAAAACTTTTTTGTGGCTAACACGCATGATATTTTGCTCTTT
ATCACCAATAAGGGGCAATTGTATCATTTGAAAGTCTATAAAATCCCAGAAGCGAGCCGGATCGCTATGGGTAAAGCTAT
TGTGAATTTAATCTCACTCGCTCCTAATGAAAAGATCATGGCAACCCTAAGCACTAAAGATTTTAGCGATGAACGCTCTT
TAGCTTTCTTCACAAAAAATGGCGTGGTGAAGCGCACCAATTTGAGCGAATTTGGCGGTAATAGGAGTTATAGCGGTATC
AGAGCGATTGTTTTAGATGAAGGCGATGAATTAGTGGGCGCAAAAGTTGTGGATAAAAACGCTAAGCATTTGCTCATCGC
ATCTTATTTGGGCATGTTCATTAAATTCCCTTTAGAAGACGTGCGCGAAATAGGAAGAACTACTCGTGGGGTTATGGGTA
TTAGACTGAATGAAAATGATTTTGTTGTCGGCGCGGTCGTCATTAGCGATGATAGCAACAAGCTTTTGAGCGTGAGCGAA
AACGGGCTTGGCAAGCAAACTTTAGCCGAAGCGTATAGAGAGCAATCTCGTGGAGGTAAGGGGGTCATTGGCATGAAGCT
CACTCAAAAGACCGGTAATTTGGTGAGCGTTATCAGCGTGGATGATGAGAACCTGGATTTAATGATCCTTACTGCGAGCG
CGAAAATGATCAGAGTTTCCATTAAAGACATTAGAGAAACCGGAAGAAATGCCAGTGGGGTAAAACTCATAAACACCGCT
GATAAAGTCGTGTATGTCAATTCTTGCCCTAAAGAAGAAGAGCCAGAAAATTTAGAAACCTCACGTGCGCAAAATTTGTT
TGAGTGA

>Flq|NC_010611.6235697|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACCGGCCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGGCATATCTTGGAAGGCTTGACAGTTGCTTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGTGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTGATTCCTGAAGAGCAAGTGGTATTAACTGTTTCACAAACGGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCGACTTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAACGTGGGTAAAGTGTACCGTCTGAAAGTTTTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAATTTGTTACCACTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGCGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>Flq|NC_009725.1.5460264|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGGCACAGCCAGAATTATTTCATGATTTACCGTTAGAAGAAGTAATCGGCGACCGTTTCGGACGCTACAGTAAATACAT
TATTCAAGACAGGGCGCTGCCCGACGCTCGTGACGGTTTAAAGCCGGTGCAGCGGAGAATTTTATACGCCATGCACGCGG
ACGGAAATACATTCGATAAAAATTTCCGTAAAGCGGCGAAAACGGTCGGAAACGTTATCGGTAATTATCATCCGCACGGT
GACAGCTCTGTTTATGAAGCGATGGTGCGGATGAGCCAGGATTGGAAAGTGCGGAATGTGCTGATTGAGATGCACGGCAA
CAATGGAAGCATTGACGGTGATCCGCCGGCTGCCATGCGTTATACGGAAGCGAGATTATCTTCTATCGCGTCAGAGCTTT
TGCGTGACATCGATAAAAATACGGTTGAATTCGTTCCGAACTTTGATGACACTAGTAAAGAACCGGTTGTTTTGCCCGCC
ATGTTCCCTAACTTGCTTGTCAACGGATCAACCGGGATTTCAGCGGGCTATGCGACTGATATTCCCCCTCATCATCTGGG
TGAGGTCATTGATGCCGTCATTAAACGGATTGAATCTCCGGATTGCACCGTCGATGACTTGATGCAGGTGATTAAAGGGC
CTGACTTTCCGACAGGAGGCATTATTCAAGGAGTCGACGGCATTCGGAAGGCTTATGAAACCGGGAAAGGCAAAATTATT
ATCCGCGGCAAGGCTGAAGTGGAATCCGTAAGAGGTGGACGGGAGCAGATCGTCATTACAGAAATTCCGTTTGAAGTAAA
CAAAGCCAATCTCGTAAAGAAAATGGACGAATACCGCATAGACAAAAAAGTCGAAGGCATTTCTGAAGTCCGGGATGAAA
CTGACCGCACGGGGCTTCGGGTCGTCGTTGAGTTAAAGAAAGAAGCCGATGCAAAAGGCATTTTGAATTTCTTATATAAA
AACACTGATCTGCAGACAACTTATAACTTTAATATGGTCGCCATACATAACCGCCGGCCGATGCTGATGAGTCTTACGGC
CATCCTGGATGCGTATATTTCCCATCAGAAGGAAGTGGTGACAAACCGCTCCGTCTTTGAATTGCAAAAAGCAAAAGAGC
GGCACCACATCGTTGAAGGACTGATGAAGGCACTGTCTGTGTTAGATGAGGTCATAGCCGTCATCCGGGCAAGCAGCGAC
AAGAAAGATGCGAAACAAAACGTAATGTCTAAATTCACATTTACGGAGCCGCAGGCCGAAGCGATCGTATCCTTGCAGCT
GTATCGTCTGACAAACACGGATATTACGGCGCTAAAAGAGGAAGCGGAAGAGCTCAGCAAGAAAATTCAGGAGCTCGAAG
CCATTTTAAGTCATGATAAAAAGCTGTTAAAAGTCATTACAAGCAGCCTGAAAAAATTGAAAAAGACCTATGCTGACAGC
AGACGGTCTGTCATTGAAGAAAAGATTGAGGAAATTAAAATCAATCTTGAAGTCATGGTTGCCTCTGAGGACGTATATGT
GACAGTCACAAAAGACGGCTATGTAAAACGAACAAGTCAGCGGTCATTTGCCGCTTCTAACGGCCAGGATTTCGGTATGA
AGGATACTGACAGGCTGATTCACCAATTTGAAATGAATACAACGGATGTTCTCCTGCTCTTTACCAATAAGGGAAGCTAT
GTTTATTGTCCGGTTCACCAGCTTCCCGATATCAGGTGGAAAGACATGGGGCAGCACGTAACGAACATCATCACGATTGA
CCGTGATGAAACCATCGTGAAAGCTATACCGGTAAAAGAATTTGATCCATCTTCATATTTATTGTTTATGACGAAAAACG
GCATGGTGAAAAGAACTGAAATGACGCATTACAAAGCGCAGCGTTACTCGAAAGCGCTTGTTGCCCTTAACCTTAAAGGG
GACGACGAGCTGATTGATGTTCATGTCACAGACGGCGGCAGCCAGCTGTTTATCGCCACCCGTCTCGGGTACGGTTTATG
GTTCGGTGAAGATGAAGTAAATGTAGTCGGTGCCCGTGCGGCCGGCGTAAAGGGCATAAATGTAAAAGACGGTGATACCG
TCGTATCAGGACAAATCCTGCATGAGACAGATTCGCTTGTCCTTGTCACACAGCGGGGAGCAATCAAGCGGATGAACCTA
TCTGAATTCGAAAAAACATCCAGGGCGAAGCGCGGTGTCATCATGCTGCGTGAGCTTAAAAAGAACCCGCATCGCGCAGT
CGGCGTATTCGCGTGCGCTTTAGCCGACATGATCGCTGCGGAAACAGAAAAAGGCGAGAGAATCGAAATCGCCGTGAAGT
CCTTGCGGGCGAATGACCGATACAGCAACGGCTCCTTCTTTACCGATGAAGATGAGACAGGGCCGGTAACAGACGTATGG
CGTATCCCCGCGTCTGATGTTTAA

>Flq|AE000516.2|gene6|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACAGACACGACGTTGCCGCCTGACGACTCGCTCGACCGGATCGAACCGGTTGACATCCAGCAGGAGATGCAGCGCAG
CTACATCGACTATGCGATGAGCGTGATCGTCGGCCGCGCGCTGCCGGAGGTGCGCGACGGGCTCAAGCCCGTGCATCGCC
GGGTGCTCTATGCAATGTTCGATTCCGGCTTCCGCCCGGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACC
ATGGGCAACTACCACCCGCACGGCGACGCGTCGATCTACGACACCCTGGTGCGCATGGCCCAGCCCTGGTCGCTGCGCTA
CCCGCTGGTGGACGGCCAGGGCAACTTCGGCTCGCCAGGCAATGACCCACCGGCGGCGATGAGGTACACCGAAGCCCGGC
TGACCCCGTTGGCGATGGAGATGCTGAGGGAAATCGACGAGGAGACAGTCGATTTCATCCCTAACTACGACGGCCGGGTG
CAAGAGCCGACGGTGCTACCCAGCCGGTTCCCCAACCTGCTGGCCAACGGGTCAGGCGGCATCGCGGTCGGCATGGCAAC
CAATATCCCGCCGCACAACCTGCGTGAGCTGGCCGACGCGGTGTTCTGGGCGCTGGAGAATCACGACGCCGACGAAGAGG
AGACCCTGGCCGCGGTCATGGGGCGGGTTAAAGGCCCGGACTTCCCGACCGCCGGACTGATCGTCGGATCCCAGGGCACC
GCTGATGCCTACAAAACTGGCCGCGGCTCCATTCGAATGCGCGGAGTTGTTGAGGTAGAAGAGGATTCCCGCGGTCGTAC
CTCGCTGGTGATCACCGAGTTGCCGTATCAGGTCAACCACGACAACTTCATCACTTCGATCGCCGAACAGGTCCGAGACG
GCAAGCTGGCCGGCATTTCCAACATTGAGGACCAGTCTAGCGATCGGGTCGGTTTACGCATCGTCATCGAGATCAAGCGC
GATGCGGTGGCCAAGGTGGTGATCAATAACCTTTACAAGCACACCCAGCTGCAGACCAGCTTTGGCGCCAACATGCTAGC
GATCGTCGACGGGGTGCCGCGCACGCTGCGGCTGGACCAGCTGATCCGCTATTACGTTGACCACCAACTCGACGTCATTG
TGCGGCGCACCACCTACCGGCTGCGCAAGGCAAACGAGCGAGCCCACATTCTGCGCGGCCTGGTTAAAGCGCTCGACGCG
CTGGACGAGGTCATTGCACTGATCCGGGCGTCGGAGACCGTCGATATCGCCCGGGCCGGACTGATCGAGCTGCTCGACAT
CGACGAGATCCAGGCCCAGGCAATCCTGGACATGCAGTTGCGGCGCCTGGCCGCACTGGAACGCCAGCGCATCATCGACG
ACCTGGCCAAAATCGAGGCCGAGATCGCCGATCTGGAAGACATCCTGGCAAAACCCGAGCGGCAGCGTGGGATCGTGCGC
GACGAACTCGCCGAAATCGTGGACAGGCACGGCGACGACCGGCGTACCCGGATCATCGCGGCCGACGGAGACGTCAGCGA
CGAGGATTTGATCGCCCGCGAGGACGTCGTTGTCACTATCACCGAAACGGGATACGCCAAGCGCACCAAGACCGATCTGT
ATCGCAGCCAGAAACGCGGCGGCAAGGGCGTGCAGGGTGCGGGGTTGAAGCAGGACGACATCGTCGCGCACTTCTTCGTG
TGCTCCACCCACGATTTGATCCTGTTCTTCACCACCCAGGGACGGGTTTATCGGGCCAAGGCCTACGACTTGCCCGAGGC
CTCCCGGACGGCGCGCGGGCAGCACGTGGCCAACCTGTTAGCCTTCCAGCCCGAGGAACGCATCGCCCAGGTCATCCAGA
TTCGCGGCTACACCGACGCCCCGTACCTGGTGCTGGCCACTCGCAACGGGCTGGTGAAAAAGTCCAAGCTGACCGACTTC
GACTCCAATCGCTCGGGCGGAATCGTGGCGGTCAACCTGCGCGACAACGACGAGCTGGTCGGTGCGGTGCTGTGTTCGGC
CGACGACGACCTGCTGCTGGTCTCGGCCAACGGGCAGTCCATCAGGTTCTCGGCGACCGACGAGGCGCTGCGGCCAATGG
GTCGTGCCACCTCGGGTGTGCAGGGCATGCGGTTCAATATCGACGACCGGCTGCTGTCGCTGAACGTCGTGCGTGAAGGC
ACCTATCTGCTGGTGGCGACGTCAGGGGGCTATGCGAAACGTACCGCGATCGAGGAATACCCGGTACAGGGCCGCGGCGG
TAAAGGTGTGCTGACGGTCATGTACGACCGCCGGCGCGGCAGGTTGGTTGGGGCGTTGATTGTCGACGACGACAGCGAGC
TGTATGCCGTCACTTCCGGCGGTGGCGTGATCCGCACCGCGGCACGCCAGGTTCGCAAGGCGGGACGGCAGACCAAGGGT
GTTCGGTTGATGAATCTGGGCGAGGGCGACACACTGTTGGCCATCGCGCGCAACGCCGAAGAAAGTGGCGACGATAATGC
CGTGGACGCCAACGGCGCAGACCAGACGGGCAATTAA

>Flq|FQ312006.1|gene1417|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACGGATTCAATCCAATCATCTATCACCCCTGTCAATATCGAAGAAGAACTTAAATCTTCCTACCTTGACTACGCGAT
GTCGGTTATCGTTGGGCGTGCATTACCTGACGTTCGAGATGGTTTAAAACCTGTTCACCGCCGCGTACTATTCTCAATGG
ATCGCGAAGGCAATACCGCCAATAAAAAATACGTAAAATCAGCGCGTGTTGTGGGTGATGTAATCGGTAAATATCACCCG
CATGGTGACTCAGCCGTGTACGATACAATCGTTCGTATGGCACAACCCTTCTCACTTCGCTATATGTTGGTTGATGGGCA
AGGTAACTTTGGTTCAATTGACGGCGATGCACCTGCTGCAATGCGTTATACCGAAGTGCGTATGCAAAAAATTACGCAAG
CATTGCTCACGGATTTGGATAAAGAAACCGTCAATTTCTCGCCAAACTATGATGGCGAATTAATGATTCCAGATGTATTG
CCGACTCGTATTCCAGCACTTTTAGCAAATGGTTCTTCTGGTATTGCGGTGGGGATGGCAACTAACATTCCCCCTCACAA
CTTAAACGAAGTATTAAATGGTTGTTTGGCTTATATTGACAACAATGAAATTACCATTGATGAATTAATGCAACATATTC
CGGGCCCAGACTTTCCAACCGCTGCATTAATTAATGGTCGTAAAGGGATTGAAGAAGCCTATCGCACTGGTCGTGGTAAA
GTGTATGTTCGTGCTCGTGCAACCGTAGAAACCAACGAAAAAGGACGCGAGCAAATTATCGTGTCTGAATTGCCATACCA
AGTAAATAAAGCAAAATTAGTCGAGAAAATCGCCGAATTAATTCGCGAGAAAAAAATCGAAGGTATCAGCAATATTACTG
ACCTTTCAAATAAAGAAGGGATCCGTATTGAAATTGATATTAAACGTGATGCAGTGGGGGAAGTGGTATTAAACCATCTT
TACTCACTCACTCAAATGCAAGTGACCTTTGGTATCAATATGGTGGCATTGGATCACGGTCAGCCACGTTTATTTAATCT
TAAAGAAATTATTGAAGCCTTTGTTTTACACCGCCGTGAAGTCGTTACACGTCGTTCTATCTTTGAGCTTCGCAAAGCAC
GTGAACGTACGCATATTTTGGAAGGTTTAGCGGTTGCTCGTTCTAATATCGATGAAATGATTGCGATCATTCGTAACTCT
AAAAACCGTGAGGAAGCGGCAACAGCAATCAGTTCACGCTCTTGGACGTTACATAGCGATATTATTAATCTTCTTGATGC
TTCTGCTCGTCCTGATGAGTTAGAAGAAAATCTTGGTATTCAAGGCGAACAATATTACTTATCGCCAGCGCAAGTAAACG
CAATTCTAGAACTTCGTTTACACCGTTTAACGGGCATTGCGTTTGAAGAAGTTATAAAAGAATATGAAGAATTATTAGTT
AAAATTGCGGATCTTCTTCATATTTTAAGTAGCGCAGAACGTTTAATGGAAGTAATTCGTGAAGAATTGGAAGAAGTAAA
AGCACAATTTGGTGATGATCGTTTAACTGAAATTACCGCTGCTTCTGGCGATATTGATTTAGAAGATTTAATCGCACAAG
AAGACGTGGTTGTGACGCTTTCTCACGAAGGTTATGTGAAATACCAACCACTGACTGACTATGAAGCACAACGCCGTGGC
GGTAAAGGCAAATCTGCAACGAAGATGAAAGAAGAAGATTTCATCGAAAAATTACTGGTAGCAAATACTCACGATACCAT
CCTCTGCTTCTCTAGCCGTGGTCGTTTATATTGGTTGAAAGTATATCAACTTCCGCAAGCGAGCCGTGGCGCACGCGGGC
GTCCAATTGTGAATATTCTTCCGTTACAAGAAAACGAACGTATTACTGCAATCTTGCCAGTTTCTGCTTACGAAGAAGAT
AAATTCGTAGTCATGGCAACTGCTGGCGGTATTGTGAAGAAAATCGCCTTAACCGAATTTAGCCGTCCACGTTCAAACGG
TATCATCGCATTGAATTTACGTGACGAAGATGAATTAATCGGCGTGGATATTACTAATGGCAGCAACGAAATTATGTTGT
TCTCATCGCAAGGTCGCGTGGTGCGTTTTGCTGAAAATGCCGTGCGTGCAATGGGGCGTTTAGCAACAGGTGTTCGCGGT
ATCAAACTGGCTTTAACAAACGATATTTCTGACGATGAAAGTGCGGTAGAAATTGAAGATATTTCTGATGACAACGCTGA
AGCATCATTAGACTTAAATATCGATAAAGTGGTTTCTCTCGTTGTGCCAAAAGGTGAAGGGGCAATTTTAACCGCAACAC
AAAACGGCTACGGAAAACGCACACAATTAAGTGAATACCCAACTAAATCACGTAATACAAAAGGTGTGATTTCGATTAAA
GTGAGTGAACGCAATGGTAAAGTCGTTGCCGCAACTCAAGTAGAAGAAACAGACCAAATTATGTTGATCACTGATGCAGG
AACGCTTGTTCGCACACGCGTAAGCGAAGTGAGCATTGTAGGGCGTAACACGCAAGGTGTCCGTTTAATTCGTACCGCAG
ATGATGAACACGTAGTAAGTTTAGAGCGTGTTTGTGATGCGGATGAAGAAGATTCTTTGGAAGAAAGTAGTTCTGAAGAA
TAA

>Flq|CP001138.1|gene2385|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGCGATTCCGCAGTGTATGACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGG
TAACTTCGGTTCTATTGACGGCGACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGGCGAAAATCGCCCACGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTGGATTTCGTGGATAACTATGACGGTACGGAAAAAATTCCGGACGTCATGCCG
ACCAAAATTCCGAATCTGCTGGTGAACGGTTCTTCCGGTATCGCAGTAGGTATGGCGACGAATATCCCGCCGCACAACCT
GACGGAAGTGATTAACGGCTGCCTGGCGTATATCGACAACGAAGACATCAGCATTGAAGGGCTGATGGAACATATTCCGG
GTCCGGACTTCCCGACCGCCGCGATCATCAACGGTCGTCGTGGTATCGAAGAAGCCTACCGTACCGGTCGTGGCAAAGTG
TACATTCGCGCCCGCGCGGAAGTTGAAGCTGACGCGAAAACGGGCCGTGAAACCATCATCGTCCATGAAATTCCCTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGATAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAATCCGACAAAGACGGGATGCGCATCGTGATTGAAGTAAAACGCGATGCGGTGGGCGAGGTGGTGCTTAATAATCTC
TACTCCCAGACCCAGCTACAGGTTTCCTTCGGTATTAACATGGTGGCGCTGCATCACGGCCAGCCGAAGATCATGAACCT
GAAAGATATCATTTCAGCGTTCGTGCGCCACCGCCGTGAAGTGGTGACGCGTCGGACTATTTTTGAACTGCGTAAAGCCC
GTGACCGCGCGCATATCCTTGAAGCTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATCGAACTGATTCGCCGCGCG
CCAACGCCGGCAGAAGCAAAAGCGGCGCTGATTTCGCGTCCGTGGGATCTGGGCAACGTTGCTGCGATGCTGGAGCGCGC
CGGTGATGACGCCGCGCGCCCGGAATGGCTGGAGCCAGAATTTGGCGTGCGTGACGGTCAGTACTACCTGACTGAGCAGC
AGGCGCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTGGAGCATGAAAAACTGCTCGACGAATACAAAGAG
TTGCTGGAGCAGATTGCTGAACTGCTGCACATTCTGGGCAGCGCCGATCGCCTGATGGAAGTGATCCGTGAAGAGATGGA
GTTAATTCGCGATCAGTTCGGCGATGAGCGTCGTACCGAAATCACCGCCAACAGCGCCGATATTAATATCGAAGATCTGA
TTAGCCAGGAAGATGTTGTCGTGACGCTGTCTCACCAGGGTTACGTCAAGTATCAACCGCTGACGGATTACGAAGCGCAA
CGTCGTGGTGGGAAAGGTAAATCTGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCCAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGCCGTCTGTACTGGATGAAGGTCTATCAGTTGCCGGAAGCCAGTCGTGGCG
CGCGCGGTCGTCCGATCGTCAATCTACTGCCGCTGGAAGCCAACGAACGTATCACCGCGATTCTGCCGGTTCGTGAGTAC
GAAGAAGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACGGCGCTGACCGAATTCAGCCGTCCGCG
TTCCGCCGGTATTATCGCGGTAAACCTCAACGACGGCGACGAGCTGATTGGCGTTGACCTGACTTCTGGTTCTGACGAAG
TCATGCTGTTCTCGGCCGCGGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGTGCGATGGGGCGTACCGCGACCGGT
GTGCGCGGTATTAAGCTGGCGGGAGACGATAAAGTCGTCTCTCTGATCATCCCACGCGGCGAAGGCGCTATTCTGACCGT
AACGCAAAACGGCTACGGGAAGCGTACCGCAGCGGACGAGTACCCGACCAAGTCTCGTGCGACGCAGGGCGTTATCTCTA
TCAAAGTGACCGAGCGCAACGGTTCCGTTGTCGGTGCGGTACAGGTAGACGATTGCGACCAGATCATGATGATCACGGAT
GCCGGTACTCTGGTGCGTACCCGTGTGTCCGAGATCAGCGTAGTGGGACGTAATACCCAGGGCGTTATCCTTATCCGCAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGCGTTGCTGAACCGGTAGATGACGAAGAACTCGACGCTATCGACGGCA
GCGTGGCGGAAGGGGATGAGGATATCGCCCCGGAAGCGGAAAGCGATGACGACGTTGCGGATGACGCTGACGAGTAA

