MEGAResFrom MEG, the Microbial Ecology Group

GYRA

GyrA and B are the two components of the bacterial DNA gyrase (topoisomerase IIa). Mutations in these proteins can cause resistance to fluoroquinolones via evasion of the mechanism of action.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC245234/

Other Groups in Fluoroquinolone-resistant DNA topoisomerases

Sequences

Download Sequences

>>MEG_3176|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGTTGAAGGAGAAAAACTCATTCCTATTAACATAGAAGACCAGATGAAGACAGCCTACATTGACTATTCAATGTCAGT
GATTGTCTCAAGAGCTTTGCCCGATGTACGCGATGGGCTGAAGCCTGTACATCGTCGTGTACTCTTTGGAATGCACGAGC
TTGGCGTACGTAGCAACACCGCTCATAAGAAATCAGCCCGTATCGTAGGGGAAGTACTCGGTAAGTACCATCCACACGGC
GATTCTTCCGTATATGACACAATGGTACGTATGGCACAATGGTGGAACATGCGCTATATGCTTGTAGATGGGCAAGGTAA
CTTTGGTTCTATCGATGGAGACTCTCCTGCAGCTATGCGTTATACCGAGGCGAGAATGAGAAAAATGGCCGAGGATATGC
TGATAGATATCGACAAAGAAACAGTAGATCACAGCCTGAACTTTGACGATACCCTACTCGAACCTACTGTATTGCCTACC
CGCATCCCTAACCTACTGGTGAATGGGTCTTCGGGTATTGCTGTAGGTATGGCTACCAATATGCCACCTCATAATCTTGC
TGAAGTAGTTGATGGTATAATTGCTTATCTTGGCAATCAAGATATTACCATCGATGAACTTATGGAATATATCAAGGCTC
CTGACTTCCCTACAGGTGGAATCATCTATGGCTATGATGGAGTAAGAGAAGCCTTCAAGACTGGACGTGGACGTGTAGTA
ATCCGCGCCAAGGCTCATTTTGAAGAAGTTAATGGTCGTGACTGTATTGTCGTAACTGAAGTTCCCTATCAAGTGAACCC
AGAGACGATGCGTGAACAGACTTCGAACCTTGTCAAAGAAGGCAAACTCGAAGGCCTAGCCGATATCGTAGATCAAACAG
GTAAAGGAGGAATGCGCATCGTATATGAACTCAAAAAAGATGCTATTCCCAACGTAGTGCTGAATAACCTCTTCAAACAC
ACAGCATTACAATCCTCCTTCAGTGTCAATAATATTGCCTTGGTCAATGGACGCCCTCAGCAACTGAACCTCAAGGACTT
AATATATCACTTTGTAGAACATCGCCACGATGTAGTATACAGACGTACTGAGTATGAGCTCAAAAAAGCCAAAGAACGTA
TCCATATCTTGGAAGGGTTCATGAAGGTGATGGCCACAGAAGACACTATGGGGAAAGCTATTGAAATCATCCGTTTTCAT
GACAAGCCCAAAGAGGATTTGATGACCGAGTTCGAGCTTACCGAAATACAAGCTGAAGCTATCTTAGCCTTACAGCTACG
TCGTATCAATAAGCTATTAATCCTTCAAACCAAAGAAGAATATGAGCAATTATTAGCACAAATTATTGATTTGGAAGATA
TCCTTGCTCGCAAAGAACGCCGTACCGAGATTATCAAAGAAGAACTCTTGGAAATAAAATCCAAATATGGAGACGAACGT
CGTTCTGTCATAGAATATGCAGGGGGTGATATCTCCATTGAGGATATTATCCCTGATGATCAAGTGGTTATTACCATTTC