>CARD|pvgb|U00096|2336792-2339420|ARO:3003294|Escherichia|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
TTATTCTTCTTCTGGCTCGTCGTCAACGTCCACTTCCGGAGCGATTTCATCGTCCCCTTCCGCGGCACTGCCGTCGATGG
TATCCAGATCTTCCTCGTCAACCGGTTCAGCAACACGTTGCAGACCCACTACGTTTTCATCTTCCGCAGTACGGATGAGG
ATCACGCCCTGGGTGTTACGGCCCACGATGCTGATTTCCGAAACGCGAGTACGTACCAGCGTACCGGCATCGGTGATCAT
CATGATCTGGTCGCAGTCATCTACCTGTACCGCGCCAACAACTAAACCGTTACGTTCGGTAACCTTGATGGAGATAACCC
CTTTCGTCGCACGCGACTTGGTTGGGTATTCCGCCACTGCGGTACGTTTACCGTAACCGTTTTGCGTTGCGGTGAGGATT
GCGCCATCGCCACGAGGCACGATCAGAGAGACGACTTTATCGCCTTCACCTAAGCGAATACCGCGAACACCGGTGGTGTT
GCAGCCCATCGCACGGACAGAAGACTCTTTAAAGCGCACCACTTTACCTTCAGCGGAGAACAGCATTACTTCGTCTTCGC
CGCTGGTCAGGTCAACGCCGATCAGCTCATCGCCGTCAACCAGTTTGATCGCCACTTTACCGGCGGTACGCAGACGGTTG
AACTCGGTGAGGACAGTTTTCTTCACGGTACCGTTAGCGGTCGCCATGAAGACTTTCACGCCTTCTTCAAACTCGGTCAC
TGGCAGGATCGCAGTGATACGTTCGTCCTGCTCCAGCGGCAGCAGGTTGACGATCGGACGACCGCGCGCGCCACGAGTGG
CTTCCGGCAACTGATAAACTTTCATCGAATAGACGCGACCACGGCTGGAGAAGCACAGAATATGGTCGTGAGTGTTCGCC
ACCAGCAGTCGGTCGATAAAGTCTTCTTCTTTAATACGTGCGGCAGATTTACCTTTCCCGCCACGACGCTGCGCTTCGTA
TTCAGAAAGCGGCTGATACTTAACGTAGCCCTGGTGAGAGAGCGTCACGACCACATCTTCCTGGGTGATCAGATCTTCCA
GGTTGATGTCTGCGCTGTTGGCGGTGATTTCAGTACGACGTTTGTCACCGAACTGTTCACGAACCAGCTCCAGCTCTTCA
CGGATCACTTCCATCAGACGATCGGCGCTACCAAGAATACGCAACAGTTCCGCGATCTGATCCAGCAGCTCTTTGTATTC
GTCGAGCAGTTTTTCGTGCTCAAGACCGGTCAGTTTCTGCAAACGCAGATCCAGAATCGCCTGAGCTTGCTGTTCGGTCA
GGTAGTACAGACCATCACGCACGCCGAACTCTGGCTCCAGCCATTCCGGACGCGCAGCATCGTCGCCAGCACGTTCGAGC
ATCGCGGCAACGTTGCCCAGCTGCCACGGATTAGCAACCAGCGCAGTTTTCGCTTCTGCAGGCGTCGGCGCATGACGGAT
CAGTTCGATGATCGGGTCGATGTTCGCCAGCGCCACGGCTAATGCTTCAAGGATATGAGCACGATCGCGAGCTTTACGCA
GTTCGAAAATAGTACGACGGGTCACCACTTCACGGCGGTGACGAACAAACGCCGCGATGATGTCTTTCAGGTTCATGATC
TTCGGCTGACCATGGTGCAATGCCACCATGTTGATACCGAAAGAAACCTGCAACTGGGTCTGGGAGTAGAGGTTGTTGAG
CACAACTTCACCGACCGCATCGCGTTTCACTTCAATCACGATGCGCATACCGTCTTTGTCAGACTCGTCACGCAGCGCGC
TGATGCCTTCCACGCGTTTTTCTTTTACCAGTTCCGCAATCTTCTCGATCAGGCGCGCTTTGTTTACCTGATACGGAATT
TCGTGGACGATAATGGTTTCACGACCGGTTTTGGCGTCAACTTCCACTTCTGCGCGAGCGCGGATATACACCTTGCCGCG
ACCGGTACGGTAAGCTTCTTCAATACCGCGACGACCGTTAATGATTGCCGCCGTCGGGAAGTCCGGCCCCGGGATGTGTT
CCATCAGCCCTTCAATGCTGATGTCTTCATCATCAATATACGCCAGACAACCGTTGATGACTTCCGTCAGGTTGTGCGGC
GGGATGTTGGTTGCCATACCTACGGCGATACCGGAAGAACCGTTCACCAGCAGGTTAGGAATTTTGGTTGGCATGACGTC
CGGAATTTTTTCCGTGCCGTCATAGTTATCAACGAAATCGACCGTCTCTTTTTCGAGATCGGCCATCAGTTCATGGGCAA
TTTTCGCCAGACGGATTTCCGTATAACGCATTGCCGCCGCAGAGTCGCCGTCGATAGAACCGAAGTTACCCTGACCGTCT
ACCAGCATATAACGCAGCGAGAATGGCTGCGCCATGCGGACGATCGTGTCATAGACCGCCGAGTCACCATGGGGATGGTA
TTTACCGATTACGTCACCAACGACACGGGCAGATTTTTTATAGGCTTTGTTCCAGTCATTGCCTAGTACGTTCATGGCGT
AAAGTACGCGACGGTGTACCGGCTTCAGGCCATCTCGGACATCTGGCAGCGCACGGCCAACAATGACCGACATCGCATAA
TCCAGATAGGAGCTCTTCAGCTCTTCCTCAATGTTGACCGGTGTAATTTCTCTCGCAAGGTCGCTCATC

>Flq|NC_011586.7046500|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCGGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATA
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAGGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTCAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGTGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACTGTTTCACAAACAGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCTATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCACGCGACCGTACTTTGCTTTACCAACGTGGGTAAAGTGTACCGTTTGAAAGTATTTGAGGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACTGCAATCTTGCCATTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGCGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTTGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>Flq|NC_012469.1.7686721|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAGGATAAAAATTTAGTGAATGTCAATCTGACAAAGGAGATGAAGGCAAGTTTTATCGACTACGCCATGAGTGTTAT
CGTAGCGCGAGCTCTTCCTGATGTTCGAGATGGCTTAAAACCTGTTCACCGTCGCATTCTCTACGGAATGAATGAATTGG
GTGTGACCCCAGACAAACCCCATAAAAAATCTGCTCGTATTACAGGGGATGTCATGGGTAAATATCACCCACACGGGGAT
TCCTCTATTTATGAAGCCATGGTCCGTATGGCTCAATGGTGGAGCTACCGTTACATGCTTGTAGATGGTCATGGGAATTT
TGGTTCCATGGATGGAGATAGTGCTGCCGCTCAACGTTATACCGAGGCACGTATGAGCAAGATTGCTCTGGAAATGCTTC
GTGATATCAACAAAAATACAGTTGATTTCGTTGATAACTATGATGCCAATGAACGGGAACCCTTGGTCTTGCCAGCGCGT
TTTCCAAACCTTTTGGTTAATGGAGCAACTGGTATCGCGGTTGGGATGGCAACCAATATTCCACCTCATAATCTGGGTGA
AACCATTGATGCAGTGAAGTTGGTCATGGATAATCCTGAAGTGACTACCAAGGACTTGATGGAAGTCTTGCCTGGACCAG
ATTTTCCAACTGGTGCTCTTGTCATGGGGAAATCAGGTATCCATAAGGCTTATGAAACAGGTAAAGGTTCGATTGTCCTA
CGTTCTCGTACAGAGATTGAAACGACTAAGACTGGTCGTGAGCGTATCGTTGTAACAGAATTTCCTTACATGGTCAATAA
AACCAAGGTGCATGAGCATATTGTTCGCTTGGTTCAGGAAAAACGCATTGAGGGTATCACAGCAGTACGTGATGAGTCAA
ACCGTGAAGGTGTTCGATTTGTTATTGAAGTCAAGCGCGACGCCTCAGCCAATGTTATTCTCAATAACCTCTTCAAAATG
ACCCAAATGCAAACCAATTTTGGTTTCAATATGCTCGCTATCCAAAATGGTATACCGAAAATTTTGTCTCTTCGTCAGAT
TTTGGATGCTTATATCGAGCACCAAAAAGAAGTGGTTGTTCGTCGTACACGTTTTGATAAGGAAAAAGCGGAAGCGCGCG
CTCATATCTTAGAAGGTCTCTTGATTGCGCTAGACCATATCGACGAAGTGATTCGTATCATCCGTGCTAGTGAAACGGAT
GCGGAAGCTCAAGCTGAGTTGATGAGCAAGTTTAAGCTTTCTGAACGTCAAAGTCAAGCTATCCTTGATATGCGTCTTCG
TCGTTTGACAGGTTTGGAACGCGATAAGATTCAATCTGAGTATGATGACCTCTTGGCTCTGATTGCGGATTTAGCAGATA
TTCTTGCTAAGCCTGAACGTGTTTCTCAAATTATCAAAGACGAATTGGATGAAGTTAAACGTAAATTTTCTGATAAGCGC
CGTACAGAGTTGATGATTGGACAGGTCTTGAGTCTCGAGGATGAGGACTTGATTGAAGAATCGGATGTCTTGATTACCCT
TTCTAACAGAGGCTACATTAAGCGTTTGGATCAGGACGAGTTCACTGCTCAAAAACGTGGGGGTCGTGGTGTCCAAGGAA
CGGGAGTGAAAGATGATGACTTTGTTCGTGAGTTAGTGTCAACTAGCACCCATGATCATCTGCTCTTCTTCACAAACAAG
GGACGTGTCTATCGTCTTAAAGGTTATGAAATTCCTGAGTATGGTCGGACTGCCAAAGGGCTACCAGTAGTCAATCTCTT
GAAATTGGATGAAGACGAAAGTATTCAGACGGTTATCAATGTTGAGTCTGATCGCAGTGATGATGCTTATCTCTTCTTTA
CAACCCGTCACGGTATTGTGAAGAGAACCAGTGTTAAGGAGTTTGCCAATATTCGTCAAAATGGTCTCAAAGCGCTGAAT
TTAAAGGATGAAGATGAGTTAATCAATGTCTTGTTGGCAGAAGGAGATATGGATATTATCATTGGTACCAAGTTTGGTTA
TGCAGTTCGCTTTAATCAATCAGCCGTTCGTGGTATGAGTCGTATCGCCACTGGTGTGAAAGGTGTTAACCTTCGTGAAG
GAGACACAGTTGTTGGTGCCAGCTTGATTACTGATCAAGATGAGGTTCTTATTATCACAGAAAAAGGATATGGTAAGCGT
ACAGTCGCTACTGAATACCCAACAAAAGGTCGTGGTGGTAAGGGAATGCAGACAGCTAAAATTACCGAAAAAAATGGCTT
GCTGGCCGGTCTTATGACTGTTCAAGGGGATGAGGATTTGATGATTATCACTGATACAGGTGTCATGATTCGAACCAATC
TTGCCAATATTTCACAAACAGGACGTGCAACTATGGGAGTTAAAGTAATGCGCCTGGATCAAGATGCTCAGATAGTGACT
TTCACAACGGTTGCGGTGGCAGAAAAAGAAGAAGTTGGGACAGAAAACGAAACAGAAGGTGAAGCATAA

>Flq|CP004022.1|gene1837|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACATTGCCAGAGAAATCACACCAGTTAATATCGAAGAAGAGCTGAAAAGCTCATATTTGGATTATGCGATGTC
CGTTATTGTAGGACGCGCATTACCCGATGTTCGAGACGGACTGAAGCCAGTACACCGCCGAGTGCTATTTGCGATGAATG
TACTGGGAAACGATTGGAATAAACCTTATAAAAAATCAGCCCGTGTTGTTGGGGATGTAATCGGTAAATATCACCCGCAC
GGTGACAGTGCTGTCTATGAAACGATTGTTCGTTTAGCACAGCCTTTTTCTATGCGCTACATGTTGGTTGACGGTCAGGG
TAACTTCGGGTCAGTTGATGGTGACTCCGCGGCGGCTATGCGTTATACCGAAGTTCGTATGGCGAAGATCGCCCATGAAC
TGCTGGCGGATTTGGAAAAAGAGACGGTCGACTTTGTTCCTAACTATGATGGAACAGAAAATATACCGGCTGTTATGCCA
ACCCGTATTCCAAACTTGTTAGTTAATGGCTCTTCAGGTATTGCCGTTGGGATGGCAACGAATATCCCTCCGCATAACCT
CGGTGAAGTTATCGACGGTTGTCTTGCCTATGTTGATAATGAAGACATCACCATAGAAGAATTAATGGAATATATTACCG
GGCCTGATTTTCCGACTGCTGCGATTATTAATGGTCGCAGAGGAATATTAGATGCTTATCGTACAGGGCGTGGAAAGATT
TATATCCGTGCTCAGGCTGATATTGAAACTGATGAGAAAACAGGTCGCGAAACCATTATCGTGACAGAAATTCCTTATCA
GGTGAATAAAGCCCGTTTAATTGAAAAAATTGCGGAGCTTGTAAAAGATAAACGTATTGAAGGTATCAGCGGATTACGTG
ACGAGTCTGATAAAGACGGTATGCGTATTGTTGTTGAGATCAAACGTGATGCAGTCGGTGAAGTAGTATTAAATCACCTC
TTTTCACAAACTCAAATGCAAGTCTCTTTTGGTATTAATATGGTTGCGCTTCATCAAGGCCAACCAAAATTATTGAACCT
AAAAGAAATTATCGCAGCCTTTATTCGCCATCGTCGTGAAGTGGTGACTCGTCGTACCATTTTTGAATTACGTAAAGCAC
GTGATCGTGCTCATATCTTAGAAGCACTTGCGGTCGCTTTGGCCAATATCGATCCTGTGATTGAATTAATTCGTCAAGCA
CCAACCCCAGCAGAAGCGAAAGCGGCATTAATTGCCCAACCTTGGGATCTCGGTAGCGTGTCTACGATGTTAGAGCGTGC
TGGTGATAGCAATGTTGCTCGCCCTGAGTGGTTAGAGCCACAATTTGGTGTGCATGACGGTAAATACTATCTAACAGAAC
AACAAGCACAAGCCATTTTAGATTTGCGGTTGCAGAAACTGACCGGACTTGAGCATGAAAAACTGCTAGATGAATATCGT
GAATTACTGCTACAAATTGCTGAGTTATTGCATATTTTGAGAAGCCCTGAGCGTTTAATGGACGTTATTCGTGAAGAGCT
AACAGCAATTAAAACACAATATAACGATCCTCGTCGTACTGAAATCACTGAAAATACCGCTGATATTAATATCGAAGATC
TGATTAATGAAGAAAATGTGGTTGTGACACTATCTCACCAAGGTTACGTTAAATATCAGCCATTGACTGATTATGAAGCG
CAACGTCGTGGAGGAAAAGGTAAGTCAGCCGCAAGGATCAAAGAAGAAGACTTTATCGATCGCCTACTGGTGGCTAATAC
ACACGATACTATTTTGTGTTTCTCAAGTCGTGGTCGCCTGTACTGGATGAAAGTTTATCAGTTACCAGAAGCGAGCCGCG
GTGCTCGTGGTCGCCCAATTATCAATTTGTTACCTCTAGAACAAGATGAGCGGATCACCGCTATTCTTCCAGTAAGAGAG
TATGAAGAAGGTAAATTTGTCTTTATGGCAACGGCGAGCGGTACGGTTAAAAAGACACCATTACAAGACTTCAGTCGTCC
TCGTAGTGCCGGTATTATCGCGGTTAATTTAAATGATGGCGATGAGCTTATCGGTGTTGATTTAACCGACGGTAGTAATG
AAGCTATGCTGTTCTCAGCAGATGGTAAAGTGGTTCGTTTCGCAGAAGAGTGTGTTCGTCCAATGGGTCGTACTGCGACA
GGTGTTCGTGGTATGAAACTGGTTGATGATGATAAAGTGGTTTCACTGATCATTCCTCGTGGCGAAGGTGATATCTTAAC
AGTGACTGAAAACGGTTATGGTAAACGTACCGTTCAAAGTGAATACCCAACCAAAAACCGTGCAACACAAGGCGTTATCT
CGATTAAAGTGAGTGAGCGTAATGGTAAAGTGGTAGGCGCTATTCAAGTTGAAGAAACTGACCAGATTATGATGATCACC
AATGCCGGAACGTTAGTGCGTACCCGAGTATCAGAAGTCAGCATTGTGGGACGTAATACACAAGGTGTTACCTTGATCCG
TACTACAGAAGACGAGCTAGTCGTTGGCTTACAACGTGTTGAAGATGAAGATGATGCGTTAGATGATGATGAAGTTGATG
AAATGATCAGCGACAATATCTCTGATGTTCCAGAGTCTGAACCAACAGATGATGCGGATAGTGAAGAAGAATAA

>Flq|NC_006582.1.3204559|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAAGAAGATGTACCAAGACTAAGAGAAAGACAAATAGACGAGGAAATGAAAGAATCGTTCATCGATTACGCGAT
GAGCGTCATTGTCAGCCGGGCGCTGCCAGACGTAAGGGATGGCATGAAGCCCGTGCATCGCCGTATTCTGTATGCCATGT
TTGAGCTTGGGATGACGCCAGACAAACCATATAAAAAGTCGGCGCGGATCGTAGGCGAAGTGCTTGGAAAGTACCACCCA
CACGGCGATACTTCTGTATATGACGCAATGGTACGGATGGCACAAGATTTTAGTTATCGTTATATGCTCGTCAACGGGCA
TGGCAACTTCGGTTCCATTGATGGCGACTCTGCCGCGGCGATGCGTTATACGGAATCAAAAATGTCCAAGATTTCCATGG
AACTAGTCCGGGATTTAAACAAAGATACCGTTGATTTTATCGATAACTATGACGGCACTGAGCGAGAACCGAAAGTGATG
CCTTCCCGTTTTCCGAATTTACTCGTCAATGGCACGTCGGGGATTGCAGTAGGGATGGCAACCAATATCCCGCCCCATCA
ATTAGGTGAAGTGATTGACGGTGTACTTGCTTTAGCAAAAAATCCTGACATTAGTATTCCTGAGCTCATGGAATATATTC
CAGGCCCTGATTTTCCAACAGGCGGCGAGATCCTCGGCCGCTCTGGCATACGCAAAGCCTATTCAACAGGACGAGGCTCG
ATTACCGTACGGGCTAAAACCGAAATTGTCGAAAACAAAGGCAAACAGTCGATTATCGTCACGGAACTGCCATACCAAGT
CAATAAAGCGCGTCTGATTGAAAAAATCGCGGAACTAGTGCGTGACAAGAAAATTGATGGCATTACCGAACTGCGTGATT
CCTCGGACCGCAATGGCATGAACATTGTCATCGATGTGCGTAGAGACGCAAATCCAAACGTCATTTTAAACAATTTGTTT
AAACAGACAGCTTTGCAAACAAGTTTTGGCATTAATATGCTTGCTCTTGTGAATGGCCGGCCTGAAGTCTTAAACTTAAA
ACAGACGCTGGAACAATATTTGGCTCACCAAGTAGAAGTGATCCGCAGGCGCACTCAGTTTGACCTAAACAAAGCGGAAG
CCCGCGCCCACATTTTGGAAGGCTTGCGCATTGCCCTTGACCATATTGATGAAATCATTGCCTTAATCCGTGGTTCGGAT
ACAGCAGAAATCGCTCGAAACGGCTTAATTGAGCGATTTGAACTCAGCTATGACCAAGCACAAGCGATTCTCGATATGCG
CTTGCAACGGTTAACTGGTTTGGAACGGGATAAGCTTGAACAAGAATACAAAGACGTGTTGGCGCGAATTGCTGAACTCC
GTGCAATTTTGGCTAGTGACGAGAAAGTCATTGACGTCATCCAAGAAGAAATCCTTGCCATTAAAGAGAAATTTAATGAC
GAACGGCGGACGGTCATTTCGGCGAGCGAAGAACATTTGGAAGATGAGGATTTAATCCCACGGCAAAATATTGTTATTAC
TATTACCCATAACGGCTACATTAAACGCTTGCCTATTTCTACGTACCGTGCTCAAAAACGGGGCGGAAAAGGCGTACAAG
GCATGGGTACGAATGATGACGACTTTGTCCAGCACTTGTTTACGACCAACACGCACCATACCGTGTTAGTCTTCACAAAC
AAAGGGAAAGCCTACCGCCTAAAAGGGTATGAAATCCCTGAACTAGGTCGAACAGCAAAAGGCATTCCGGCGATTAATCT
GTTGCCGTTTGATCCAGGCGAAACGATCAGTACAGTCATCCCAATTGAATGCTTTGATGACGATTCGTATTTGTTTTTCG
TAACAGAGCACGGCATTGCCAAACGAACAAAGTTGTCTGCATTTGCGAATATCCGTAAAGGTGGTTTGTTCGCGATCAAT
TTAAGAGAAGGCGATTCACTCCACGGCGTGCGTTTAACCGATGGCAACCGTGAAGTGATGATCGGGACGAAACAAGGAAT
GGCGATCCGTTTTCCAGAAACAGATGTCCGCCTAATGGGACGTACTGCAGGCGGCGTCAAAGGCATTACCCTATCTGAGA
ATGACGGTGTTGTCGGCATGGAAGTAGTGGATGAAAACCAAAGCGTGCTCGTCGTTACCGAGAAAGGCTACGGCAAACGG
ACGCCACTTGATGAATACCGGGTCCAAAGCCGCGGAGGAAAAGGGATTAAAACATGTAACATTACTGATAAAAACGGTCC
TCTTGTCTCTTTGAAAATGGTGGCCGACGAAGACGACATTATGATTGTTACCGCCAATGGGATTATTATTCGCACCAACG
TAGACGGCATTTCAACGACTGGCCGAAATACTCAAGGCGTGACGTTGATTCGTGTCAACGAAGGAGAAGAAGTAGCGACA
GTCGCCCGTGTGAACATTAACGACGACGAAGTCGATGACTTAGAAGACGATGATGAGCAAGAGCAACCGACATCAGAGGA
AAACGCAGAATAA

>Flq|NC_003098.1.933198|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAGGATAAAAATTTAGTGAATGTCAATCTGACAAAGGAGATGAAGGCAAGTTTTATCGACTACGCCATGAGTGTTAT
CGTAGCGCGAGCTCTTCCTGATGTTCGAGATGGCTTAAAACCTGTTCACCGTCGCATTCTCTACGGAATGAATGAATTGG
GTGTGACCCCAGACAAACCCCATAAAAAATCTGCTCGTATTACAGGGGATGTCATGGGTAAATACCACCCACACGGGGAT
TCCTCTATTTATGAAGCCATGGTCCGTATGGCTCAATGGTGGAGCTACCGTTACATGCTTGTAGATGGTCATGGGAATTT
TGGTTCCATGGATGGAGATAGTGCTGCCGCTCAACGTTATACCGAGGCACGTATGAGCAAGATTGCTCTGGAAATGCTTC
GTGATATCAACAAAAATACAGTTGATTTCGTTGATAACTATGATGCCAATGAACGGGAACCCTTGGTCTTGCCAGCGCGT
TTTCCAAACCTTTTGGTTAATGGAGCAACTGGTATCGCGGTTGGGATGGCAACCAATATTCCACCTCATAATCTGGGTGA
AACCATTGATGCAGTGAAGTTGGTCATGGATAATCCTGAAGTGACTACCAAGGACTTGATGGAAGTCTTGCCTGGACCAG
ATTTTCCAACTGGTGCTCTTGTCATGGGGAAATCAGGTATCCATAAGGCTTATGAAACAGGTAAAGGTTCGATTGTCCTA
CGTTCTCGTACAGAGATTGAAACGACTAAGACTGGTCGTGAGCGTATCGTTGTAACAGAATTTCCTTACATGGTCAATAA
AACCAAGGTGCATGAGCATATTGTTCGCTTGGTTCAGGAAAAACGCATTGAGGGTATCACAGCAGTACGTGATGAGTCAA
ACCGTGAAGGTGTTCGATTTGTTATTGAAGTCAAGCGCGACGCCTCAGCCAATGTTATTCTCAATAACCTCTTCAAAATG
ACCCAAATGCAAACCAATTTTGGTTTCAATATGCTCGCTATCCAAAATGGTATACCGAAAATTTTGTCTCTTCGTCAGAT
TTTGGATGCTTATATTGAGCACCAAAAAGAAGTGGTTGTTCGTCGTACACGTTTTGATAAGGAAAAAGCGGAAGCGCGCG
CTCATATCTTAGAAGGTCTCTTGATTGCGCTAGACCATATCGACGAAGTGATTCGTATCATCCGTGCTAGTGAAACGGAT
GCGGAAGCTCAAGCTGAGTTGATGAGCAAGTTTAAGCTTTCTGAACGTCAAAGTCAAGCTATCCTTGATATGCGTCTTCG
TCGTTTGACAGGTTTGGAACGCGATAAGATTCAATCTGAGTATGATGACCTCTTGGCTCTGATTGCGGATTTAGCAGATA
TTCTTGCTAAGCCTGAACGTGTTTCTCAAATTATCAAAGACGAATTGGATGAAGTTAAACGTAAATTTTCTGATAAACGC
CGTACAGAGTTGATGGTTGGACAGGTCTTGAGTCTCGAGGATGAGGACTTGATTGAAGAATCGGATGTCTTGATTACCCT
TTCTAACAGAGGCTACATTAAGCGTTTGGATCAGGACGAGTTCACTGCTCAAAAACGTGGGGGTCGTGGTGTCCAAGGAA
CGGGAGTGAAAGATGATGACTTTGTTCGTGAGTTAGTGTCAACTAGTACCCATGATCATCTGCTCTTCTTCACAAACAAG
GGACGTGTCTATCGTCTTAAAGGTTATGAAATTCCTGAGTATGGTCGGACTGCCAAAGGGCTACCAGTAGTCAATCTCTT
GAAATTGGATGAAGACGAAAGTATTCAGACGGTTATCAATGTTGAGTCTGATCGCAGTGATGATGCTTATCTCTTCTTTA
CAACCCGTCACGGTATTGTGAAGAGAACCAGTGTTAAGGAGTTTGCCAATATTCGTCAAAATGGTCTCAAAGCGCTGAAT
TTAAAGGATGAAGATGAGTTAATCAATGTCTTGTTGGCAGAAGGAGATATGGATATTATCATTGGTACCAAGTTTGGTTA
TGCAGTTCGCTTTAATCAATCAGCCGTTCGTGGTATGAGCCGTATCGCCACTGGTGTGAAAGGTGTTAACCTTCGTGAAG
GAGACACAGTTGTTGGTGCCAGCTTGATTACTGATCAAGATGAGGTTCTTATTATCACAGAAAAAGGATATGGTAAGCGT
ACAGTCGCTACTGAATACCCAACAAAAGGTCGTGGTGGTAAGGGAATGCAGACAGCTAAAATTACCGAAAAAAATGGCTT
GCTGGCCGGTCTTATGACTGTTCAAGGGGATGAGGATTTGATGATTATCACTGATACAGGTGTCATGATTCGAACCAATC
TTGCCAATATTTCACAAACAGGACGTGCAACTATGGGAGTTAAAGTAATGCGCCTGGATCAAGATGCTCAGATAGTGACT
TTCACAACGGTTGCGGTGGCAGAAAAAGAAGAAGTTGGGACAGAAAACGAAACAGAAGGTGAAGCATAA

>Flq|CP002695.1|gene952|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGATTCCTTCGCCAAGGAGACGCTTCCGGTATCGCTGGAAGAAGAGATGCGCCGTAGCTATCTTGATTACGCGATGAG
CGTGATCGTGGGGCGCGCGCTGCCAGACGTGCGTGACGGTCTCAAGCCTGTGCATCGCCGCGTGCTGTACGCGATGCACG
AACTGAACAACGATTGGAACCGTGCCTATAAGAAGTCCGCGCGTATCGTCGGGGACGTCATCGGTAAGTACCACCCGCAC
GGCGACCAGTCGGTATACGACACCATCGTCCGCATGGCGCAGGACTTCTCCATGCGCTACATGCTGGTCGACGGCCAGGG
CAACTTCGGCTCCATCGACGGCGACAACGCCGCGGCGATGCGCTACACCGAAATCCGCCTGGCCAAGATCGCGCACGAGT
TGCTGGCCGATATCGACCAGGAAACGGTCGACTTCGGGCCCAACTACGACGGCAGCGAACAGGAGCCCCTGCTGCTGCCT
TCGCGCCTGCCCAACCTGCTGGTCAACGGCAGCTCGGGTATCGCCGTGGGCATGGCCACCAACATTCCCCCGCACAACCT
GCAGGAAGTGGTCGACGGCTGCCTGTATTGCCTGCGCAATCCGGAATGCTCGATCGACGAGCTGATCGAACTGATCCCGG
CGCCGGACTTTCCCACGGGCGGGGTGATCTACGGCATCACGGGCGTTCGCGAGGGGTACCGCACCGGGCGCGGCCGCGTC
ATCATGCGCGCCAAGACCCACTTCGAGGACATGGAGAAGGGCAACCGCCAGGCCATCGTGGTCGACGCGATTCCCTACCA
GGTCAACAAGAAGACCCTGCAGGAGCGCATCGCCGAGCTGGTCAACGACAAGAAGATCGAGGGCATTTCGGACATCCGCG
ACGAGTCGGACAAGGACGGCATGCGCCTGGTCATCGAGCTCAAGCGCGGCGAAGTGCCCGAGGTGGTGCTGAACAACCTG
TACAAGAATACGCAGCTGCAGGACACCTTCGGCATGAACCTGGTGGCGCTGGTCGACGGCCAGCCGCGCCTGCTGAACCT
CAAGCAGCTGATCGAGTACTTCCTGCAGCATCGCCGCGAAGTGGTGACGCGCCGCACCGTGTTCCAGCTGCGCAAGGCGC
GCGAACGCGGCCACGTGCTGGAAGGCCTGGCGGTGGCGCTGGCCAACATCGACGACTTCATCGCCATCATCAAGGCGGCG
CCCACCCCGCCGGTGGCGCGCCAGGAATTGATGGCGCGTTCCTGGGATTCGTCGCTGGTGCGTGAAATGCTGGCCCGCGT
CGACGGCGACGCCGCCGGCGGCGTCGCGGCGTTCCGCCCCGACGACCTGGCGCCCGAGTACGGCCTGCAGGGCGATGGCA
ACTACCGGCTGAGCGAGACCCAGGCGCAGGAAATCCTCAACATGCGCCTGCAACGCCTGACCGGCCTGGAGCAGGACAAG
ATCATCGGCGAGTACAAGGACGTGATGGCCACCATCGCCGACCTGCTCGACATCCTGGCCCGTCCGGATCGCATCACCAC
GATCATCAGCGAAGAGCTGCAGGCCATCAAGGCCGAGTTCTCGACCTCGGCCAAGGATACGCGCCGCGCCGAAATCGAAG
TCAACGCCACCGAGCTGGATACCGAAGACCTGATCACGCCGATGGACATGGTGGTCACCCTGTCGCATGGCGGATACATC
AAGAGCCAGCCGCTGTCCGAGTACCGTTCGCAAAAGCGCGGCGGACGCGGCAAGCAGGCTACCGCCATGAAGGAGAACGA
CTGGGTCGACCAGCTGTTCATCGCCAATACGCACGACTACCTGCTGTGCTTCTCCAACCGGGGCCGGGTGTACTGGCTGA
AGGTGTGGGAGGTGCCGCAGGGCACGCGCAACTCGCGCGGCAAGCCCATCGTCAACATGTTCCCGCTGGCCGACGGCGAG
AAGGTGACCGTGGTGCTGCCGGTCAAGGAATTCAGCGAAGACCACTACGTCTTCATGGCGACGTCGCGCGGCACGGTCAA
GAAGACCCCGCTGTCCGACTTCTCGAACCCGCGCAAGGCCGGCATCATCGCCGTCGACCTGGATGACGGCGATTACCTGA
TCGGCGCAGACCTGACCGACGGCAAGCACGATGTGATGTTGTTCTCCGACGCCGGCAAGGCGGTGCGCTTCGACGAGAAC
GACGTGCGTCCGATGGGCCGCAATGCGCGCGGCGTGCGCGGCATGATGCTCGAAGAGGGCCAGACCGTCATCGCGCTGCT
GGTGGCCGGCGACGAGACCCAGAGCGTGCTGACCGCCACCGAGAACGGCTACGGCAAGCGCACCCCGATCACCGAGTACA
CCCGCCATGGCCGCGGCACCAAGGGCATGATCGCCATCCAGACCAGCTCGCGCAACGGCCGCGTGGTCGGCGCCGTGCTG
GTGATGCCGTCCGACGAGATCATGCTGATCACCACCGGCGGCGTGCTGGTGCGCACCCGCGTGGCCGAGATCCGCGAGAT
GGGTCGCGCCACGCAGGGCGTCACGCTGATCAGCGTCGATGACGGCAGCAGCCTGTCCGGCGTGCGGCGCGTGGTCGAAA
GCGATGCCGACGCCGATGACGAGGATGGCGGCGAAGAGGGCGGCGAAGAGGGCGGCGACCAAGGCGGCGACGATACCGGC
GCCCAGGGCAAGGATTCTGAACCGACTGAACCTACGGAGTAA

>Flq|AP010904.1|gene4|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGAGCGATCTGATCCAAATCGAGGAAGAGCTCAAGAAGTCCTATCTGGAATATTCCTTGAGCGTCATCATAGGCCGCGC
CATCCCCGATGTGCGCGACGGCCTCAAACCCGTGCACCGGCGCATTCTCTACGCCATGCACGATCTGTCCAACACCTACA
ACCGGCCCTACAAGAAATCCGCCCGCGTCGTCGGTGACGTCATCGGTAAATACCATCCCCACGGCGACCAATCCGTGTAC
GACGCCCTGGTCCGCATGGCCCAGGACTTCTCCATGCGCGACGCCATCGTGGATGGCCAGGGCAACTTCGGCTCCATCGA
CGGCGACGCCGCGGCGGCCATGCGATACACCGAAGTCCGCATGTCCCGCCTGGCCGGCGAGTTCTTGGCCGACATCGAAA
AGGAAACCGTCGATTTTCGGCCCAACTACGACAACAGCCTGGAAGAGCCGGCCGTCCTGCCCACCAAGGTGCCCAATCTG
CTTTTAAACGGCTCCTCGGGCATCGCCGTCGGCATGGCCACCAACATCCCGCCCCACAACCTGGGCGAGCTGTGCGACGG
CCTGCTGCACCTGCTCGACACGCCCTCCTGCCCGGTCACCGACATCATCGGCCTGGTCAAGGGGCCGGACTTCCCCACCG
GCGCGGCCATCTACGGCGGCAAGGGACTCACCGAAGCCTACACCACCGGACGCGGCACCATCAAAATCCGGGGCCGGGCC
GAGGTCGAGGAACGCAAGAAAGATTATGTTTCCGTGGTCATCCGGGAAATCCCGTATGCGCTCAACAAGTCTTCCCTGGT
GGAAAAGATCGCGGCGCTCATTAACGACGGCCGCATCGAGGGCGTGTCCGACCTGCGCGACGAGTCCGACCGCAAGGGCA
TCCGCATTGTCCTGGATCTCAAAAAGGGCGTCATCCCCGACATCGTCATCAACGCCCTGTACAAGTACACGCCGCTGGAA
ACCTCGTTCGGCATCAACATGCTTGTGGTTGCCGACAACCGGCCGGCGCTTTTAAACATCAAGCAGGTCCTGGAGCACTT
CCTCACCCACCGCCGCGACGTCATCCTGCGCCGCACCCGGTTCGATCTGCGAAAGAGCGAGGAGCGCGCCCACATCCTCG
AAGGCCTGCGCATCGCCCTGGACAACATCGACGAAGTGGTCTCCATCATCCGGGCCTCCAAAAACGCCGTCGAAGCCCGG
GAACGGTTGATGGAGCGCTTCGGCCTGTCCGAGCGCCAGGCCCAGGCCATCCTGGACATGCGCCTTCAACGCCTGACCAA
CCTGGAGCGCCAAAAGCTCATCGACGAGTACAACGAGCTCATCAAGCTCATTGAATACCTGCGCTCGATCCTGGAAAACG
ACGAGGTGCTGCGCGGCGTCATCCGCGACGAAATCAAGGAAATCCAGGACCGTTACGCCACCCCGCGCAAGACTGAGATT
CTGGAGGACCTTGAAGGCATCAACATCCTCGATCTCATCCCCGACGAGGACGTGGTCATCACCCTGTCGCGCCGGGGCTA
CATCAAGCGCACCAAAATCGATAATTACCAGCAACAAAAGCGCGGCGGCAAAGGCATCGCCGGGGTGGCCACGGCCGGCG
ACGACTTTGTCCAGTCGTTTTGCGCCACCACCAACCACCAGCAGTTGTTGCTTTTTACCAACCTCGGCCGCATGTTCATG
CTGCCCGTGCACCAGATTCCCGAAGGCCAGCGCACGGCCAAGGGCGCGCACATCGCCAACCTGCTGCCCATGGACAAGGA
AGAGTTCGTGGCCACGGCCCTGTCCATCCGCGAGTTCTCCGAGGAGCGCTATTTCCTGTTCGTGACCCGCAAGGGCATGG
TCAAGCGCACCTGCACCGACCTCTACAAGAACTGCCGTTCCACGGGCATCATCGCCGTGGGGCTTAAGGAAAACGACGAA
CTCCTGACCGTCAAGGAGATCGACGACGAGACCGAAGTCTTGCTGGCCACCCAGCAGGGCCTGTCCAACCGCTTCCACAT
CAGCGGCGTGCGCCCCACCGGCCGGGGCGCGGCCGGCGTCAAGGGCATTGCCCTTAAGGGCAACGACCGTGTGGCCGCCG
GCGTGGTCATCACCAGCGTCAGCCGCTCCGAGGTGCTCACTGTCTCAGCCAACGGCTACGGCAAGCGCACCTCCATCGAA
CACTACCCTATCCGCAACCGGGGCGGCTCCGGCGTCATCAACATGCGCGTGACGCCCAAGACCGGTCAGGTCATCGGCGC
GGTCATGGTCGGCGACGACGACGAACTGCTGCTGTTAACCTCCGCCAACAAGATCATCCGCCTGTCCGTCTCCGGCATCT
CGTCCGTGGGCCGGGCCACCCAGGGCGTCATGCTGGTGCGCATGGACGAAAACGATACCGTCATGGGCTTTGACCTGGTC
GATCCGAGCGACCTCGACCGGTGCGCGCCCTCCGGCGAATAG