CAACGCAGGTTACATAAAGCGTACTTCTGTCAATGAATACAAAACCCAAGCACGTGGTGGTGTAGGACAAAAAGCCTCTG
CTACTCGTGATAAGGACTTCATAGAGCATCTGTTCATAGGTACCAACCACCAGTATATGCTGTTCTTTACAGAGAAAGGT
AAGTGTTTTTGGCTCAGGGTGTATGAGATTCCTGAAGGAGGTAAAAATACCAAAGGACGCGCCATACAGAACCTTATCAA
TATCGAACCCGATGACCTTGTTAAGGCAGTCATCTGTACCCATGACCTCAAGGAAAAAGACTATACCAATAGTCACTATG
TCATCATGGCTACTAAAAAAGGGATTATTAAGAAAACCAGCTTAGAACAATATTCACGTCCACGCCAGAATGGTATCGTT
GCCATCACTATCAAAGAAGATGATGAGCTATTAGAAGCACGTCTTACCTCTGGCAACAGCCAAATCATGCTAGCTGTCAA
GTCTGGAAAGGCTATTCGCTTCCCAGAGGACAAGGTGAGAGCTGTAGGGCGTAGTGGCTCTGGAGTACGAGGTATCTCTT
TGGATAGTGACAAAGATGAGGTAATCGGAATGATTGCCATAGAAAATCCTCTGGAAGAAACCGTATTGGTAGTTTCCGAG
AATGGTTATGGTAAGCGTACCTTTATCGATGAACCAGAGACAGGAGAAGCAGTATATCGTATTACCAACCGTGGAGGAAA
AGGAGTCAAGACTATTTCTATCACAGAGAAAACAGGTAATCTGGTAGCAATCAAGTCAGTTTTGGAAGAAGACGATCTGA
TGATTATCAATAAGTCGGGTATGGCTATTCGCCTCCCTGTAAGTGGACTCCGTGTGATGGGACGTGCTACCCAAGGAGTA
CGCCTTATCAATATCAAAGGAAATGACTCTATTGCCGCAGTAGCAAAGGTTATGAAAGAAGATGAGGATGAAAATACTAC
CGAAGAGATAGAAAACCCAACAGAAGAATAA

>>MEG_3177|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACCGACGCAACCATCCGCCACGACCACAAATTCGCCCTCGAAACCCTGCCCGTCAGCCTTGAAGACGAAATGCGCAA
AAGCTATCTCGACTACGCCATGAGCGTCATTGTCGGGCGCGCGCTGCCGGACGTTCGCGACGGCCTAAAGCCGGTGCACC
GGCGCGTACTGTACGCGATGCACGAGCTGAAAAATAACTGGAATGCCGCCTACAAAAAATCGGCGCGCATCGTCGGCGAC
GTCATCGGTAAATACCACCCCCACGGCGATTCCGCAGTTTACGACACCATCGTCCGTATGGCGCAAAATTTCGCTATGCG
TTATGTGCTGATAGACGGACAGGGCAACTTCGGATCGGTGGACGGGCTTGCCGCCGCAGCCATGCGCTATACCGAAATCC
GCATGGCGAAAATCTCACATGAAATGCTGGCAGACATTGAGGAAGAAACCGTTAATTTCGGCCCGAACTACGACGGTAGC
GAACACGAGCCGCTTGTACTGCCGACCCGTTTCCCCACACTGCTCGTCAACGGCTCGTCCGGTATCGCCGTCGGTATGGC
GACCAACATCCCGCCGCACAACCTCACCGACACCATCAACGCCTGTCTGCGTCTTTTGGACGAACCCAAAACCGAAATCG
ACGAACTGATCGACATTATCCAAGCCCCCGACTTCCCGACCGGGGCAACCATCTACGGCTTGGGCGGCGTGCGCGAAGGC
TATAAAACAGGCCGCGGCCGCGTCGTTATACGCGGTAAGACCCATATCGAACCCATAGGCAAAAACGGCGAACGCGAAGC
CATCGTTATCGACGAAATCCCCTATCAGGTCAACAAAGCCAAGTTGGTCGAGAAAATCGGCGATTTGGTTCGGGAAAAAA
CGCTGGAAGGCATTTCCGAGCTCCGCGACGAATCCGACAAATCCGGGATGCGCGTCGTTATCGAGCTGAAACGCAACGAA