>Flq|NC_011035.1.6447337|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACCGACGCAACCATCCGCCACGACCACAAATTCGCCCTCGAAACCCTGCCCGTCAGCCTTGAAGACGAAATGCGCAA
AAGCTATCTCGACTACGCCATGAGCGTCATTGTCGGGCGCGCGCTGCCGGACGTTCGCGACGGCCTAAAGCCGGTGCACC
GGCGCGTACTGTACGCGATGCACGAGCTGAAAAATAACTGGAATGCCGCCTACAAAAAATCGGCGCGCATCGTCGGCGAC
GTCATCGGTAAATACCACCCCCACGGCGATTTCGCAGTTTACGGCACCATCGTCCGTATGGCGCAAAATTTCGCTATGCG
TTATGTGCTGATAGACGGACAGGGCAACTTCGGATCGGTGGACGGGCTTGCCGCCGCAGCCATGCGCTATACCGAAATCC
GCATGGCGAAAATCTCACATGAAATGCTGGCAGACATTGAGGAAGAAACCGTTAATTTCGGCCCGAACTACGACGGTAGC
GAACACGAGCCGCTTGTACTGCCGACCCGTTTCCCCACACTGCTCGTCAACGGCTCGTCCGGTATCGCCGTCGGTATGGC
GACCAACATCCCGCCGCACAACCTCACCGACACCATCAACGCCTGTCTGCGTCTTTTGGACGAACCCAAAACCGAAATCG
ACGAACTGATCGACATTATCCAAGCCCCCGACTTCCCGACCGGGGCAACCATCTACGGCTTGGGCGGCGTGCGCGAAGGC
TATAAAACAGGCCGCGGCCGCGTCGTTATGCGCGGTAAGACCCATATCGAACCCATAGGCAAAAACGGCGAACGCGAAGC
CATCGTTATCGACGAAATCCCCTATCAGGTCAACAAAGCCAAGTTGGTCGAGAAAATCGGCGATTTGGTTCGGGAAAAAA
CGCTGGAAGGCATTTCCGAGCTCCGCGACGAATCCGACAAATCCGGGATGCGCGTCGTTATCGAGCTGAAACGCAACGAA
AATGCCGAAGTCGTCTTAAACCAACTCTACAAACTGACTCCGCTGCAAGACAGTTTCGGCATCAATATGGTTGTTTTGGT
CGACGGACAACCGCGCCTGTTAAACCTGAAACAGATTCTCTCCGAATTCCTGCGCCACCGCCGCGAAGTCGTTACCCGAC
GTACGCTTTTCCGGCTGAAGAAGGCACGCCATGAAGGGCATATCGCCGAAGGCAAAGCCGTCGCACTGTCCAATATCGAT
GAAATCATCAAGCTCATCAAAGAATCGCCCAACGCGGCCGAGGCCAAAGAAAAACTGCTTGCGCGCCCTTGGCGCAGCAG
CCTCGTTGAAGAAATGCTGACGCGTTCCGGTCTGGATTTGGAAATGATGCGTCCGGAAGGATTGGCTGCAAACATTGGTC
TGAAAAAACAAGGTTATTACCTGAGCGAGATTCAGGCAGATGCTATTTTACGCATGAGCCTGCGAAACCTGACCGGCCTC
GATCAGAAAGAAATTATCGAAAGCTACAAAAACCTGATGGGTAAAATCATCGACTTTGTGGATATCCTCTCCAAACCCGA
ACGCATTACCCAAATCATCCGTGACGAACTGGAAGAAATCAAAACCAACTATGGCGACGAACGCCGCAGCGAAATCAACC
CGTTCGGCGGCGACATTGCCGATGAAGACCTGATTCCGCAACGCGAAATGGTCGTGACCCTGACCCACGGCGGCTATATA
AAAACCCAGCCGACCACCGACTATCAGGCTCAGCGTCGCGGCGGGCGCGGCAAACAGGCGGCTGCCACCAAAGACGAAGA
CTTTATCGAAACCCTGTTTGTTGCCAACACGCATGACTATTTGATGTGTTTTACCAACCTCGGCAAGTGCCACTGGATTA
AGGTTTACAAACTGCCCGAAGGCGGACGCAACAGCCGCGGCCGTCCGATTAACAACGTCATCCAGCTGGAAGAAGGCGAA
AAAGTCAGCGCGATTCTGGCAGTACGCGAGTTTCCCGAAGACCAATACGTCTTCTTCGCCACCGCGCAGGGAATGGTGAA
AAAAGTCCAACTTTCCGCCTTTAAAAACGTCCGCGCCCAAGGCATTAAAGCCATCGCACTCAAAGAAGGCGACTACCTCG
TCGGCGCTGCGCAAACAGGCGGTGCGGACGACATTATGTTGTTCTCCAACTTGGGCAAAGCCATCCGCTTCAACGAATAC
TGGGAAAAATCCGGCAACGACGAAGCGGAAGATGCCGACATCGAAACCGAGATTTCAGACGACCTCGAAGACGAAACCGC
CGACAACGAAAACACCCTGCCAAGCGGCAAAAACGGCGTGCGTCCGTCCGGTCGCGGCAGCGGCGGTTTGCGCGGTATGC
GCCTGCCTGCCGACGGCAAAATCGTCAGCCTGATTACCTTCGCCCCTGAAACCGAAGAAAGCGGTTTGCAAGTTTTAACC
GCCACCGCCAACGGATACGGAAAACGCACCCCGATTGCCGATTACAGCCGCAAAAACAAAGGCGGGCAAGGCAGTATTGC
CATTAACACCGGCGAGCGCAACGGCGATTTGGTCGCCGCAACCTTGGTCGGCGAAACCGACGATTTGATGCTGATTACCA
GCGGCGGCGTGCTTATCCGTACCAAAGTCGAACAAATCCGCGAAACCGGCCGCGCCGCAGCAGGCGTGAAACTGATTAAC
TTGGACGAAGGCGAAACCTTGGTATCGCTGGAACGTGTTGCCGAAGACGAATCCGAACTCTCCGGCGCTTCTGTAATTTC
CAATGTAACCGAACCGGAAGCCGAGAACTGA

>Flq|CP000034.1|gene2423|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCGGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGTGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTA
TATATCCGCGCCCGTGCTGAAATGGAAGTTGACGCCAAAACCGGACGTGAAACCATTATCGTCCACGAAATTCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCAAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTTGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCGATGCTCGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGTTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGTGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAATATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGTGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACGCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTACCAGTTGCCGGAGGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTACTGCCGCTGGAGCAGGACGAACGTATCACCGCGATCCTGCCGGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACTGTGAAGAAAACCGTCCTCACCGAATTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGAAGGCGATGAGTTGATCGGCGTTGACCTGACCAGTGGCGAAGATGAAG
TAATGCTGTTCTCCGCCGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAATACCACTGGT
GTGCGCGGTATTCGCTTAGGCGAAGGCGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAAAACGGTTATGGTAAGCGTACCGCAGTGGCGGAATACCCAACCAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCAGAAATCAGCATCGTGGGCCGTAACACCCAAGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAACGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>CARD|pvgb|NC_002516.2|3556426-3559198|ARO:3003684|Pseudomonas|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
TTACTCTTCGTTGCCTTCCGCTTCCGCCGCGGGCTCGGACTCGGACTCGGCCGACTCGCCCAGAGATTCGGCAGCTTCCT
CGCCCTCGGGCAGGTCCTCGTCATCTCCGCCCGACGGCTCCTGGACACGCTCCAGACCGACCAGTACCTCGTCGCTGGCG
AGCTTGATCAGGGTTACGCCCTGGGTATTGCGGCCGGACAGGGAGACTTCGTCGACACGCGTCCGCACCAGGGTGCCCTG
GTCGGAAATCAGCATGATCTCCTCGCCTTCCTGGACCTGTACCGCGGCGATCAGCGCGCCGTTGCGCTCGTTGGTGACCA
TGGCGATCACCCCCTGGCCGCCGCGGCCGCGACGCGGGAACTTGCTCAGCGGGGTACGCTTGCCGAAGCCGCGCTCGGAG
GCGGTGAGGATCTGCGCCCCGGACTCCGGAATCAGCATGGAGATCAGCTGCTGCCCCTTGCCCAGGCGCATGCCACGTAC
GCCGCGGGCGTTGCGGCCCATGATGCGCACCACGCTCTCGGCGAAGCGGATCACCTTGCCGGCGCTGGAGAACAGCATGA
CTTCCTTGGCGCCATCGGTGATCGCGGCGGCGATCAGGGTGTCGCCCTCTTCCAGCTTGAGCGCGATCAGGCCGCTGCTG
CGCGGACGGCTGAACTGCACCAGCGGGGTCTTCTTCACGGTACCGAAGGCGGTGGCCATGAAGATGTAGGCGCCGGTCGG
CTCGGCCACCAGCTCGGCGGTCTCGCCCTCGACTTCCTCGACCTCGGCGGCCTCGACCACCTCGCCCTCGAGCACCGCGC
CTTCGGCTTCGTCGAGGTCGTCATCGGCGCCACCGTTCTGCTGCAGCGCCTCCAGGTCGATCTGCAACATCGCGGTGATC
CGCTCGCCCTCATCCAGCGGCAGCAGGTTCACCAGCGGCCGGCCACGCGCGGTACGCGAGGCTTCCGGAATCTCGAAGGT
ACGCAGCCAGTAGACCTTGCCCTTGCTGGAGAACAGCAGGAGGGTCGCATGGCTGTTGGCCACCAGCAGGTGTTCGATGT
AGTCCTCGTCCTTCATCCCGGTGGCGGACTTGCCTTTGCCGCCGCGACGCTGCGCCTGGTAGGCGGCCAGCGGCTGGGAC
TTGGCGTAGCCGCCGTGCGAGATGGTCACCACGCGGTCTTCCTCGGTGATCAGGTCGGCGATGGTCAGGTCGACCTGGGA
AGCCACGATCTCGGTGCGGCGAGCATCGCCGAATTCGGCCTTGACCGCTTCCAGTTCCTCACGGATCACCTCCATCAGGC
GCGCCGGGTTGGTCAGGATGCGGATCAGCTCGCCGATCAGGTTGAGGATTTCCTGGTATTCGGAGAGCAGCTTCTCGTGC
TCCAGGCCGGTCAGGCGATGCAGGCGCAGCTCGAGGATCGCCTGGGCCTGCTCCGGCGACAGGTAGTACTTGCCGTCGCG
CAGGCCGTACTGCGGATCCAGGTCTTCCGGACGACAGGCGTCGGCGCCGGCACGCTCGACCATCGCTTCCACCGCGCTGG
ACTCCCAGGCAGTGGCGATCAGGCGTTCCTTGGCCTCGGCCGGGGTCGGCGAACTCTTGATCAGCTCGATCACCGGGTCG
ATGTTCGACAGGGCGACCGCCTGGCCTTCCAGGATGTGCCCGCGCTCGCGGGCCTTGCGCAGCTCGTAGACGGTACGCCG
GGTCACCACTTCGCGGCGGTGGCGGACGAACACCTCGAGCATGTCCTTCAGGTTCAGCGTGCGCGGCTGGCCGTCGACCA
GGGCCACCACGTTGATGCCGAACACGCTCTGCAGCTGGGTCTGGGCATAGAGGTTGTTGAGGACCACCTCGCCCACCTCG
CCGCGACGCAGCTCGATGACCACGCGCATGCCGTCCTTGTCAGACTCGTCGCGCAGCTCGGAAATACCCTCGATCTTCTT
CTCTTTCACCAGCTCGGCGATCTTCTCGATCAACCGCGCCTTGTTCAACTGGTACGGCAGCTCGGTGATGATAATCTGCT
CGCGACCGCCGCCCTTCTCCATCTCCTCGACGACGGCGCGGGCACGGATGTAGATGCGCCCGCGACCGGTGCGGTAGGCC
TCGATGATCCCGGCGCGGCCGTTGATGATGCCGGCGGTGGGGAAGTCCGGACCGGGGATGTACTGCATCAGCTCATCGAC
GGTCAGGTCGGGGTTGTCCATCAGCGCCAGGCAGCCGTCGATCACTTCGCCGAGGTTGTGCGGCGGGATGTTGGTCGCCA
TGCCCACGGCGATACCGCTGGAACCGTTGACCAGCAGGTTGGGAATCTTGGTCGGCATGACCGCCGGGATCTGCTCGGTG
CCATCGTAGTTGGGCACCCAGTCGACGGTTTCCTTTTCCAGGTCCGCCAGCAGTTCGTGGGCCAGCTTGGCCATGCGCAC
TTCGGTGTATCGCATGGCTGCGGCGTTGTCGCCGTCCACCGAACCGAAGTTGCCCTGGCCGTCTACCAGCATGTAGCGCA
GCGAGAACGGCTGCGCCATGCGCACGATGGTGTCGTAGACCGCGGTGTCGCCGTGCGGGTGGTACTTACCGATCACGTCG
CCGACCACACGGGCGGATTTCTTGTAGGGCTTGTTCCAGTCGTTGCCCAGCTCGCTCATGGCATAAAGCACACGGCGGTG
CACCGGCTTCAGGCCGTCACGTGCATCCGGCAGGGCCCGCCCGACGATCACGCTCATCGCGTAGTCGAGATAGGACTGTT
TCAGCTCGTCTTCGATATTGACCGGGAGAATTTCTTTGGCCAGTTCGCCCAT

>Flq|AL009126.3|gene7|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGTGAACAAAACACACCACAAGTTCGTGAAATAAATATCAGTCAGGAAATGCGTACGTCCTTCTTGGATTATGCAAT
GAGCGTTATCGTGTCCCGTGCTCTTCCGGATGTTCGTGACGGTTTAAAACCGGTTCATAGACGGATTTTGTATGCAATGA
ATGATTTAGGCATGACAAGTGACAAGCCTTATAAAAAATCCGCGCGTATCGTTGGAGAAGTTATCGGGAAATACCACCCG
CACGGTGATTCAGCGGTATATGAATCCATGGTCAGAATGGCTCAGGATTTCAACTACCGTTATATGCTCGTTGACGGTCA
CGGAAACTTCGGTTCTGTTGACGGAGACTCAGCGGCGGCCATGCGTTATACAGAAGCACGAATGTCTAAAATCTCAATGG
AGATTCTTCGCGACATCACAAAAGACACAATCGATTACCAGGATAACTATGACGGGTCAGAAAGAGAACCTGTCGTTATG
CCTTCAAGGTTCCCGAATCTGCTCGTGAACGGTGCTGCCGGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCACCA
GCTGGGAGAAATCATTGACGGTGTACTTGCTGTTAGTGAGAATCCGGACATTACAATTCCAGAGCTTATGGAAGTCATTC
CAGGGCCTGATTTCCCGACCGCGGGTCAAATCTTGGGACGCAGCGGTATCCGGAAAGCATACGAATCAGGCCGAGGCTCT
ATCACGATCCGGGCAAAAGCTGAGATCGAACAAACATCTTCGGGTAAAGAAAGAATTATCGTTACAGAGTTACCTTACCA
AGTAAATAAGGCGAAATTAATTGAGAAAATTGCTGATCTCGTAAGGGACAAAAAGATAGAGGGTATCACAGATCTGCGTG
ATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGAAATCAGACGCGATGCCAATGCGAATGTTATCTTAAACAATCTG
TACAAACAAACTGCTCTACAAACATCTTTTGGCATCAACCTGCTTGCGCTTGTTGATGGCCAGCCGAAAGTTTTAACTCT
TAAGCAATGCCTGGAGCATTACCTTGACCATCAAAAAGTTGTCATTAGACGCCGTACTGCTTATGAATTGCGTAAAGCAG
AAGCGAGAGCTCATATCTTGGAAGGATTGAGAGTTGCACTGGATCATCTCGATGCAGTTATCTCCCTTATCCGTAATTCT
CAAACGGCTGAAATTGCGAGAACAGGTTTAATTGAACAATTCTCACTGACAGAGAAGCAAGCACAAGCGATCCTTGACAT
GAGGCTCCAGCGTTTAACGGGACTGGAACGTGAAAAGATCGAAGAAGAATACCAGTCTCTTGTTAAATTAATTGCAGAGC
TAAAAGACATCTTGGCAAATGAATATAAAGTGCTTGAGATCATTCGTGAAGAACTCACGGAAATCAAAGAGCGTTTTAAC
GATGAAAGACGTACTGAGATCGTCACTTCTGGACTGGAGACAATTGAAGATGAAGATCTCATCGAGAGAGAAAATATCGT
AGTTACTCTGACGCACAACGGATACGTCAAACGTCTTCCTGCATCAACTTACCGCAGTCAAAAACGGGGCGGAAAAGGTG
TACAAGGTATGGGAACAAACGAAGATGATTTCGTTGAACATTTGATCTCTACGTCAACTCATGACACGATTCTCTTCTTC
TCGAACAAGGGGAAAGTGTATCGTGCAAAAGGGTATGAAATCCCTGAATACGGCAGAACGGCAAAAGGAATCCCGATTAT
TAACCTGCTGGAGGTAGAAAAGGGTGAGTGGATCAACGCGATTATTCCAGTCACGGAATTCAATGCGGAGCTTTACCTCT
TCTTCACTACAAAGCATGGGGTTTCAAAACGAACATCGCTATCTCAATTCGCTAATATCCGCAACAATGGTCTAATTGCT
CTGAGTCTTCGTGAAGATGATGAACTGATGGGTGTACGTCTGACTGACGGCACAAAACAAATCATCATTGGAACGAAAAA
CGGTTTACTGATTCGTTTCCCTGAAACAGATGTCCGAGAGATGGGAAGAACTGCGGCGGGCGTAAAAGGCATCACCCTGA
CGGATGACGACGTTGTTGTCGGCATGGAGATTTTAGAGGAAGAATCACACGTCCTTATCGTAACTGAAAAAGGGTACGGA
AAACGAACTCCTGCTGAAGAGTACAGAACCCAAAGCCGGGGCGGAAAAGGACTCAAAACAGCGAAAATCACCGAGAACAA
CGGCCAACTAGTAGCAGTGAAAGCTACTAAAGGTGAAGAGGATCTAATGATTATTACAGCTAGCGGCGTACTCATCAGAA
TGGACATCAATGATATCTCCATCACCGGACGTGTCACTCAAGGTGTGCGTCTCATCAGAATGGCAGAAGAAGAGCATGTT
GCTACAGTAGCTTTAGTTGAGAAAAACGAAGAAGATGAGAATGAAGAAGAACAAGAAGAAGTGTGA