AATGCCGAAGTCGTCTTAAACCAACTCTACAAACTGACTCCGCTGCAAGACAGTTTCGGCATCAATATGGTTGTTTTGGT
CGACGGACAACCGCGCCTGTTAAACCTGAAACAGATTCTCTCCGAATTCCTGCGCCACCGCCGCGAAGTCGTTACCCGAC
GTACGCTTTTCCGGCTGAAGAAGGCACGCCATGAAGGGCATATCGCCGAAGGCAAAGCCGTCGCACTGTCCAATATCGAT
GAAATCATCAAGCTCATCAAAGAATCGCCCAACGCGGCCGAGGCCAAAGAAAAACTGCTTGCGCGCCCTTGGCGCAGCAG
CCTCGTTGAAGAAATGCTGACGCGTTCCGGTCTGGATTTGGAAATGATGCGTCCGGAAGGATTGGCTGCAAACATTGGTC
TGAAAAAACAAGGTTATTACCTGAGCGAGATTCAGGCAGATGCTATTTTACGCATGAGCCTGCGAAACCTGACCGGCCTC
GATCAGAAAGAAATTATCGAAAGCTACAAAAACCTGATGGGTAAAATCATCGACTTTGTGGATATCCTCTCCAAACCCGA
ACGCATTACCCAAATCATCCGTGACGAACTGGAAGAAATCAAAACCAACTATGGCGACGAACGCCGCAGCGAAATCAACC
CGTTCGGCGGCGACATTGCCGATGAAGACCTGATTCCGCAACGCGAAATGGTCGTGACCCTGACCCACGGCGGCTATATA
AAAACCCAGCCGACCACCGACTATCAGGCTCAGCGTCGCGGCGGGCGCGGCAAACAGGCGGCTGCCACCAAAGACGAAGA
CTTTATCGAAACCCTGTTTGTTGCCAACACGCATGACTATTTGATGTGTTTTACCAACCTCGGCAAGTGCCACTGGATTA
AGGTTTACAAACTGCCCGAAGGCGGACGCAACAGCCGCGGCCGTCCGATTAACAACGTCATCCAGCTGGAAGAAGGCGAA
AAAGTCAGCGCGATTCTGGCAGTACGCGAGTTTCCCGAAGACCAATACGTCTTCTTCGCCACCGCGCAGGGAATGGTGAA
AAAAGTCCAACTTTCCGCCTTTAAAAACGTCCGCGCCCAAGGCATTAAAGCCATCGCACTCAAAGAAGGCGACTACCTCG
TCGGCGCTGCGCAAACAGGCGGTGCGGACGACATTATGTTGTTCTCCAACTTGGGCAAAGCCATCCGCTTCAACGAATAC
TGGGAAAAATCCGGCAACGACGAAGCGGAAGATGCCGACATCGAAACCGAGATTTCAGACGACCTCGAAGACGAAACCGC
CGACAACGAAAACACCCTGCCAAGCGGCAAAAACGGCGTGCGTCCGTCCGGTCGCGGCAGCGGCGGTTTGCGCGGTATGC
GCCTGCCTGCCGACGGCAAAATCGTCAGCCTGATTACCTTCGCCCCTGAAACCGAAGAAAGCGGTTTGCAAGTTTTAACC
GCCACCGCCAACGGATACGGAAAACGCACCCCGATTGCCGATTACAGCCGCAAAAACAAAGGCGGGCAAGGCAGTATTGC
CATTAACACCGGCGAGCGCAACGGCGATTTGGTCGCCGCAACCTTGGTCGGCGAAACCGACGATTTGATGCTGATTACCA
GCGGCGGCGTGCTTATCCGTACCAAAGTCGAACAAATCCGCGAAACCGGCCGCGCCGCAGCAGGCGTGAAACTGATTAAC
TTGGACGAAGGCGAAACCTTGGTATCGCTGGAACGTGTTGCCGAAGACGAATCCGAACTCTCCGGCGCTTCTGTAATTTC
CAATGTAACCGAACCGGAAGCCGAGAACTGA

>>MEG_3178|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTAAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCGGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGCGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTA
TATATCCGCGCCCGTGCTGAAGTGGAAGTTGACGCCAAAACCGGACGTGAAACCATTATCGTCCACGAAATTCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATTGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTTGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCCATGTTGGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGTTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGCGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAATATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGCGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACGCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTACCAGTTGCCGGAAGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTACCGCTGGAACAGGACGAACGTATCACCGCGATCCTGCCGGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACTGTGAAGAAAACCGTCCTCACCGAATTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGACGGCGATGAGCTGATCGGCGTTGATCTGACCAGTGGCGAAGATGAAG
TAATGCTGTTCTCCGCCGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAATACCACTGGT
GTGCGCGGTATTCGCTTAGGTGAAGGCGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAAAACGGTTACGGTAAACGTACTGCAGTGGCGGAATACCCAACCAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTGGTTGGCGCGGTGCAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCAGAAATCAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAGCGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGATGATGAAATTGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>>MEG_3179|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGACCGATCTTACTCGACTACCAGAACATGATGTGTCGACCGGTATTGAACCAGTCAGTATCATTGAAGAAATGCAGTG
CTCTTATCTAGATTATGCGATGAGCGTAATTGTGTCGCGCGCACTGCCTGATGTCCGTGATGGGCTTAAGCCTGTCCATC
GGCGCATTCTTCATGCGATGAATGAAATGGGACTTTTGTTCAATAAGCCTTATCGTAAGTCAGCGGGTGTTGTTGGTGAA
GTGATGGGAAAGTTTCATCCTCATGGTGATGCTTCAATTTATGATGCCTTGGTGCGTATGGCACAGGATTTTTCTTTACG
AAATCCTCTGATTGATGGACAGGGAAATTTTGGCTCTGTTGACGGTGATCCACCCGCAGCGATGCGTTACACGGAATGTC
GTTTAGAAAAAGTTGCAGAAGAACTTTTAGCTGATATTGATAAAGATACTGTTGATTTTCAAGATAATTATGATGGGCGT
GAGCATGAACCTATAGTTTTGCCTGCACGTTTCCCTAACCTGTTAGTAAATGGATCGGGTGGTATTGCTGTAGGTATGGC