>CARD|pvgb|AL450380|7317-11067|ARO:3003298|Mycobaterium|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACTGATATCACGCTGCCACCAGGTGACGGTTCTATACAGCGGGTTGAGCCGGTCGACATTCAGCAGGAAATGCAGCG
CAGCTATATTGATTACGCGATGAGTGTGATTGTGGGCCGGGCGTTGCCTGAAGTCCGCGATGGTCTCAAACCGGTACATC
GTCGGGTCTTGTACGCGATGTTAGACTCCGGTTTCCGCCCGGACCGTAGCCACGCTAAGTCAGCACGGTCAGTCGCTGAG
ACGATGGGCAATTACCATCCGCACGGCGACGCATCGATTTATGACACGTTAGTGCGCATGGCGCAGCCGTGGTCGCTGCG
GTATCCCTTGGTTGATGGGCAAGGCAATTTCGGTTCGCCGGGTAATGACCCACCGGCAGCGATGCGTTATTGTGTGTCAG
GAAATTCCTTGGTGAGGTTGCTATTTGGGAAATCAATACGAATCGGTGATATCGTTACTGGAGCTCAGTTCAATTCGGAC
AATCCGATCGACTTGAAGGTTCTTGATCGGCATGGTAATCCGGTTGTAGCCGATTATTTATTCCATTCAGGAGAGCACCA
AACCTATACAGTGCGCACCACTGAAGGCTATGAGATCACCGGGACGTCGAACCATCCCTTGTTGTGTTTAGTGAATGTCG
GCGGTATACCCACCTTGTTGTGGAAGCTGATTGGAGAAATTCGATCAGGAGACTACGTTGTTTTACAGCGGATCCCACCA
GTGGAATTTGGTCCGGCGGACTGGTATTCTACGATGGAAGCATTGTTATTCGGAGCCTTTATTAGTGGGGGCTTCGTTTT
TCAGGACCATGCTGGATTTAACAGCCTTGACCGTGACTATTTCACCATGGTTGTTAATGCTTATGATACGGTTGTGGGTG
GCCTGCGTTGCATATCTTCTCGAATCACCGTATCGGGGTCGACGCTACTCGAACTTGATGTTTATAACCTCATCGAGTTT
AAGAAGACAAGACTTAGCGGTTTATGCGGGCAACGGTCTGCGGACAAGTTGGTACCTGACTGGTTGTGGCACTCACCTTC
CACCGTCAAACGAGCATTCCTTCAGGCATTGTTTGAAGGTGAAGGATTTTCTTCGATATTGTCGCGAAATATAATTGAGA
TTTCCTACTCGACACTTAGTGAGCGACTGGCCGCCGACGTCCAGCAGATGCTGCTTGAATTCGGAGTCGTGTCTGAGCGC
TATTGCCATACTGTCAATGAGTACAAGGTTGTCATAGCTAACCGCGCTCAAGTAGAAATGTTTTTCACCCAAGTCGGTTT
CGGTGTTACTAAACAAGCTAAGCTTATCCGGGACGTGGTATCTATGTCTCCATGCGTTGGCATGGATATCAACTGCGTAC
CAGGTTTGGCCACTTTCATTCGTAAGCATTGTGATAACCGCTGGGTCGAGGAAGACTCATTTAATCAGCATAATGTTGAT
TGCGTCCAACATTGGCACCATCATAGCGCGGAAATCGTCGGCCACATCGCCGATCCCGATATTCGTGCCATCGTGACTGA
CCTTACTGATGGCCGGTTCTACTACGCGCGCGTCGCGTCCGTGACTGATACCGGTATTCAACCTGTGTTCAGTCTACATG
TGGACACCGAGGATCATTCGTTTTTGACTAATGGATTCATCAGCCATAACACCGAGGCTCGGCTTACTCCATTGGCGATG
GAAATGTTGCGCGAGATCGACGAGGAGACAGTTGATTTCATATCTAACTACGATGGCCGGGTGCAGGAACCGATGGTGTT
GCCTAGCCGTTTTCCCAACCTGTTGGCTAATGGTTCTGGCGGTATCGCGGTCGGCATGGCTACCAATATCCCGCCGCACA
ACCTGTATGAGCTCGCCGACGCTGTGTTTTGGTGCCTAGAGAACCATGACGCTGACGAAGAGACGATGCTGGTCGCTGTT
ATGGAACGGGTCAAAGGTCCTGATTTCCCTACCGCCGGGTTGATTGTCGGTTCGCAAGGCATTGCCGATGCTTACAAGAC
TGGCCGTGGTTCCATTCGGATACGCGGAGTTGTTGAGGTTGAAGAAGATTCACGCGGAAGGACGTCATTGGTCATCACTG
AGCTACCGTATCAGGTCAACCACGACAACTTCATCACTTCTATCGCTGAGCAAGTCCGCACTGGCCGGCTAGCCGGCATC
TCCAATGTAGAAGACCAAGGCAGCGACCGGGTTGGTGTACGTATCGTCATCGAGATCAAGCGTGACGCGGTGGCCAAAGT
GGTGCTCAATAACCTGTACAAGCATACTCAGCTGCAAACTAGTTTCGGAGCCAACATGTTGTCAATCGTTGACGGCGTGC
CGCGCACTTTGCGGTTGGATCAGATGATTTGTTATTATGTCGAACATCAACTGGACGTCATTGTCCGGCGCACTACCTAC
CGATTGCGTAAAGCCAACGAGCGGGCTCATATTTTGCGTGGATTGGTCAAAGCGCTCGATGCGTTAGATGAGGTTATTAC
GTTGATTCGGGCATCGCAGACCGTGGATATTGCTCGTGTTGGGGTGGTCGAGTTACTCGATATCGACGACATTCAGGCTC
AAGCTATCCTGGACATGCAGCTGCGGCGTTTGGCGGCTTTGGAGCGTCAACGCATTATTGATGATCTCGCTAAGATTGAG
GTCGAGATCGCTGATCTGGGAGATATTCTGGCTAAGCCGGAGCGTCGGCGTGGTATCATTCGTAATGAACTGACTGAGAT
CGCAGAGAAGTACGGTGATGACCGTCGTACTCGGATAATAGCGGTTGATGGTGATGTCAACGACGAGGATTTGATTGCTC
GTGAAGAGGTCGTTGTCACGATAACTGAAACTGGATATGCTAAACGTACTAAAACTGACCTGTATCGCAGCCAGAAACGC
GGCGGGAAAGGTGTTCAAGGCGCCGGTTTGAAGCAGGACGACATCGTCCGGCATTTCTTCGTGTGTTCAACTCACGATTG
GATCCTGTTTTTCACCACCCAAGGCCGCGTATACCGGGCCAAGGCCTATGAATTGCCAGAGGCTTCTCGAACGGCACGCG
GGCAACACGTGGCCAATTTGCTTGCATTCCAGCCTGAAGAGCGCATCGCTCAGGTAATTCAGATCCGTAGCTATGAAGAC
GCTCCATACTTGGTCCTTGCCACGCGCGCCGGTCTGGTTAAGAAGTCAAAGTTGACCGATTTTGACTCTAATCGTTCGGG
TGGGATCGTGGCAATTAATTTACGTGACAACGATGAGTTGGTCGGTGCAGTGTTGTGCGCGGCCGACGGCGACTTGCTTC
TGGTATCGGCTAACGGCCAGTCTATCCGGTTCTCAGCGACTGACGAGGCCTTGCGTCCGATGGGGCGGGCTACCTCTGGT
GTGCAGGGCATGCGGTTTAACGCCGATGATCGACTGTTGTCGTTGAATGTGGTTCGCGAAGATACTTACCTGCTTGTCGC
AACGTCTGGGGGTTACGCTAAACGCACCTCGATTGAGGAGTACCCGATGCAGGGCCGTGGCGGAAAGGGTGTTCTAACGG
TCATGTACGATCGTCGGCGCGGTAGCTTGGTTGGGGCCATCGTGGTTGATGAAGACAGCGAGTTGTACGCGATCACCTCA
GGGGGTGGGGTAATTCGTACAACGGCACGCCAGGTTCGCCAGGCAGGACGCCAGACCAAGGGTGTTCGGTTGATGAACTT
AGGTGAGGGCGACACGCTGTTAGCCATCGCACGTAATGCCGAAGAAAGCGCCGACGGCGGTGTCGGTTAAA

>Flq|NC_012491.1.7717618|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCAGAAGAAACTGCTCGGTTTCCAAAAGTCGATATTAGCCACGAAATGAGAGAATCGTTCATTAGCTATGCGATGAG
CGTTATCGTCAGTCGGGCTTTGCCTGACGTTCGCGATGGTTTGAAGCCTGTACACAGGCGTATTTTGTATGCCATGCACG
ATATGGGCCTTACTCCTGACAAGCCGTTCCGTAAATCGGCAAACGTTGTCGGGGAAGTAATGGCGAACTACCATCCGCAT
GGTGACTCTTCCATCTATGAAGCGATGGTACGTATGGCCCAAGATTTTAACATGCGCTACATGCTGGTTGAAGGGCAAGG
GAACTTCGGTTCTGTAGACGGCGACCCGGCAGCGGCGATGCGTTATACGGAGTCGCGTTTTTCCAAGCTCGCGCTGGAGC
TTTTGCGCGATATTGATAAAGAAACGGTCGATTTCATTCCTAACTACGACGGACGCAAAGAAGAGCCGGTTGTATTGCCT
TCTCGTTTCCCGAACCTGCTTTTGAATGGTGCATCAGGGATTGCTGTAGGTATGGCTACCAATATTCCGCCACATAACTT
GACGGAAGTTGTTGATGGTGTCATTGCCATGATCGACAATCCTGATATTACGATTCAAGATTTGATGAAAATCATCAAGG
GACCTGACTTCCCTACAGCGGGGGAGATTCTCGGTTACAGTGGTATTCGCCGTGCCTATGAAACAGGCCGTGGTTCCATT
ATTATGCGCGCCAAAACCCAGATTGAAGAGGATGGGAAAGGCAAACCACGCATCATCGTAACAGAGATCCCTTATCAGGT
AAACAAGGCTAGACTCGTGGAAAAAATCGCGGAGCTAGTGCGCGAGAAAAAAATCGAAGGCATTACCGACCTTCGTGATG
AGTCTGACCGCAAAGGTATGCGTATTGTCATGGAATTGCGCCGTGACGTCATTCCAAAGGTTGTATTGAACAATCTATTT
AAGCATACCCAAATGCAGTCTACATTTGGTGTGAATATGCTGGCACTCGTTGATAGTCGTCCGCGTGTATTGAATCTGCG
TGACATGCTCTATTACTATTTGGAGCACCAACGTGTCATTATCCGCAGAAGGACCGAATACGATCTCAAGCAAGCAGAAG
CCCGTGCGCACATCTTGGAAGGCTTGCGTATTGCATTGGATCATATTGACGAGATTATCAGCTTGATTCGTTCTTCTCAA
ACCACGGAAGAAGCTCGCACAGGACTCATGGAGAATTACTCCTTGTCCTACGAGCAGGCACAGGCGATTCTCGATATGCG
TCTGCAACGCCTGACTGGTTTGGAACGAGAAAAAATCGAGAACGAATACCAGGAGCTCATGGTAAAAATCGCAGAACTGC
GTGCTATTCTTGCAGACGAAGCTAAAATCTACGCGATCATCCGCGATGAGCTGGGTGAGATCAAAGAGAAGTTTGGCGAT
GAAAGACGCACAGAAATTACTTTCGATGAGAATCATATCGAAGATGCTGATTTGATCCCAGAGGAAGATGTCGTAATCAC
CCTGACGCATGACGGTTATATCAAGCGTCTGCCTGTTTCGACCTACCGTTCGCAAAAACGTGGTGGACGTGGCGTGCAGG
GATTGGGAACCAAGGATGACGATTTTGTCGAGCATCTGTACATTACCAACTCGCATGATTACATCATGTTCTTTACGAGC
AAAGGGAAGGTGTATCGCCTAAAAGGATTTGAGATTCCTGACCTGAGCCGGACAGCAAAAGGTACCCCAATCATCAATCT
CATTCAGATTGAAAAAGGGGAGCGGGTTAGTGCGGTAATCCCTGTGAAAGAGTTTGATCAAGAACATTACCTGTTCTTTG
CGACCAAGAAGGGGATTATTAAGAAAACTACGCTGGAGTCCTATGAAAACATTCGCAAAGGCGGGCTAATTGCGGTTAAC
CTGCGCGAAGATGATGAGTTGATTGGTGTTCGTCTGACGGATGGCCAACAACAAATCATTATGGGTACTCATAAAGGTAT
GTCCGTCCGTTTCAATGAGGGAGACGTACGCACGATGGGACGTAACGCCACCGGTGTGAAGGGGATTACCCTTGACGACG
ATGATGATGTCATCGATATGGACGTTATCAAGCCAAATGCAGAAGTGCTCATTGTAACGGCGAATGGTTACGGAAAACGG
ACTCCTGTCGATGAATACCGCATTCAATCTCGTGGCGGTAAAGGAATTAAGACACACAATGTAACGGATCGTAGCGGTCC
GGTCGTCGGTCTGAAAGTCGTTGAGCCTGAAGAAGATCTGATGATTATTACCACTTCCGGTATCATCATTCGTACAGAAA
TGAAAGGTATTTCTGTGATGGGGCGCTACACGCAAGGTGTGAAACTGATCCGTTTGTCTGAAAATGAGCAAGTGGGATCA
GTCGCCAAATGTCCTCCGACTGAGGAAGAGGATATGACGGATGAAGATGCAGAAGAGGGAATCGAAGATCTGCAAGACGG
AGAGACTGTCGAAGCAACCGAGCCTATCGAACCTACCGAACCGACAGAGGAATAA

>CARD|pvgb|AF469609|566-3353|ARO:3003297|Bartonella|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGACCGATCTTACTCGACTACCAGAACATGATGTGTCGACCGGTATTGAACCAGTCAGTATCATTGAAGAAATGCAGTG
CTCTTATCTAGATTATGCGATGAGCGTAATTGTGTCGCGCGCACTGCCTGATGTCCGTGATGGGCTTAAGCCTGTCCATC
GGCGCATTCTTCATGCGATGAATGAAATGGGACTTTTGTTCAATAAGCCTTATCGTAAGTCAGCGGGTGTTGTTGGTGAA
GTGATGGGAAAGTTTCATCCTCATGGTGATGCTTCAATTTATGATGCCTTGGTGCGTATGGCACAGGATTTTTCTTTACG
AAATCCTCTGATTGATGGACAGGGAAATTTTGGCTCTGTTGACGGTGATCCACCCGCAGCGATGCGTTACACGGAATGTC
GTTTAGAAAAAGTTGCAGAAGAACTTTTAGCTGATATTGATAAAGATACTGTTGATTTTCAAGATAATTATGATGGGCGT
GAGCATGAACCTATAGTTTTGCCTGCACGTTTCCCTAACCTGTTAGTAAATGGATCGGGTGGTATTGCTGTAGGTATGGC
AACCAATATTCCTCCACATAATCTAGGTGAGGTTATTGATGGATGTGTTGCTTTGATCGATAATCCTAACATAACTATAG
ATGAGATGTTAGCAATTATTCCGGGGCCTGATTTTCCTACAGGTGGTATTATTCTTGGCCATTCTGGTGTCCGTTCTGCT
TATGAAACAGGGCGTGGTTCAATTATTATGCGTGCTAAGGTTGAGATCGAGGAAATTCGCAATCAGCGGCAGGCAATTAT
CGTAAGCGAAATACCTTATCAAGTTAATAAAGCAACAATGGTTGAGAAGATGGCCGAATTGGTGCGTGATAAACGTATCG
AAGGAATCTCCGATTTGCGTGATGAATCTGATCGTGATGGGTATCGAGTTGTCATTGAGCTAAAAAGAGAAGCTGTTGCA
GACGTTGTTTTGAATCAGCTTTATCGTTATACACCGTTGCAAGCCTCATTTGGTTGCAATATGGTTGCGTTGAATGGAGG
AAAGCCTGAACAAATGACGTTGCTTGACATGCTTCGTGCATTTGTTTCCTTCCGCGAAGAAGTGGTAAGCCGGCGCACAA
AATATCTTTTGCGTAAAGCACGTGAGCGTGCGCATGTTTTAGTTGGTCTTGCTATCGCTGTTGCTAATATTGATGAGATT
ATAGAATTAATTCGCAAAGCTCATGATCCACAGACAGCGCGTACACAGTTAATGGAACGGCGTTGGCCGGCTTCTGAGGT
AGCAGCTTTGATTAAGCTTATAGATGATCCTCGTCATATTATTCATGAGGATAATACGTACAATTTGTCTGAAGAACAAG
CGCGTGCTATTTTAGAATTGCGTTTGCAAAGATTAACAGCGCTTGGTCGTAATGAAATTGCTGATGAACTCAATGCAATT
GGAGAAGATATTGCTGACTATCTTGGTATTTTAGCATCACGCTCACGGATCATGGACATTGTTAAAAGTGAGCTCAGCGC
TTTGCGTGAAACATTTGCAACACCACGGCGTACTGTATTTGGTTTTGGTAGTGCCGAGATGGACTGCGAAGATCTGATTG
TTCCAGAAGATATGGTGGTGACAGTGAGCCATAGTGGCTATATTAAGCGTGTGCCTCTAAATACATACCGTGCGCAGCGT
CGTGGTGGTAAGGGACGTTCTGGTATGGCAACAAAGGATCAGGATTTTGTTACTCGCTTATTCGTGGCCAATACACATAC
ACCAGTTCTTTTCTTTTCATCACGTGGGATTGTTTATAAAGAGAAGGTTTGGCGTTTACCTGTTGGTACGCCGCAATCAC
GCGGTAGAGCTTTAATTAATATGTTGCCTTTGCAACAAGGCGAGCGCATTACAACAATTATGCCATTGCCGGAGGATGAG
GCAAGTTGGGGTAAACTGGATATTATGTTTGCAACAACGCGTGGAACTGTGCGCCGTAATAAATTATCAGACTTTATTCA
AGTTAATCGCAATGGTAAAATAGCAATGAAACTTGATGAAGAGGGAGATGAGATCCTTTCTGTAGAGACCTGTACAGAAC
ATGATGACGTTGTTCTTATTACAGCAAACGGGCAGTGTATTCGTTTTCCAGTTACTGATATTCGTGTATTTTCTGGTCGT
AATTCGATGGGGGTACGCGGTATCAATATGGTTGAGGGTGATAAGGTCATTTCAATGACTATTTTAGAGCATGTTGAAGC
GACATCAGTCGAACGTTCTGCTTATATTAAACGTGCAATCAATGAGCGTCGTGTTGCAGGTTCAGATGATGAAGATATTT
TAACTGTTGATGAAGATGGAGAGGAAACTGAGGTTGAATTAACAGATGAACGTTATGCAGAACTTAGCGCTCATGAGCAA
ATGCTTTTAACAGTTAGTGAATTTGGTTATGGAAAACGCTCTTCTTCTTATGATTTCCGTATTTCAGGACGCGGTGGAAA
AGGGATACGCGCAACTGATCTATCAAAGGCGGCTGAAATTGGTAAGTTAGTAGCAGCCTTTCCAGTAGGAGAACGAGATC
AAATTATGTTAGTTTCGGATGGAGGACAGCTTATTCGTGTTCCCGTCAACTGTATTCGTATAGCGGGTCGTTCAACTAAA
GGGGTCACAGTCTTTAATACAGCAAAAGGTGAAAAAGTTGTATCGGTTGAGCGTATTTCTGAATCTGAAAATGATACTAA
TCAGTTAGATATTGAAAGTGAGGAACATTCCGGAACAGTTAGCATGAGTGAAGAGAAAAAACTCTGAA

>Flq|CP001581.1|gene7|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCTAAACGAAGGAAAGATTTTGCCTGTAGATGTAAGTAAAGAAATGAAGAAATGTTATATAGACTATGCCATGAGTGT
AATAGCTGGCCGTGCATTACCAGATGTAAGAGATGGGTTAAAGCCAGTACATAGAAGAATAATATATTCAATGCAGGGAT
TAGGATTAGCTCCAGAAAAAGGTTATAGAAAATGTGCGAGAATTGTAGGGGATGTACTAGGTAAGTATCATCCTCATGGA
GATACAGCAGTTTATGAAGCTTTAGTAAGAATGGCTCAGAATTTTTCAATAAGATATACATTAGTAGATGGTCATGGAAA
TTTTGGTTCTGTAGATGGTGATGGAGCAGCAGCAATGAGATATACAGAAGCTAAGATGAGTAAAATATCTATGGAACTTA
TAAAAGACATAAATAAAAATACAGTTGATTTTATTCCTAACTTTGATGGGGAAGAAGAAGAACCATCTGTATTACCATCA
AGGTTTCCTAATCTTTTAGTTAATGGTTCTTCAGGTATAGCAGTAGGTATGGCTACTAATATTCCACCTCATAATTTAAC
AGAGGTTATAGATGGAATAATAATGCTAATAGAAAATGAAGATGTAAATATACTTGATTTAATGACTAAAATAAAAGGAC
CAGATTTCCCTACTTCTGGATTAATCGTAGGTACAAGAGGAATAAGGGAAGCTTATGAAACTGGTAGAGGAAAAGTTATA
ATTAGAGCTAAAGCTGAGATTGAAGAGGAAAAAGGGAAAAATAAGATAATAGTTACAGAAATACCTTATCAAGTTAATAA
AGCTAGACTTATAGAAAATATGGCTAACCTTGTAAAGGATAAAAAAATAAATGGAATTTCAGATTTAAGAGATGAATCAG
ATAGAGATGGTATGAGAATTGTTATAGAATTAAAAAGGGATGCAAATCCTAATATAGTTTTAAACCAATTATATAAGCAT
ACAAAACTTCAAGATACCTTTGGAATAATCATGTTAGCTTTAGTTAATAACCAACCTCAAATTTTAAATTTAAAAGAAAT
ATTAGTTAATTATGTGGAATTCCAAAAGGAAGTAATAAGAAGAAGAACTAGATTTGACTTAGATAAAGCATTAGCAAGGG
CTCACATATTAGAAGGTTTAAGAATAGCCTTAGATCATATTGATGAAGTTATAAAACTTATAAGAGCATCTAAAAATACA
GCTGAAGCTAAAGAAGGATTAATGAATAACTTTAATCTTTCAGAAAAACAAGCTCAAGCTATATTAGATATGAAGTTACA
AAGGCTTACAGGTTTAGAAAGAGAAAAAATAGAAGAAGAATATAAAGAACTTATGGAAAAGATAAGTTATTTTAGAGAAA
TATTAGATAAAGAAGAATTAGTACTAAGTATAATAAAAGAAGAATTAATAGAGATAAAAAATAAATATGGTGATGAAAGA
AAAACAGAAATAGTAAAAGGTGAACATGATATAGACATAGAGGACTTAATTGAAGATAAAAAGGTGATAGTAACTTTAAC
TCATGGTGGATACATAAAAAGATTAGATATGGATACATACTCTTCACAAAAAAGAGGAGGAAAGGGTATTCAAGCTACAT
CTACAAAACAGGATGATTTTATAGAAAATATGTTTGTAACATCTACTCATAGTACTATATTATTCTTTACTAATAGGGGT
AAGGTATATAAACTTAAAGCTTATGAAATACCAGAAGCAGGAAGAACAGCTAAAGGTACAAATATAGTAAATCTTATACC
TATAGAAAATAATGAGAAAATACAAACAGTAATAGGTTTAAAAGACATAGATGACATGAAGCATTTTGTAATGTGTACGA
GAAATGGAATAATTAAAAAGACAGAGATAAGTAAATATTCTTCCATAAGAAAAGGTGGATTAAATGCCATAAATTTAAGA
GAAGATGATGAATTAATAGATGTAAAAATGACCAAAGGAAATGATGAAATAATAGTAGTAACACAAAATGGGTACTGTAT
AAGATTTAATGAAGAAGATGTAAGACCTATGGGAAGAGTTGCAACAGGTGTTAAGGCTATAACACTAAGAAAAACTGATA
AGGCTGTATCTATGGATGTAGTAATAGAAGATGAAACACTATTATCTATAAGTGAAAATGGATTTGGTAAACGAACAGAC
ATAGAAGAATATCCTATCCATAGAAGAGGTGGAAAAGGTGTTATAACTTATAAGATAACTGACAAAACAGGACCTATAGT
TGGAGCAAGGTTTGTAAAAGAAGATGATGAACTTATGCTTGTAAATAGTGGTGATGTTGCAATAAGAATAAATGTTTCGG
AAATATCTAAAACTAGTAGAAATGCTATGGGTGTAAAACTAATGAGAACTAGTGAAGAAGAAAAAATAGTAGCTATAGCT
AAAATAAAGAGTGAAGACATAATAGAAGAAGAAATTTTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAAAA
TCTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAATAA

>Flq|CP003275.1|gene5239|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCCGACGAGAACACCCCCGTCACCCCCGAAGAGGGCGGCGAACTCGTGATGCGTGTCGAGCCCGTCGGGCTTGAGAC
GGAGATGCAGCGCTCGTACCTGGACTACGCGATGTCCGTCATCGTGTCCCGTGCGCTGCCCGACGTCCGGGACGGTCTCA
AGCCCGTCCACCGCCGTGTGCTGTACGCGATGTACGACGGCGGCTACCGCCCCGAGCGCGGCTTCTACAAGTGCGCCCGT
GTCGTCGGCGACGTCATGGGCAACTACCACCCGCACGGCGACTCCTCCATCTACGACGCCCTGGTGCGCCTCGCCCAGCC
GTGGTCGATGCGGATGCCGCTGGTGGACTCCAACGGCAACTTCGGCTCCCCGGGCAACGACCCCGCGGCGGCCATGCGCT
ACACCGAGTGCAAGATGGCGCCGCTGTCGATGGAGATGGTCCGGGACATCGACGAGGAGACCGTCGACTTCACGGACAAC
TACGACGGCCGCTCCCAGGAGCCGACCGTCCTGCCGGCCCGCTTCCCGAACCTGCTGATCAACGGCTCGGCCGGTATCGC
GGTCGGCATGGCCACCAACATCCCGCCGCACAACCTGCGCGAGGTCGCGGCCGGCGCCCAGTGGTACCTGGAGAACCCCG
AGGTCTCCCACGAGGAGCTGCTGGACGCGCTCATGGAGCGCATCAAGGGCCCCGACTTCCCGACCGGCGCCCTGGTGGTG
GGCCGCAAGGGCATCGAGGAGGCGTACCGCACCGGCCGCGGCTCCATCACGATGCGCGCGGTGGTCGAGGTCGAGGAGAT
CCAGGGCCGCCAGTGCCTGGTGGTCACCGAGCTGCCGTACCAGGTGAACCCGGACAACCTGGCGCAGAAGATCGCCGACC
TGGTGAAGGACGGCAAGATCGGCGGCATCGCGGACGTCCGCGACGAGACCAGCTCGCGCACCGGCCAGCGCCTGGTGATC
GTCCTGAAGCGGGACGCGGTCGCCAAGGTCGTGCTGAACAACCTGTACAAGCACACGGACCTCCAGACGAACTTCGGCGC
CAACATGCTGGCGCTGGTCGACGGCGTGCCGCGCACCCTGTCCCTGGACGCGTTCATCCGCCACTGGGTGACGCACCAGA
TCGAGGTCATCGTCCGCCGGACCCGGTTCCGGCTGCGCAAGGCCGAGGAGCGCGCCCACATCCTGCGCGGTCTGCTGAAG
GCCCTCGACGCCATCGACGAGGTCATCGCGCTGATCCGGCGCAGTGAGACCGTCGAGATCGCGCGCAGCGGCCTGATGGG
CCTCCTGGAGATCGACGAGATCCAGGCGAACGCCATCCTTGAGATGCAGCTGCGCCGGCTGGCGGCCCTGGAGCGGCAGA
AGATCGTCCAGGAGCACGACGAACTCCAGGCGAAGATCAACGAGTACAACGAGATCCTCGCCTCGCCGGTGCGCCAGCGC
GGGATCGTCAGCGAGGAGCTGGCCGCGATCGTCGAGAAGTACGGCGACGACCGCCAGACCAAGCTGATCCCGTACGAGGG
CGACATGTCCATCGAGGACCTGATCGCCGAGGAGGACATCGTCGTCACCGTCACGCGCGGCGGCTACGTCAAGCGGACGA
AGACGGACGACTACCGGGCGCAGAAGCGCGGCGGCAAGGGCGTGCGCGGCACGAAGCTGAAGGAAGACGACATCGTCGAC
CACTTCTTCGTCTCCACCACGCACCACTGGCTGCTGTTCTTCACCAACAAGGGCCGGGTGTACCGGGCGAAGGCGTACGA
GCTGCCCGAGGCCGGCCGGGACGCGCGCGGCCAGCACGTGGCGAACCTGCTCGCCTTCCAGCCGGACGAGGCGATCGCCG
AGATCCTGGCGATCCGTGACTACGAGGCGGCGCCGTACCTGGTGCTGGCCACCAAGTCGGGCTTGGTCAAGAAGACGCCA
CTGAAGGATTACGATTCGCCTCGCTCCGGCGGTGTCATCGCCATCAACCTGCGGGAACGCGAGGACGGTTCGGACGACGA
GCTGATCGGCGCCGAGCTGGTCTCGGCGGACGACGATCTGCTGCTGATCAGCAAGAAGGCGCAGTCGATCCGGTTCACCG
CCTCGGACGAGTCCCTGCGCCCGATGGGCCGCGCCACCTCCGGCGTCAAGGGGATGAGTTTCCGGGAGGGCGACGAGCTT
CTCTCGATGAATGTGGTGCGACCCGGTACGTTCGTGTTCACTGCCACCGACGGTGGGTACGCGAAGCGGACCGCCGTCGA
CGAGTACCGCGTCCAGGGCCGCGGCGGCCTCGGCATCAAGGCCGCCAAGATCGTGGAGGACCGTGGTTCGCTCGTCGGCG
CGCTGATCGTCGAGGAGAACGACGAAATCCTCGCGATCACCCTCTCCGGCGGTGTGATTCGCACGCGAGTCAGCGAGGTC
AGGGAGACGGGCCGTGACACCATGGGCGTCCAACTGATCAATCTGGGCAAGCGCGATGCCGTGGTCGGTATCGCACGTAA
CGCCGAAGCGGGGCGCGAGGCGGAGGAAGTCGACGGCGACGTGGCCGTGGACGAGACCGCCGAGGGTGCCGCGATCACCG
GCACGGACGAGGGTGAGGCACCCTCGGCCGAGTAG

>Flq|NC_007622.3794239|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAAGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGCGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCCGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATATAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACTGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGAGCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACTTTGAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTAAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCCGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGCGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAGGATGCAGATGAAGTAAATGAAGATGAACAATCTACTGTATCTGA
AGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAGTGATTGATT
CAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATACAACAATCA
TCAGATGAAGATGAAGAATAA

>Flq|CP000768.1|gene728|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAGAATATTTTTAGCAAAGATTCTGATATTGAACTTGTAGATATAGAAAATTCTATAAAAAGTAGTTATTTAGACTA
TTCTATGAGTGTTATTATAGGTCGTGCTTTGCCTGATGCAAGAGATGGTTTAAAGCCTGTTCATAGAAGAATTTTATATG
CTATGCAAAATGATGAGGCAAAAAGTAGAACAGATTTTGTCAAATCAGCCCGTATAGTGGGTGCTGTTATAGGTCGTTAT
CACCCGCATGGAGATACAGCAGTTTATGATGCTTTAGTTAGAATGGCTCAAGATTTTTCTATGAGATATCCAAGTATTAC
AGGACAAGGTAACTTTGGATCTATAGATGGCGATAGTGCTGCTGCGATGCGTTATACTGAAGCAAAAATGAGTAAACTTT
CTCATGAGCTTTTAAAAGATATAGATAAAGATACGGTCGATTTTGTTCCAAATTATGATGGTTCAGAAAGTGAACCTGAT
GTTTTACCTTCTAGGGTTCCAAATTTATTATTAAATGGTTCAAGTGGTATAGCTGTAGGTATGGCGACAAATATCCCACC
TCATAGTTTAAATGAGTTGATAGATGGACTTTTATATTTGCTTGATAATAAAGATGTAAGCTTAGAAGAGATTATGCAGT
TTATCAAAGGTCCAGATTTTCCAACAGGTGGAATAATTTATGGTAAAAAAGGCATTATAGAAGCTTATCGCACAGGGCGT
GGTCGTGTGAAAGTGCGCGCTAAAACTCATATTGAAAAAAAGACAAATAAAGATGTTATTGTTATAGATGAGCTTCCTTA
TCAAACCAATAAAGCTAGGCTTATAGAGCAGATTGCAGAGCTTGTTAAAGAAAAGCAAATTGAAGGAATATCTGAAGTAA
GAGATGAGAGCAATAAAGAAGGAATCCGTGTTGTTATAGAGCTTAAACGTGAGGCTATGAGTGAAATTGTTTTAAATAAT
CTATTTAAATCTACCACTATGGAAAGTACTTTTGGTGTGATTATGTTAGCAATTCACAATAAAGAACCTAAAATTTTCTC
TTTGCTAGAACTTTTAAATCTTTTCTTAACCCATAGAAAAACAGTTATTATTAGAAGAACGATTTTTGAACTTCAAAAGG
CAAGAGTAAGAGCTCATATTTTAGAAGGTCTTAAAATTGCACTTGATAATATAGATGAAGTGATTGCTTTAATTAAAAAT
AGTTCCGACAATAATACCGCAAGAGATTCTTTGGTAGCTAAATTTGGTCTTAGTGAACTTCAAGCGAATGCTATTTTAGA
TATGAAACTGGGTCGTTTAACAGGACTTGAAAGAGAAAAAATTGAAAATGAACTTGCAGAATTAATGAAAGAAATTGCAA
GACTTGAAGAAATTTTAAAAAGTGAAACTTTGCTTGAAAATTTAATTCGCGATGAATTAAAAGAAATTAGAAGCAAATTT
GATGTACCACGTATTACTCAAATTGAAGATGATTATGATGATATTGATATTGAAGATTTGATTCCTAATGAAAATATGGT
TGTAACTATCACGCATCGTGGTTATATTAAGCGTGTGCCTAGTAAACAATATGAAAAGCAAAAACGAGGCGGAAAAGGAA
AATTAGCCGTTACGACTTATGATGATGATTTTATAGAAAGTTTCTTTACGGCAAATACACATGATACGCTTATGTTTGTA
ACAGATCGTGGACAGCTTTATTGGCTTAAAGTTTATAAAATTCCTGAAGGCTCAAGAACGGCTAAAGGAAAAGCAGTGGT
AAATCTTATCAATTTACAAGCTGAAGAAAAAATCATGGCTATTATTCCAACCACGGATTTTGACGAGAGTAAATCTTTAT
GTTTCTTTACTAAAAATGGTATTGTAAAGCGTACAAATTTGAGTGAATATCAAAATATCAGAAGTATTGGAGTTAGAGCG
ATCAACTTAAATGAAAATGATGAGTTGGTAACTGCTATTATTGTTCAAAGAGATGAAGATGAAATTTTTGCCAGTGGTGG
TGAAGAAAATTTAGAAAATCAAGAAATTGAAAATTTAGATGATGAAAATCTTGAAAATGAAGAAAGTGCAAGTACACAAG
GTAAAATGCTCTTTGCAGTAACCAAAAAAGGTATGTGTATCAAATTCCCGCTTGTTAAAGTGCGTGAAATCGGCCGTGTA
AGTCGTGGGGTGACAGCTATTAAGTTTAAAGAGAAAAATGACGAATTAGTAGGTGCAGTTGTTATAGAAAATGATGAGCA
AGAAATTTTAAGCGTAAGTGCAAAAGGTATAGGAAAACGCACCAATGCTGGAGAATATAGATTGCAAAGTAGAGGTGGTA
AGGGTGTAATTTGCATGAAGCTTACAGAAAAAACTAAAGATCTTATTAGTGTAGTTATAGTAGATGAAACTATGGATTTG
ATGGCTCTTACAAGTTCAGGCAAGATGATACGTGTTGATATGCAAAGCATTAGAAAAGCAGGGCGTAATACGAGTGGCGT
CATCGTGGTTAATGTGGAAAATGACGAGGTGGTTAGCATCGCTAAGTGTCCTAAAGAGGAAAATGATGAGGATGAGTTAA
GCGATGAAAACTTTGGTTTAGATTTGTAA

>Flq|NC_007795.3919179|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>Flq|NC_010410.6003186|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTATTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCATTTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACGGTTTCGCAAACGGGTTATGCAAAAACTCAACCTCTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAGCAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACTTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAGGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGCGGTATGCGCGTGAGTTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAACAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGTGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>Flq|AE016830.1|gene6|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGTGAAGAAATTAAAGAAAACATTCAAGACGTCAATCTGACCAGCGAAATGAAAGAATCTTTCATTGACTACGCAAT
GAGTGTTATCGTAGCCCGCGCGTTACCTGACGTTCGTGACGGTTTAAAACCTGTTCATCGCCGAATCTTATATGGAATGA
ACGAATTAGGGGTAACCCCTGATAAACCACACAAAAAATCAGCCCGGATTGTTGGGGATGTTATGGGTAAATATCACCCC
CATGGGGACAGTGCGATTTACGAATCAATGGTGCGGATGGCACAACCTTTTAGTTATCGGGCTATGTTAGTTGACGGCCA
CGGAAACTTCGGTTCCGTCGATGGTGACGGCGCTGCCGCTATGCGTTATACCGAAGCACGTATGAGTAAAATTGCTTTAG
AAATGCTACGAGATATTAACAAAAATACAGTCGATTTCCAAGGAAACTATGATGATTCAGAACAAGAACCAGTAGTTTTA
CCTGCTCGTTTTCCAAACTTACTAGTTAACGGAACAACGGGGATTGCGGTGGGGATGGCAACAAATATTCCACCACACAA
TTTAAGTGAAGTGATTGATGCAACAAGTTTATTGATGGACAATCCTGATGTAACGACGAATGAATTGATGGAAGTGTTAC
CTGGACCAGATTTTCCAACAGGCGGTTTAGTGATGGGGAAATCAGGGATTCGCCGAGCATATGAAACAGGGAAAGGTTCG
ATTACTGTTCGTGCAAAAGTTGAATTGACTGAAATGCCGAATGGAAAAGAACGTATTTTAGTAACTGAATTGCCTTATAT
GGTGAATAAAGCCAAATTAATCGAACGAATTTCTGAATTACACAGAGATAAACGAATTGAAGGAATTACTGATTTGCGGG
ATGAATCTTCTCGTGAAGGCATGCGGATTGTCATCGATGTTCGTCGAGATGTGAGTGCCTCTGTTGTGTTAAACAACTTG
TACAAAATGACTGCCTTACAAACATCTTTTGGTTTTAACATGTTAGCCATCGAAAAAGGCGTACCGAAAATTTTAAGCTT
GAAACGTATTTTAGAAAACTACGTCGAGCACCAAAAAGAAGTCATTACTCGCCGGACGATTTTTGACAAAAACAAAGCAG
AAGCACGGGCGCATATTTTAGAAGGTCTACGAATTGCCTTAGATCATATCGATGAAATCATTGCCATTATCCGTGGGTCA
CAATCAGATGACGAAGCAAAAGCAACGTTAATTGAACGCTTTGAATTTTCAGATCGTCAAGCGCAAGCGATTTTAGATAT
GCGTTTACGCCGTTTAACAGGCTTAGAACGCGACAAAATTGAAAATGAATATCAAGAGCTATTGAAATTCATTGCGGACT
TAGAGGACATTTTAGCCCGCCCAGAACGCGTCATTGAAATCATTAAAACAGAGTTAAATGACGTTCGCACAAAATTTGGT
GATGCACGACGCACAGAATTATTAGTAGGTGAAGTCCTAAGTCTTGAAGATGAAGATTTAATCGAAGAAGAAGAAGTCGT
GATTACATTAACCAATAACGGCTACATTAAGCGGATGGCAAACTCCGAATTCCGGGCGCAACGCCGCGGCGGACGTGGTG
TCCAAGGCATGGGCGTTCATGATGATGATTTCGTGAAAAACCTAGTTTCTTGTTCAACACATGACACGTTATTATTCTTT
ACGAACACTGGGAAAGTTTACCGAGCAAAAGGTTACGAAATCCCTGAATACGGTAGAACAGCAAAAGGAATTCCAGTGAT
TAACTTACTGGGAATTGATTCTGCAGAAAAAATTCAAGCGATTATTTCTGTTGAGGGCAAAGCGGAAGCAGGTAAATACT
TGTTCTTCACAACCTTAAAAGGAACCGTCAAACGGACAGCCGTAACAGCCTTTTCTAATATCCGTAGTAATGGATTAATC
GCCATTAGCTTAAAAGAAGATGATGAGTTAGTTAACGTAGTAACGACTAATGGCAATCAGAAGATGATTATCGGAACACA
TGCAGGATACTCTGTCACATTTGATGAAAATACTGTACGTGATATGGGCCGGACAGCATCAGGTGTTCGTGGAATCCGTC
TCCGCGAAAATGATTATGTGGTCGGCGCAGCGATTCTGGATGAAAATAAAGAAGTCCTAGTCATTACTGAAAATGGTTAT
GGTAAGCGTACAAAAGCCTCTGAATATCCAGTTAAAGGACGTGGCGGTAAAGGGATTAAGACAGCAAATATCACTGAGAA
AAATGGTCCATTAGCTGGTTTAACCACGGTCAATGGTGATGAAGATATCTTATTGATTACGAACAAAGGCGTCATTATCC
GCTTTAACGTTGATTCTGTTTCTCAAACAGGACGCGCAACATTAGGGGTTCGTTTAATGAGAATGGAAGATGGTGCCAAA
GTGGTAACAATGGCTGTTGTAGAACCAGAAGAAGTGGAAGAAGAAATCGTTGAAGTTGTAGAAACAACAGAAAACGAAAC
AACATCAGAAACAGAAGAATAA

>Flq|NC_002951.3236187|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>Flq|NC_011595.7058445|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTATTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACGGTTTCGCAAACGGGTTATGCAAAAACTCAACCTCTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAGCAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACTTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAGGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGCGGTATGCGCGTGAGTTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAACAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGTGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>Flq|NC_002745.1122777|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>Flq|CP001485.1|gene2164|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGATCTAGCTAAAGAGATCACGCCCGTAAACATCGAAGACGAGCTACGCAGTTCGTATTTGGACTACGCGATGTC
GGTTATCGTGGGTCGTGCTCTTCCTGATGTGCGTGATGGCCTTAAACCAGTACACCGACGCGTACTGTTCGCGATGAATG
TGCTGGGCAACGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTGGTAGGTGACGTAATCGGTAAATATCACCCTCAT
GGTGACAGTGCGGTTTACGACACCATCGTGCGTATGGCGCAGCCTTTCTCACTTCGTTACATGTTGGTCGATGGCCAAGG
TAACTTTGGCTCGATCGACGGCGACTCCGCGGCGGCAATGCGTTATACCGAAGTTCGTATGTCGAAAATCGCGCACGAAC
TCTTGGCAGACCTAGACAAAGAAACCGTTGACTACGTTCCGAACTATGACGGCACCGAGCAGATCCCTGCGGTATTGCCG
ACAAAGATCCCGAACCTGCTGATCAACGGCGCATCTGGTATTGCGGTGGGTATGGCAACCAACATTCCTCCGCACAATTT
AGGTGAAGTGATCGATGGCTGTTTAGCCTACATCGATAATGAAGCGATCACCATTGATGAGTTGATGGACTACATTCCTG
GTCCAGATTTCCCAACCGCCGCGCTGATCAGTGGCCGTAAAGGCATCATTGACGCGTACAAAACCGGCCGCGGCAAGGTT
TACATGCGCTCGAAAGCGGAAATCGAAACCGATAAGAACGGCAAAGAAACCATTATCGTCAGCGAAATCCCTTATCAAGT
GAACAAAGCGCGCTTGATCGAAAAAATCGCTGAGTTGGTGAAAGAGAAAAAAGTCGAAGGGATCAGTGCACTGCGTGACG
AGTCTGACAAAGACGGTATGCGCATTGTGATTGAGTGTAAGCGTGATGCGGTTGGCGAAGTGGTTTTGAACAACCTGTAT
GCCAACACTCAGCTGCAAACCACCTTCGGTATCAACATGGTGGCACTCGATAACGGTCAGCCTAAGCTGTTTAACCTGAA
AGAGATGCTGAAGTGTTTCGTCGACCACCGCCGCGAAGTGGTGACTCGTCGTACTATTTTTGAACTGCGTAAAGCGCGTG
AGCGTGCCCACATCCTTGAAGGTTTGGCACTGGCTCTGGCTAACATTGATGAAATCATTGAACTGATCCGCCGTGCCGCC
ACGCCTGCAGAAGCAAAAGAAGGCTTAATTGCCCGTGGTTGGGATCTTGGCAACGTTGCGGCAATGCTTGAGCGTGCAGG
TACGGATGCGGCGCGTCCTGAGTGGCTTGAGCCACAATACGGCATCCGCGATGGCAAGTACTTCCTGACTGAGCAACAAG
CGCAAGCGATTCTGGATCTGCGTCTGCACAAGCTGACTGGTCTAGAGCACGAGAAGATCCTCGATGAGTACAAGCAGCTT
CTCGAAGAAATCGCGGCATTGATGCACATTCTGGCGAGCACAGAGCGCTTGATGGAAGTGATCCGTGAAGAGCTAGAAGC
GATTCGCGCTGGCTTTAGCGATGCGCGCCGCACTGAAATCACGGCAGCAACGCACGACATCGACATGGAAGAGCTGATCG
CTCGTGAAGATGTGGTTGTGACTCTGTCACACGAAGGTTATGTGAAGTATCAATTACTGAGCGACTACGAAGCACAGCGT
CGTGGTGGTAAAGGTAAGAGCGCAACCAAGATGAAAGAAGAGGACTACATTGAGCGTCTTCTGGTTGCCAATACTCACGA
TAACATTCTGCTGTTCTCGACTCGCGGCAAAACTTACCGTATGAAGGTATACCAACTGCCGCTCGCCAGCCGTACTGCGC
GTGGTAAGCCAATCGTGAACCTGCTTCCTCTGGAAGAAAACGAGCGCATCACCGCGATTCTGCCAGTGACTGAGTTTAGT
GAAGATAAATTCATCTTCATGGCAACCGGTGACGGTACTGTGAAGAAAACATCGCTGGATCAGTTTGCCAACGTTCGTGC
GAATGGTTTGATTGCGCTCAACCTGCGTGACGAAGACTCGCTGATTGGTGTGGATATCACCGATGGCGAAAGCGAAATTA
TGCTGTTCTCTAAATTCGGTAAAGTGGTTCGCTTTAAAGAGTCCGAAGAAACCGCGGTTGTGGATGAAAATGGTCAACCT
GTGCTGGATGAAAATGGCCAGCCAGAGATCAAGTTCAAAGGCGTAAGACCAATGGGTCGTACCGCTGCGGGTGTTCGCGG
CATGAAACTGGCTGATGGCGACCAAGTGGTATCGCTCATCGTGCCGAAGACCGAAGGTGACGTACTCACCGTAACTGAAA
ATGGTTACGGCAAACGTACCAGCCTATCTGAATACCCAACCAAAGGTCGTGGAACTCAGGGTGTGGTTTCGATCAAAGTC
TCTGAGCGTAACGGCAGCGTTGTGGGTGCAGTACAAGTGGCCGAGGGTGATGAGTTCATGATGATCACCAATGCCGGTAC
ACTGGTACGTACTCGCGTGGCGGAAGTGAGCCAAGTGGGCCGTAATACTCAAGGCGTGACCCTGATCCGTACTTCGGAAG
GTGAAAGTGTGGTAGGTCTGCAGCGTATCGATGAAATCGAAGAGTCGGAATTGCCAGAAGGTGAGGAAGCACTTGTCGAG
AACGATGCACCTGTTGCACAAGATGATGATGGTGAACAAGAGTAA