AACCAATATTCCTCCACATAATCTAGGTGAGGTTATTGATGGATGTGTTGCTTTGATCGATAATCCTAACATAACTATAG
ATGAGATGTTAGCAATTATTCCGGGGCCTGATTTTCCTACAGGTGGTATTATTCTTGGCCATTCTGGTGTCCGTTCTGCT
TATGAAACAGGGCGTGGTTCAATTATTATGCGTGCTAAGGTTGAGATCGAGGAAATTCGCAATCAGCGGCAGGCAATTAT
CGTAAGCGAAATACCTTATCAAGTTAATAAAGCAACAATGGTTGAGAAGATGGCCGAATTGGTGCGTGATAAACGTATCG
AAGGAATCTCCGATTTGCGTGATGAATCTGATCGTGATGGGTATCGAGTTGTCATTGAGCTAAAAAGAGAAGCTGTTGCA
GACGTTGTTTTGAATCAGCTTTATCGTTATACACCGTTGCAAGCCTCATTTGGTTGCAATATGGTTGCGTTGAATGGAGG
AAAGCCTGAACAAATGACGTTGCTTGACATGCTTCGTGCATTTGTTTCCTTCCGCGAAGAAGTGGTAAGCCGGCGCACAA
AATATCTTTTGCGTAAAGCACGTGAGCGTGCGCATGTTTTAGTTGGTCTTGCTATCGCTGTTGCTAATATTGATGAGATT
ATAGAATTAATTCGCAAAGCTCATGATCCACAGACAGCGCGTACACAGTTAATGGAACGGCGTTGGCCGGCTTCTGAGGT
AGCAGCTTTGATTAAGCTTATAGATGATCCTCGTCATATTATTCATGAGGATAATACGTACAATTTGTCTGAAGAACAAG
CGCGTGCTATTTTAGAATTGCGTTTGCAAAGATTAACAGCGCTTGGTCGTAATGAAATTGCTGATGAACTCAATGCAATT
GGAGAAGATATTGCTGACTATCTTGGTATTTTAGCATCACGCTCACGGATCATGGACATTGTTAAAAGTGAGCTCAGCGC
TTTGCGTGAAACATTTGCAACACCACGGCGTACTGTATTTGGTTTTGGTAGTGCCGAGATGGACTGCGAAGATCTGATTG
TTCCAGAAGATATGGTGGTGACAGTGAGCCATAGTGGCTATATTAAGCGTGTGCCTCTAAATACATACCGTGCGCAGCGT
CGTGGTGGTAAGGGACGTTCTGGTATGGCAACAAAGGATCAGGATTTTGTTACTCGCTTATTCGTGGCCAATACACATAC
ACCAGTTCTTTTCTTTTCATCACGTGGGATTGTTTATAAAGAGAAGGTTTGGCGTTTACCTGTTGGTACGCCGCAATCAC
GCGGTAGAGCTTTAATTAATATGTTGCCTTTGCAACAAGGCGAGCGCATTACAACAATTATGCCATTGCCGGAGGATGAG
GCAAGTTGGGGTAAACTGGATATTATGTTTGCAACAACGCGTGGAACTGTGCGCCGTAATAAATTATCAGACTTTATTCA
AGTTAATCGCAATGGTAAAATAGCAATGAAACTTGATGAAGAGGGAGATGAGATCCTTTCTGTAGAGACCTGTACAGAAC
ATGATGACGTTGTTCTTATTACAGCAAACGGGCAGTGTATTCGTTTTCCAGTTACTGATATTCGTGTATTTTCTGGTCGT
AATTCGATGGGGGTACGCGGTATCAATATGGTTGAGGGTGATAAGGTCATTTCAATGACTATTTTAGAGCATGTTGAAGC
GACATCAGTCGAACGTTCTGCTTATATTAAACGTGCAATCAATGAGCGTCGTGTTGCAGGTTCAGATGATGAAGATATTT
TAACTGTTGATGAAGATGGAGAGGAAACTGAGGTTGAATTAACAGATGAACGTTATGCAGAACTTAGCGCTCATGAGCAA
ATGCTTTTAACAGTTAGTGAATTTGGTTATGGAAAACGCTCTTCTTCTTATGATTTCCGTATTTCAGGACGCGGTGGAAA
AGGGATACGCGCAACTGATCTATCAAAGGCGGCTGAAATTGGTAAGTTAGTAGCAGCCTTTCCAGTAGGAGAACGAGATC