>Flq|NC_003112.2.903806|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACCGACGCAACCATCCGCCACGACCACAAATTCGCCCTCGAAACCCTGCCGGTAAGCCTTGAAGACGAAATGCGCAA
AAGCTATCTCGACTACGCCATGAGCGTCATTGTCGGGCGCGCGCTGCCGGACGTTCGCGACGGTCTCAAGCCGGTACACC
GCCGCGTACTGTACGCGATGCACGAGCTGAAAAACAACTGGAATGCCGCCTACAAAAAATCGGCGCGCATTGTCGGCGAC
GTCATCGGTAAATACCACCCCCACGGCGATACCGCCGTATACGACACCATCGTCCGTATGGCGCAAAATTTCGCTATGCG
TTATGTGCTGATAGACGGACAGGGCAACTTCGGATCGGTGGACGGGCTTGCCGCCGCAGCCATGCGCTACACCGAAATCC
GCATGGCGAAAATTTCCCACGAAATGCTGGCAGACATTGAGGAAGAAACCGTCAATTTCGGCCCGAACTACGACGGTAGC
GAACACGAGCCGCTTGTACTGCCGACCCGTTTCCCCACACTGCTCGTCAACGGCTCGTCCGGCATCGCCGTCGGCATGGC
GACCAATATCCCGCCGCACAACCTTTCTGATACCGTCAATGCCTGCCTGCGCCTGCTCGATGCACCCGACACCGAAATCG
ACGAACTGATCGACATTATCCAAGCCCCCGACTTCCCGACCGGGGCAACCATCTACGGCTTGAGCGGCGTGCGCGAAGGC
TATAAAACAGGCCGCGGCCGCGTCGTTATGCGCGGTAAGACCCATATCGAACCCATAGGCAGAAACGGCGAACGCGAAGC
CATCGTTATCGACGAAATCCCCTATCAGGTCAACAAAGCCAAGCTGGTCGAGAAAATCGGCGATTTGGTTCGGGAAAAAA
CACTGGAAGGCATTTCCGAGCTCCGCGACGAATCCGACAAATCCGGTATGCGCGTCGTTATCGAGCTGAAACGCAACGAA
AATGCCGAAGTCGTCTTAAACCAACTCTACAAACTGACTCCGCTGCAAGACAGTTTCGGCATCAATATGGTGGTTTTGGT
CGACGGACAACCGCGCCTGTTGAACCTGAAACAGATTCTCTCCGAATTCCTGCGCCACCGCCGCGAAGTCGTTACCCGAC
GTACGCTTTTCCGGCTGAAGAAGGCACGCCATGAAGGGCATATTGCCGAAGGCAAAGCCGTCGCACTGTCCAATATCGAT
GAAATCATCAAGCTCATCAAAGAATCGCCCAACGCAGCCGAGGCCAAAGACAAACTGCTTGCGCGCCCTTGGCGCAGCAG
CCTCGTTGAAGAAATGCTGACGCGTTCCGGTCTGGATTTGGAAATGATGCGTCCGGAAGGATTGGCTGCAAACATCGGCT
TGAAAGAGCAAGGTTATTACCTGAGCGAGATTCAGGCAGATGCTATTTTACGCATGAGCCTGCGAAACCTGACCGGCCTC
GATCAAGAAGAAATTGTCGAAAGCTACAAAAACCTGATGGGTAAAATCATCGACTTTGTGGATATCCTCTCCAAACCCGA
ACGCATTACCCAAATCATCCGCGACGAACTGGAAGAAATCAAAACCAACTATGGCGACGAACGCCGCAGCGAAATCAACC
CGTTCGGCGGCGACATTGCCGATGAAGACCTGATTCCGCAACGCGAAATGGTCGTTACCCTGACACATGGCGGCTATATC
AAAACCCAGCCGACCACCGACTATCAGGCGCAGCGTCGCGGCGGGCGCGGCAAACAGGCGGCTGCCACCAAAGACGAAGA
CTTTATCGAAACCCTGTTTGTTGCCAACACGCATGATTATTTGATGTGCTTTACCAATTTGGGCAAGTGTCATTGGATTA
AGGTTTACAAACTGCCCGAAGGCGGACGCAACAGCCGCGGCCGTCCGATTAACAACGTCATCCAGTTGGAAGAAGGCGAA
AAAGTCAGCGCGATTCTGGCAGTACGCGAGTTCCCCGAAGACCAATACGTCTTCTTCGCCACCGCGCAGGGAATGGTGAA
AAAAGTCCAACTTTCCGCCTTTAAAAACGTCCGCGCCCAAGGCATTAAAGCCATCGCGCTCAAAGAAGGCGACTACCTCG
TCGGCGCTGCGCAAACAGGCGGTGCGGACGACATCATGCTGTTCTCCAACTTAGGTAAAGCCATCCGCTTCAACGAATAC
TGGGAAAAATCCGGCAACGACGAAGCGGAAGATGCCGACATCGAAACCGAAATTTCAGACGGCATCGAAGATGAAACCGC
CGACAGCGAAAACGCACTGCCGAGCGGCAAACACGGTGTTCGCCCGTCCGGTCGCGGCAGCGGCGGTTTGCGCGGTATGC
GCCTGCCTGCCGACGGCAAAATCGTCAGCCTGATTACCTTCGCCCCTGAAACCGAAGAAAGCGGTTTGCAAGTTTTAACC
GCCACCGCCAACGGATACGGAAAACGCACCCCGATTGCCGATTACAGCCGCAAAAACAAAGGCGGGCAAGGCAATATTGC
CATTAACACTGGCGAGCGAAACGGCGATTTGGTCGCCGCAACCTTGGTCGGCGAAACCGACGATTTGATGCTGATTACCA
GCGGCGGCGTACTTATCCGCACCAAAGTCGAACAAATCCGCGAAACCGGCCGCGCCGCAGCAGGCGTGAAACTGATTAAC
TTGGACGAAGGCGAAACCTTGGTATCGCTGGAACGTGTTGCCGAAGACGAATCCGAACTCTCCGACGCTTCTGTAATTTC
CAATGTAACCGAACCGGAAGTCGAGAACTGA

>CARD|pvgb|AL123456|7301-9818|ARO:3003295|Mycobacterium|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACAGACACGACGTTGCCGCCTGACGACTCGCTCGACCGGATCGAACCGGTTGACATCGAGCAGGAGATGCAGCGCAG
CTACATCGACTATGCGATGAGCGTGATCGTCGGCCGCGCGCTGCCGGAGGTGCGCGACGGGCTCAAGCCCGTGCATCGCC
GGGTGCTCTATGCAATGTTCGATTCCGGCTTCCGCCCGGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACC
ATGGGCAACTACCACCCGCACGGCGACGCGTCGATCTACGACAGCCTGGTGCGCATGGCCCAGCCCTGGTCGCTGCGCTA
CCCGCTGGTGGACGGCCAGGGCAACTTCGGCTCGCCAGGCAATGACCCACCGGCGGCGATGAGGTACACCGAAGCCCGGC
TGACCCCGTTGGCGATGGAGATGCTGAGGGAAATCGACGAGGAGACAGTCGATTTCATCCCTAACTACGACGGCCGGGTG
CAAGAGCCGACGGTGCTACCCAGCCGGTTCCCCAACCTGCTGGCCAACGGGTCAGGCGGCATCGCGGTCGGCATGGCAAC
CAATATCCCGCCGCACAACCTGCGTGAGCTGGCCGACGCGGTGTTCTGGGCGCTGGAGAATCACGACGCCGACGAAGAGG
AGACCCTGGCCGCGGTCATGGGGCGGGTTAAAGGCCCGGACTTCCCGACCGCCGGACTGATCGTCGGATCCCAGGGCACC
GCTGATGCCTACAAAACTGGCCGCGGCTCCATTCGAATGCGCGGAGTTGTTGAGGTAGAAGAGGATTCCCGCGGTCGTAC
CTCGCTGGTGATCACCGAGTTGCCGTATCAGGTCAACCACGACAACTTCATCACTTCGATCGCCGAACAGGTCCGAGACG
GCAAGCTGGCCGGCATTTCCAACATTGAGGACCAGTCTAGCGATCGGGTCGGTTTACGCATCGTCATCGAGATCAAGCGC
GATGCGGTGGCCAAGGTGGTGATCAATAACCTTTACAAGCACACCCAGCTGCAGACCAGCTTTGGCGCCAACATGCTAGC
GATCGTCGACGGGGTGCCGCGCACGCTGCGGCTGGACCAGCTGATCCGCTATTACGTTGACCACCAACTCGACGTCATTG
TGCGGCGCACCACCTACCGGCTGCGCAAGGCAAACGAGCGAGCCCACATTCTGCGCGGCCTGGTTAAAGCGCTCGACGCG
CTGGACGAGGTCATTGCACTGATCCGGGCGTCGGAGACCGTCGATATCGCCCGGGCCGGACTGATCGAGCTGCTCGACAT
CGACGAGATCCAGGCCCAGGCAATCCTGGACATGCAGTTGCGGCGCCTGGCCGCACTGGAACGCCAGCGCATCATCGACG
ACCTGGCCAAAATCGAGGCCGAGATCGCCGATCTGGAAGACATCCTGGCAAAACCCGAGCGGCAGCGTGGGATCGTGCGC
GACGAACTCGCCGAAATCGTGGACAGGCACGGCGACGACCGGCGTACCCGGATCATCGCGGCCGACGGAGACGTCAGCGA
CGAGGATTTGATCGCCCGCGAGGACGTCGTTGTCACTATCACCGAAACGGGATACGCCAAGCGCACCAAGACCGATCTGT
ATCGCAGCCAGAAACGCGGCGGCAAGGGCGTGCAGGGTGCGGGGTTGAAGCAGGACGACATCGTCGCGCACTTCTTCGTG
TGCTCCACCCACGATTTGATCCTGTTCTTCACCACCCAGGGACGGGTTTATCGGGCCAAGGCCTACGACTTGCCCGAGGC
CTCCCGGACGGCGCGCGGGCAGCACGTGGCCAACCTGTTAGCCTTCCAGCCCGAGGAACGCATCGCCCAGGTCATCCAGA
TTCGCGGCTACACCGACGCCCCGTACCTGGTGCTGGCCACTCGCAACGGGCTGGTGAAAAAGTCCAAGCTGACCGACTTC
GACTCCAATCGCTCGGGCGGAATCGTGGCGGTCAACCTGCGCGACAACGACGAGCTGGTCGGTGCGGTGCTGTGTTCGGC
CGGCGACGACCTGCTGCTGGTCTCGGCCAACGGGCAGTCCATCAGGTTCTCGGCGACCGACGAGGCGCTGCGGCCAATGG
GTCGTGCCACCTCGGGTGTGCAGGGCATGCGGTTCAATATCGACGACCGGCTGCTGTCGCTGAACGTCGTGCGTGAAGGC
ACCTATCTGCTGGTGGCGACGTCAGGGGGCTATGCGAAACGTACCGCGATCGAGGAATACCCGGTACAGGGCCGCGGCGG
TAAAGGTGTGCTGACGGTCATGTACGACCGCCGGCGCGGCAGGTTGGTTGGGGCGTTGATTGTCGACGACGACAGCGAGC
TGTATGCCGTCACTTCCGGCGGTGGCGTGATCCGCACCGCGGCACGCCAGGTTCGCAAGGCGGGACGGCAGACCAAGGGT
GTTCGGTTGATGAATCTGGGCGAGGGCGACACACTGTTGGCCATCGCGCGCAACGCCGAAGAAAGTGGCGACGATAATGC
CGTGGACGCCAACGGCGCAGACCAGACGGGCAATTAAT

>Flq|NC_010400.5986734|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCAATGAGTGTAAT
CGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCTTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TCAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGCGATAGCGCCGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGGTAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACCGGTCCTG
ATTTCCCTACAAGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CTCCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTCAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCAGAAGAGCAAGTGGTATTAACTGTTTCACAAACAGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCAAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGTCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCTGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTGCCTGAGACAGGTG
AAGTACTGTGTGCGAGTGCCAACGGCTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTTGTTGGCGTAGTTTCAATTGAAACTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>Flq|FN543093.2|gene2948|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCCAGAGAAATTACACCGGTCAACATTGAGGAAGAGTTAAAGAACTCCTATCTGGATTACGCGATGTC
GGTTATTGTCGGCCGCGCGCTTCCGGATGTCCGAGATGGCCTCAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TGTTGGGCAATGACTGGAATAAAGCCTACAAAAAATCCGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGTGATTCCGCCGTTTACGATACCATTGTACGTATGGCTCAGCCGTTCTCGCTGCGTTATACGCTGGTGGATGGTCAGGG
CAACTTCGGTTCTATCGACGGCGACTCCGCCGCGGCGATGCGTTATACGGAAATCCGTCTGGCGAAGATCGCCCATGAAC
TGATGGCCGACCTCGACAAAGAAACCGTTGATTTTGTAGACAACTATGACGGCACGGAAAAAATCCCTGACGTCATGCCG
ACCAAAATCCCGAACCTGCTGGTAAACGGTTCATCCGGTATCGCCGTCGGGATGGCGACGAACATTCCGCCGCATAACCT
GACGGAAGTGATTAACGGCTGCCTCGCGTATATCGATGATGAAGATATCAGCATCGAAGGGCTGATGGAGCACATTCCTG
GCCCGGATTTCCCGACGTCCGCCATTATCAACGGCCGTCGCGGCATTGAAGAGGCGTATCGCACCGGGCGCGGCAAAATC
TACATTCGCGCGCGCGCGGAAGTGGAAGTCGATCCGAAAAACGGCCGCGAAACCATTATCGTGCACGAAATTCCGTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGACAAACGCGTCGAAGGCATCAGCGCGCTGCGCG
ACGAGTCTGACAAAGACGGTATGCGCATCGTCATTGAGATCAAACGCGACGCCGTCGGCGAAGTGGTGCTCAATAATCTC
TATTCCCAGACGCAGCTTCAGGTGTCTTTCGGTATCAACATGGTCGCGCTGCACCACGGTCAGCCGAAGATCATGGCGCT
GAAAGAGATTCTGGCGGCGTTCGTTCGCCACCGTCGTGAAGTCGTGACCCGCCGCACCATCTTTGAACTGCGCAAAGCCC
GCGAGCGTGCGCATATCTTAGAAGGTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATTGAGCTGATTCGCCGCGCG
CCGAACCCGTCCGAAGCGAAAGCGGGCCTCATCGCCCAGGCGTGGGAGCTGGGCACCGTTTCCGCGATGCTGGAGCGCGC
CGGCGACGACGCCGCGCGTCCGGAATGGCTGGAGCCGGAGTTCGGTATTCGCGATGGCAAATACTGGCTGACCGAGCAGC
AGGCACAGGCGATCCTCGATCTGCGTCTGCAGAAACTCACCGGCCTTGAGCATGAAAAACTGCTCGACGAGTATAAAGAG
CTGCTGGAGCAGATCGCTGAGCTGCTGCATATCCTCGGCAGCGCCGACCGCCTGATGGAAGTAATCCGCGAAGAGCTGGA
GCTGATCCGCGATCAGTTCGGCGATGAGCGCCGCACCGAAATCACCGCCAACAGCGCCGATATCAACATCGAAGATCTGA
TCAACCAGGAAGATGTGGTGGTCACCCTGTCTCACCAGGGCTATGTGAAGTATCAGCCGCTGACGGATTACGAAGCGCAG
CGCCGCGGCGGTAAAGGCAAATCCGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCCAACACCCA
CGATACGATCCTCTGCTTCTCAAGCCGTGGACGTCTCTACTGGATGAAAGTCTACCAGTTGCCGGAAGCGAGCCGCGGCG
CCCGCGGACGTCCTATCGTCAACCTGCTGCCGCTGGAAGCGAACGAGCGTATCACCGCGATTCTGCCGGTACGCGAGTAT
GAAGAAGGCGTTAACGTCTTTATGGCGACCGCGAGCGGCACCGTGAAGAAAACGGCGCTGACCGAGTTCAGCCGTCCGCG
TACCGCCGGTATCATCGCGGTGAACCTGAACGAGGGCGATGAGCTGATCGGCGTCGACCTGACCGCAGGTAAAGACGAAG
TGATGCTGTTCTCCGCGCAGGGCAAAGTGGTGCGCTTCAAAGAAGACGCGGTGCGTCCGATGGGTCGTACCGCCACTGGC
GTGCGCGGTATTCGCCTCGGCGAGGGCGACAGCGTTGTGTCGCTTATCGTACCGCGCGGCGAAGGCGCTATCCTGACCGC
CACCCAGAACGGTTACGGCAAGCGTACCGCGGTGGAAGAGTACCCGACCAAGTCGCGCGCGACGAAAGGGGTTATCTCCA
TCAAGGTGACCGATCGCAACGGGCCGGTCGTCGGCGCGGTGCAGGTCGATGACGCAGACCAGATCATGATGATCACCGAT
GCCGGCACCCTGGTGCGTACGCGCGTATCGGAAATCAGCGTGGTGGGCCGTAACACCCAGGGCGTTATCCTCATCCGCAC
CGCGGAAGATGAAAACGTGGTGGGTCTGCAACGTGTCGCCGAACCGGTAGATGACGAAGAGCTCGACTCTATCGACGGCA
GCGTGGCGGAAGGCGACGATGAAATCGCGCCGGAAACCGACGTTGACGACGACGCGGCGGACGACGCCGACGAGTAA