AAATTATGTTAGTTTCGGATGGAGGACAGCTTATTCGTGTTCCCGTCAACTGTATTCGTATAGCGGGTCGTTCAACTAAA
GGGGTCACAGTCTTTAATACAGCAAAAGGTGAAAAAGTTGTATCGGTTGAGCGTATTTCTGAATCTGAAAATGATACTAA
TCAGTTAGATATTGAAAGTGAGGAACATTCCGGAACAGTTAGCATGAGTGAAGAGAAAAAACTCTGA

>>MEG_3180|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACAGACACGACGTTGCCGCCTGACGACTCGCTCGACCGGATCGAACCGGTTGACATCGAGCAGGAGATGCAGCGCAG
CTACATCGACTATGCGATGAGCGTGATCGTCGGCCGCGCGCTGCCGGAGGTGCGCGACGGGCTCAAGCCCGTGCATCGCC
GGGTGCTCTATGCAATGTTCGATTCCGGCTTCCGCCCGGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACC
ATGGGCAACTACCACCCGCACGGCGACGCGTCGATCTACGACAGCCTGGTGCGCATGGCCCAGCCCTGGTCGCTGCGCTA
CCCGCTGGTGGACGGCCAGGGCAACTTCGGCTCGCCAGGCAATGACCCACCGGCGGCGATGAGGTACACCGAAGCCCGGC
TGACCCCGTTGGCGATGGAGATGCTGAGGGAAATCGACGAGGAGACAGTCGATTTCATCCCTAACTACGACGGCCGGGTG
CAAGAGCCGACGGTGCTACCCAGCCGGTTCCCCAACCTGCTGGCCAACGGGTCAGGCGGCATCGCGGTCGGCATGGCAAC
CAATATCCCGCCGCACAACCTGCGTGAGCTGGCCGACGCGGTGTTCTGGGCGCTGGAGAATCACGACGCCGACGAAGAGG
AGACCCTGGCCGCGGTCATGGGGCGGGTTAAAGGCCCGGACTTCCCGACCGCCGGACTGATCGTCGGATCCCAGGGCACC
GCTGATGCCTACAAAACTGGCCGCGGCTCCATTCGAATGCGCGGAGTTGTTGAGGTAGAAGAGGATTCCCGCGGTCGTAC
CTCGCTGGTGATCACCGAGTTGCCGTATCAGGTCAACCACGACAACTTCATCACTTCGATCGCCGAACAGGTCCGAGACG
GCAAGCTGGCCGGCATTTCCAACATTGAGGACCAGTCTAGCGATCGGGTCGGTTTACGCATCGTCATCGAGATCAAGCGC
GATGCGGTGGCCAAGGTGGTGATCAATAACCTTTACAAGCACACCCAGCTGCAGACCAGCTTTGGCGCCAACATGCTAGC
GATCGTCGACGGGGTGCCGCGCACGCTGCGGCTGGACCAGCTGATCCGCTATTACGTTGACCACCAACTCGACGTCATTG
TGCGGCGCACCACCTACCGGCTGCGCAAGGCAAACGAGCGAGCCCACATTCTGCGCGGCCTGGTTAAAGCGCTCGACGCG
CTGGACGAGGTCATTGCACTGATCCGGGCGTCGGAGACCGTCGATATCGCCCGGGCCGGACTGATCGAGCTGCTCGACAT
CGACGAGATCCAGGCCCAGGCAATCCTGGACATGCAGTTGCGGCGCCTGGCCGCACTGGAACGCCAGCGCATCATCGACG
ACCTGGCCAAAATCGAGGCCGAGATCGCCGATCTGGAAGACATCCTGGCAAAACCCGAGCGGCAGCGTGGGATCGTGCGC
GACGAACTCGCCGAAATCGTGGACAGGCACGGCGACGACCGGCGTACCCGGATCATCGCGGCCGACGGAGACGTCAGCGA
CGAGGATTTGATCGCCCGCGAGGACGTCGTTGTCACTATCACCGAAACGGGATACGCCAAGCGCACCAAGACCGATCTGT
ATCGCAGCCAGAAACGCGGCGGCAAGGGCGTGCAGGGTGCGGGGTTGAAGCAGGACGACATCGTCGCGCACTTCTTCGTG