>Flq|AM180355.1|gene6|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAAGAAAATAACAAAATACTCCCTATTGAAATAGCGGAAGAAATGAAAAAATCGTATATTGATTATTCAATGAGTGT
TATAGCTGGACGTGCTCTTCCTGATGTTAGAGATGGTTTAAAGCCAGTTCATAGAAGAATATTATATTCAATGAGTGAGT
TAAATTTAACTCCAGATAAACCATACAGGAAGTCAGCTCGTATTGTTGGGGACGTTTTAGGTAAGTACCATCCTCATGGA
GATACTGCTGTTTATTATGCTATGGTAAGAATGGCACAAGATTTTTCAACTAGAGCACTTTTAGTAGATGGTCATGGTAA
CTTTGGTTCTGTTGATGGGGATTCACCAGCTGCTATGCGTTATACAGAAGCTAAAATGAGTAAATTATCATTAGAACTAC
TGAGAGATATTGAAAAGGAAACTGTAGACTTTAAACCAAACTTTGATGAGTCGTTAAAAGAGCCTTCAGTATTGCCAGCT
AGATATCCTAATTTATTAGTAAATGGCTCAAATGGTATAGCTGTTGGTATGGCAACTTCAATACCTCCACATAATTTAGC
AGAAGTAATTGATGCAACTGTATATTTGATAGATAATCCAGAGTGTAGTGTAGATGATTTAATAAAATTTGTTCAAGGAC
CAGATTTCCCTACAGCTGCAATTATAATGGGAAAAGAAAGTATAGCAGAAGCATACAGAACTGGAAGAGGAAAAGTTAAA
GTTAGGTCTAGAGCTTTTATAGAAGAGCTACCAAAAGGAAAACAGCAAATAATAGTTACAGAAATACCTTATCAAGTAAA
TAAGGCTAAACTGGTTGAAAGAATAGCAGAGTTAGTTAAAGAAAAGAGAATAGAAGGTATATCAGACCTAAGAGACGAAA
GTAATAGAAATGGTATGAGAATTGTTATAGAATTAAAGAGGGATGCTAATGCTAATATAGTATTAAATAATTTGTATAAA
CATTCTCAAATGGAAGATACTTTTAGTATAATAATGCTTGCACTTGTAGATGGTCAGCCAAGAGTTTTAAATCTTAAACA
AATATTATATCATTATATTAAACATCAAGAAGATGTTGTTACAAGAAGAACTAAATTTGAACTAAATAAAGCTGAAGCAA
GAGCACATATTTTAGAAGGATTAAAGATTGCTTTAGATAATATAGATGCTGTTATAAGCTTGATAAGAGCTTCAAAGACT
GGGCAAGAAGCTAAGCTAGGTTTAATAGAAAAATTCAAATTAACTGAAATCCAAGCACAAGCTATATTAGATATGAGACT
TCAAAGACTTACAGGTTTAGAAAGAGATAAGATAGAAGCTGAATATGAAGATTTAATCAAGAAGATAAATAGATTAAAAG
AGATTTTAGCTGATGAAAGATTACTTTTAAATGTAATAAAGGATGAAATTACAATAATAAAAGAAAATTACTCTGATGAG
AGAAGAACAGAAATAAGACATGCTGAAGGCGAAATAGATATGAGAGATCTTATAAGTGATGAAGAAATAGCAATAACTCT
TACTCACTTTGGATATATAAAAAGGCTTCCATCTGATACTTATAAGAGTCAAAAAAGGGGTGGAAGAGGTATTTCAGCAC
TTACAACTAGAGAAGAAGATTTTGTAAGGCACTTGGTAACTACAACTACTCATAGTAGACTATTATTCTTTACAAATAAA
GGTAGAGTATTTAAATTAAATGCATATGAAATACCAGAAGGTAAGAGACAGGCTAAAGGTACTGCTATAGTGAATTTACT
TCAATTGTCAGCAGATGAGAAAATTGCTACTCTAATACCTATTGATGGTAATGATGAAAATGAATATTTATTACTTGCAA
CGAAAAAAGGTATTGTTAAAAAGACTAAGAGAGAAGAGTTCAAAAATATAAATAAATCTGGTCTTATTGCAATAGGTTTA
AGAGATGATGATGAGCTTATTGGAGTAGAACTTACAGATGGAAAACAAGAAGTACTTTTAGTAACTAAAGAAGGTATGTC
TATAAGATTTGATGAAAATGATATAAGATATATGGGTAGAACAGCAATGGGTGTAAAAGGTATAACTTTAAGTAAAGAAG
ATTTTGTTGTGTCTATGAACCTTTGTAGTAAAGGTACAGATGTGTTAGTTGTAAGTAAGAATGGTTTTGGAAAGAGAACA
AATATAGAAGAGTATAGAAGTCAAATAAGAGCTGGTAAAGGAATTAAAACTTATAATATATCTGAAAAAACTGGTACAAT
TGTAGGTGCAGATATGGTCAACGAAGATGATGAGATAATGATTATAAATTCTGATGGAGTTCTTATTAGAATAAGAGTCA
ATGAAATATCACTGTTTGGAAGAGTTACAAGTGGTGTTAAATTAATGAAGACGAATGATGAAGTCAATGTAGTTTCGATT
GCCAAAATAAATATTGAAGAAGAATAG

>Flq|CR628337.1|gene1424|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGTATACCTAGCCAAAGAAGTCTTACCAGTCAACATAGAAGACGAATTGAAGCAATCCTATTTGGATTATGCGATGAG
TGTCATTGTAGGCCGAGCATTGCCTGATGTACGTGATGGTTTAAAACCGGTGCATAGGCGAGTTCTTTTTGCGATGAGCG
AGTTGGGTAATGATTGGAATAAACCTTATAAAAAATCTGCTCGTGTAGTAGGGGATGTCATCGGTAAATACCATCCTCAT
GGGGATACAGCTGTTTATGACACTATTGTTCGTATGGCTCAGCCCTTTTCCATGCGTTATATGCTGATTGATGGGCAGGG
TAATTTTGGTTCTGTAGACGGAGATGCTCCAGCTGCCATGCGTTACACTGAAGTACGAATGTCCAAGGTGGCGCATGCTT
TACTGGCTGATTTGGATAAGGAAACCGTTGATTTTAGTCCTAACTATGATGAAACAGAATTTGCTCCAGTGGTATTGCCA
TCGAGAATTCCCAATTTACTAGTTAATGGCTCTTCCGGTATTGCGGTAGGGATGGCTACTAATATTCCACCACATAATCT
TACCGAAGTAATCAATGCATGTATTGCCTTAGTGGATGAACCTGACACGAGTCTTGAAGATTTAATGGAAATTATTCCTG
GCCCTGATTTTCCTACAGCAGCAATTATTAATGGTCGTGCTGGAATTATTGAAGGTTATCGTACTGGAAAAGGGCGGGTT
GTTATCAGGGCACGCACAGAAATTGAAACGGATGAAAGTTCAGGACGTCAGTCAATTATTATTCAGGAATTACCCTATCA
GGTGAATAAAGCGCGTTTGATCGAGCGTATTGCTGAATTGGTAAGAGACAAGAAAATCGAAGGAATTTCCGGCTTGAGGG
ATGAGTCAGATAAGCAGGGAATGAGAGTAGTCATTGAGTTAAAACGCAATGAAGTAGCAGATGTGGTATTGAATAACCTG
TTCGCTCATACTCAAATGCAAAATGTATTCGGGATTAATATGGTTGCCCTGGTGGATGGCCAACCGCGTACTTTGAATTT
GAAGCAAATACTGGAATATTTTATAAAACATCGAAGAGAGGTTGTTACCAGACGCACAATATTTGAATTGAAAAAAGCCA
GAAATCGAGCCCATTTATTGGAGGGCTTGGGAATCGCCTTGGCTAATATCGATGAAATGATCGCATTAATTAAGCAATCT
TCTACTCCTCAAGACGCAAAAAGTGCTTTATTAAGCAAAATATGGCAACCTGGCTTGGTAAAGGCCATGTTGGAAAAGGC
TGGCTCAAACGCGTCAAGGCCTGATGATTTAACTGAAGAGTATGGTTTGCATGAGAACGGATATAAATTATCTGAAGCGC
AGGCACAAGCAATACTTGAATTAAGATTACATAGGCTAACAGCTCTTGAACAAGATAAAATAATTAATGAATTTGAAGAG
CTATTGAATTTAATTAAAGAATTGCTTGACATATTGGCTTCACCTGAAAGACTTATGCAAGTTATTCGTGATGAATTGAT
AGAGATTAAATCCCAATTTGGTGATGAGAGGCGAACGGAAATAACAGCCTCACAAGAAGATTTGACTATTGAAGATTTGA
TTACCGAAGAAGACGTTGTGGTCACTTTATCTCATCAAGGTTATGTAAAATATCAGCCCATTACAGCCTATCAGGCTCAG
CGCCGAGGTGGCAAAGGCAAATCGGCAACTCATGTCAAGGATGAGGATTTTGTTGAGCGTTTGGTTATTGCGAGTACTCA
TGACACCTTATTATGTTTCTCCAATCATGGCAAATTATATTGGCTAAAAGCATATCAATTGCCTCAAGCAAGCCGTGCTT
CGAGAGGAAGGCCTATAATCAATATTCTTCCTTTGGCTGAAGGCGAAGAGATTAATGCTATGCTCCCTGTCCGTGAGTAT
AAAGACGGCAGCTATGTATTTATGGCAACCAAGAAGGGAACAGTTAAAAAAGTGCCTTTAAACGCATTTAGCAGGCCGCG
TTCCAATGGTATTATTGCTGTGGACCTGGAAGAGGATGACAGTCTCGTTGGAGTGGATATTACTGATGGTGCTCGCGATA
TTATGTTGTTTACTGATGCAGGCAAAGTGATCCGCTTTGATGAAAGTAAAGTGCGACCTATGGGGCGCACGGCTCGAGGA
GTTCGTGGAATTAGGGTAGAAAAGGATCAAGCCGTTAAATCTCTTGTGGTAGTCGATCCAAGTGGAGGCACCATTTTGAC
GGCAACTGAAAACGGCTACGGCAAGAGAACTCATATTGATGAATATCGAGTGTCAGGACGGGGCGGGCAAGGTGTTATTT
CCATTCAGGTTACTGAACGAAATGGTAAAGTGGTCCGCTCCTTGCAGGTTACCGATAATGACGAAGCCATGTTAATTACA
GATAAAGGGACTTTGGTTCGTTTTAAAGTCAATGAATTATCTGTGATAGGCCGAAATACACAAGGAGTTCGTCTGATTAA
TGTCAGTTCTGGTGAGGCAGTTGTTGGAATGCAAAAAATTGTAGATCTTGGAGAAGAATTAGAAGAGGCAGAAGACTCAT
CCCTTAATGCTGAAGACAGCAGTGATGAATAG

>Flq|AE015929.1|gene5|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATTAATGAACGAAATATAACCAGTGAAATGCGTGAATCATTCTTAGACTATGCTAT
GAGTGTTATCGTTTCTCGTGCATTACCTGATGTTAGAGACGGATTAAAGCCAGTACATCGTCGTATTCTTTATGGTTTAA
ATGAACAAGGTATGACGCCCGATAAACCTTATAAGAAATCTGCACGTATAGTCGGGGATGTCATGGGTAAATATCACCCT
CATGGTGATTCTTCAATTTATGAAGCAATGGTAAGAATGGCCCAAGACTTTAGTTATCGTTATCCACTTGTAGATGGTCA
AGGTAACTTTGGCTCTATGGATGGTGACGGTGCAGCCGCAATGCGTTATACCGAAGCACGTATGACTAAAATAACATTAG
AACTTTTACGTGATATCAACAAAGACACAATTGATTTTATTGACAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCACGTTTCCCTAACTTACTAGTAAATGGTGCGGCAGGAATTGCCGTAGGTATGGCTACAAATATTCCTCCCCACAA
TTTAACTGAAGTTATTGATGGTGTGCTCAGTTTAAGTAAGAATCCAGACATCACAATTAATGAGCTGATGGAAGACATCC
AAGGTCCTGATTTTCCTACAGCCGGTTTAGTACTAGGAAAAAGTGGTATTCGTCGAGCTTATGAAACAGGTCGTGGGTCA
ATTCAAATGCGTTCTCGTGCTGAAATAGAAGAACGTGGTGGTGGCCGTCAACGTATTGTCGTAACGGAAATACCTTTCCA
AGTCAATAAAGCGCGTATGATTGAAAAAATCGCAGAGTTAGTTAGAGATAAGAAAATCGACGGTATTACAGATTTACGTG
ATGAAACAAGTTTGCGTACAGGTGTAAGAGTAGTTATTGATGTACGTAAAGATGCAAATGCGAGTGTTATTTTAAATAAT
TTATATAAACAAACGCCATTACAAACATCATTTGGTGTAAATATGATTGCTTTAGTGAATGGTAGACCTAAACTAATCAA
TTTAAAAGAAGCACTTATTCATTACTTAGAACACCAAAAAACAGTGGTTAGACGACGTACTGAATATAATCTTAAAAAAG
CAAGAGACCGTGCACATATTCTAGAAGGTTTACGAATAGCACTAGATCATATTGATGAAATTATCACAACAATTCGTGAA
TCGGACACTGATAAAATTGCGATGGCAAGTTTACAAGAGCGTTTTAAACTTACTGAACGTCAAGCTCAAGCAATTTTAGA
TATGCGTTTAAGACGTTTAACTGGATTAGAAAGAGATAAAATAGAATCTGAGTATAATGAACTTCTAGAATATATTAAAG
AGTTAGAAGAGATTTTAGCTGATGAAGAAGTACTATTACAATTAGTTCGTGATGAATTGACTGAAATTAAAGAACGTTTC
GGCGATGAACGTCGCACTGAAATTCAATTAGGTGGTCTAGAAGATCTTGAAGATGAAGACTTAATCCCTGAAGAACAAAT
TGTTATTACATTAAGTCATAATAACTATATTAAACGTTTACCAGTATCTACATATCGTTCTCAAAATCGTGGTGGTCGTG
GCATACAAGGTATGAACACGTTGGATGAGGACTTCGTTAGTCAATTGGTAACAATGAGTACACATGATCATGTTCTGTTC
TTTACGAATAAAGGTCGTGTATATAAACTCAAAGGTTATGAAGTTCCTGAGTTGTCACGTCAATCCAAAGGCATACCTAT
TATTAATGCGATTGAACTCGAAAATGACGAAACAATAAGTACGATGATTGCAGTTAAAGACCTTGAAAGTGAAGAAGATT
ATCTCGTATTTGCGACAAAACAAGGTATCGTTAAACGTTCATCATTAAGTAACTTCTCCCGTATTAACAAAAACGGTAAA
ATTGCAATTAACTTTAAAGAAGATGATGAATTAATTGCAGTACGTCTAACAACAGGTAATGAAGATATTCTTATTGGAAC
TGCACATGCATCATTAATTAGATTCTCTGAATCTACATTACGCCCATTAGGCCGTACAGCAGCAGGTGTGAAAGGTATTT
CTCTACGTGAAGGGGATACTGTCGTAGGTCTTGATGTTGCAGATTCAGAAAGTGAAGATGAAGTATTAGTAGTTACTGAA
AATGGTTACGGTAAACGTACACCTGTTAGCGAATATCGTTTATCAAATCGTGGTGGTAAAGGAATCAAAACTGCGACAAT
TACCGAGCGTAATGGTAACATCGTTTGTATCACAACTGTAACCGGTGAAGAGGATTTAATGGTTGTAACTAACGCTGGTG
TTATTATTCGTCTTGACGTTCATGATATTTCTCAAAATGGACGTGCAGCACAAGGTGTACGCCTTATGAAACTCGGAGAT
GGTCAATTTGTTTCTACTGTTGCTAAAGTAAACGAAGAAGACGATAATGAGGAAAATGCAGATGAAGCGCAACAATCTAC
TACTACTGAAACAGCAGATGTAGAAGAGGTAGTCGATGATCAGACACCAGGCAATGCGATTCATACAGAAGGTGATGCAG
AAATGGAATCTGTAGAGTCTCCTGAAAATGATGATCGTATTGATATTAGACAAGATTTTATGGATAGAGTGAATGAAGAT
ATCGAGAGTGCTTCAGATAATGAAGAAGATAGTGATGAATAA

>Flq|CP003248.2|gene6|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACAGACACGACGTTGCCGCCTGACGACTCGCTCGACCGGATCGAACCGGTTGACATCGAGCAGGAGATGCAGCGCAG
CTACATCGACTATGCGATGAGCGTGATCGTCGGCCGCGCGCTGCCGGAGGTGCGCGACGGGCTCAAGCCCGTGCATCGCC
GGGTGCTCTATGCAATGTTCGATTCCGGCTTCCGCCCGGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACC
ATGGGCAACTACCACCCGCACGGCGACGCGTCGATCTACGACAGCCTGGTGCGCATGGCCCAGCCCTGGTCGCTGCGCTA
CCCGCTGGTGGACGGCCAGGGCAACTTCGGCTCGCCAGGCAATGACCCACCGGCGGCGATGAGGTACACCGAAGCCCGGC
TGACCCCGTTGGCGATGGAGATGCTGAGGGAAATCGACGAGGAGACAGTCGATTTCATCCCTAACTACGACGGCCGGGTG
CAAGAGCCGACGGTGCTACCCAGCCGGTTCCCCAACCTGCTGGCCAACGGGTCAGGCGGCATCGCGGTCGGCATGGCAAC
CAATATCCCGCCGCACAACCTGCGTGAGCTGGCCGACGCGGTGTTCTGGGCGCTGGAGAATCACGACGCCGACGAAGAGG
AGACCCTGGCCGCGGTCATGGGGCGGGTTAAAGGCCCGGACTTCCCGACCGCCGGACTGATCGTCGGATCCCAGGGCACC
GCTGATGCCTACAAAACTGGCCGCGGCTCCATTCGAATGCGCGGAGTTGTTGAGGTAGAAGAGGATTCCCGCGGTCGTAC
CTCGCTGGTGATCACCGAGTTGCCGTATCAGGTCAACCACGACAACTTCATCACTTCGATCGCCGAACAGGTCCGAGACG
GCAAGCTGGCCGGCATTTCCAACATTGAGGACCAGTCTAGCGATCGGGTCGGTTTACGCATCGTCATCGAGATCAAGCGC
GATGCGGTGGCCAAGGTGGTGATCAATAACCTTTACAAGCACACCCAGCTGCAGACCAGCTTTGGCGCCAACATGCTAGC
GATCGTCGACGGGGTGCCGCGCACGCTGCGGCTGGACCAGCTGATCCGCTATTACGTTGACCACCAACTCGACGTCATTG
TGCGGCGCACCACCTACCGGCTGCGCAAGGCAAACGAGCGAGCCCACATTCTGCGCGGCCTGGTTAAAGCGCTCGACGCG
CTGGACGAGGTCATTGCACTGATCCGGGCGTCGGAGACCGTCGATATCGCCCGGGCCGGACTGATCGAGCTGCTCGACAT
CGACGAGATCCAGGCCCAGGCAATCCTGGACATGCAGTTGCGGCGCCTGGCCGCACTGGAACGCCAGCGCATCATCGACG
ACCTGGCCAAAATCGAGGCCGAGATCGCCGATCTGGAAGACATCCTGGCAAAACCCGAGCGGCAGCGTGGGATCGTGCGC
GACGAACTCGCCGAAATCGTGGACAGGCACGGCGACGACCGGCGTACCCGGATCATCGCGGCCGACGGAGACGTCAGCGA
CGAGGATTTGATCGCCCGCGAGGACGTCGTTGTCACTATCACCGAAACGGGATACGCCAAGCGCACCAAGACCGATCTGT
ATCGCAGCCAGAAACGCGGCGGCAAGGGCGTGCAGGGTGCGGGGTTGAAGCAGGACGACATCGTCGCGCACTTCTTCGTG
TGCTCCACCCACGATTTGATCCTGTTCTTCACCACCCAGGGACGGGTTTATCGGGCCAAGGCCTACGACTTGCCCGAGGC
CTCCCGGACGGCGCGCGGGCAGCACGTGGCCAACCTGTTAGCCTTCCAGCCCGAGGAACGCATCGCCCAGGTCATCCAGA
TTCGCGGCTACACCGACGCCCCGTACCTGGTGCTGGCCACTCGCAACGGGCTGGTGAAAAAGTCCAAGCTGACCGACTTC
GACTCCAATCGCTCGGGCGGAATCGTGGCGGTCAACCTGCGCGACAACGACGAGCTGGTCGGTGCGGTGCTGTGTTCGGC
CGGCGACGACCTGCTGCTGGTCTCGGCCAACGGGCAGTCCATCAGGTTCTCGGCGACCGACGAGGCGCTGCGGCCAATGG
GTCGTGCCACCTCGGGTGTGCAGGGCATGCGGTTCAATATCGACGACCGGCTGCTGTCGCTGAACGTCGTGCGTGAAGGC
ACCTATCTGCTGGTGGCGACGTCAGGGGGCTATGCGAAACGTACCGCGATCGAGGAATACCCGGTACAGGGCCGCGGCGG
TAAAGGTGTGCTGACGGTCATGTACGACCGCCGGCGCGGCAGGTTGGTTGGGGCGTTGATTGTCGACGACGACAGCGAGC
TGTATGCCGTCACTTCCGGCGGTGGCGTGATCCGCACCGCGGCACGCCAGGTTCGCAAGGCGGGACGGCAGACCAAGGGT
GTTCGGTTGATGAATCTGGGCGAGGGCGACACACTGTTGGCCATCGCGCGCAACGCCGAAGAAAGTGGCGACGATAATGC
CGTGGACGCCAACGGCGCAGACCAGACGGGCAATTAA