TGCTCCACCCACGATTTGATCCTGTTCTTCACCACCCAGGGACGGGTTTATCGGGCCAAGGCCTACGACTTGCCCGAGGC
CTCCCGGACGGCGCGCGGGCAGCACGTGGCCAACCTGTTAGCCTTCCAGCCCGAGGAACGCATCGCCCAGGTCATCCAGA
TTCGCGGCTACACCGACGCCCCGTACCTGGTGCTGGCCACTCGCAACGGGCTGGTGAAAAAGTCCAAGCTGACCGACTTC
GACTCCAATCGCTCGGGCGGAATCGTGGCGGTCAACCTGCGCGACAACGACGAGCTGGTCGGTGCGGTGCTGTGTTCGGC
CGGCGACGACCTGCTGCTGGTCTCGGCCAACGGGCAGTCCATCAGGTTCTCGGCGACCGACGAGGCGCTGCGGCCAATGG
GTCGTGCCACCTCGGGTGTGCAGGGCATGCGGTTCAATATCGACGACCGGCTGCTGTCGCTGAACGTCGTGCGTGAAGGC
ACCTATCTGCTGGTGGCGACGTCAGGGGGCTATGCGAAACGTACCGCGATCGAGGAATACCCGGTACAGGGCCGCGGCGG
TAAAGGTGTGCTGACGGTCATGTACGACCGCCGGCGCGGCAGGTTGGTTGGGGCGTTGATTGTCGACGACGACAGCGAGC
TGTATGCCGTCACTTCCGGCGGTGGCGTGATCCGCACCGCGGCACGCCAGGTTCGCAAGGCGGGACGGCAGACCAAGGGT
GTTCGGTTGATGAATCTGGGCGAGGGCGACACACTGTTGGCCATCGCGCGCAACGCCGAAGAAAGTGGCGACGATAATGC
CGTGGACGCCAACGGCGCAGACCAGACGGGCAATTAA

>>MEG_3181|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACTGATATCACGCTGCCACCAGGTGACGGTTCTATACAGCGGGTTGAGCCGGTCGACATTCAGCAGGAAATGCAGCG
CAGCTATATTGATTACGCGATGAGTGTGATTGTGGGCCGGGCGTTGCCTGAAGTCCGCGATGGTCTCAAACCGGTACATC
GTCGGGTCTTGTACGCGATGTTAGACTCCGGTTTCCGCCCGGACCGTAGCCACGCTAAGTCAGCACGGTCAGTCGCTGAG
ACGATGGGCAATTACCATCCGCACGGCGACGCATCGATTTATGACACGTTAGTGCGCATGGCGCAGCCGTGGTCGCTGCG
GTATCCCTTGGTTGATGGGCAAGGCAATTTCGGTTCGCCGGGTAATGACCCACCGGCAGCGATGCGTTATTGTGTGTCAG
GAAATTCCTTGGTGAGGTTGCTATTTGGGAAATCAATACGAATCGGTGATATCGTTACTGGAGCTCAGTTCAATTCGGAC
AATCCGATCGACTTGAAGGTTCTTGATCGGCATGGTAATCCGGTTGTAGCCGATTATTTATTCCATTCAGGAGAGCACCA
AACCTATACAGTGCGCACCACTGAAGGCTATGAGATCACCGGGACGTCGAACCATCCCTTGTTGTGTTTAGTGAATGTCG
GCGGTATACCCACCTTGTTGTGGAAGCTGATTGGAGAAATTCGATCAGGAGACTACGTTGTTTTACAGCGGATCCCACCA
GTGGAATTTGGTCCGGCGGACTGGTATTCTACGATGGAAGCATTGTTATTCGGAGCCTTTATTAGTGGGGGCTTCGTTTT
TCAGGACCATGCTGGATTTAACAGCCTTGACCGTGACTATTTCACCATGGTTGTTAATGCTTATGATACGGTTGTGGGTG
GCCTGCGTTGCATATCTTCTCGAATCACCGTATCGGGGTCGACGCTACTCGAACTTGATGTTTATAACCTCATCGAGTTT
AAGAAGACAAGACTTAGCGGTTTATGCGGGCAACGGTCTGCGGACAAGTTGGTACCTGACTGGTTGTGGCACTCACCTTC
CACCGTCAAACGAGCATTCCTTCAGGCATTGTTTGAAGGTGAAGGATTTTCTTCGATATTGTCGCGAAATATAATTGAGA
TTTCCTACTCGACACTTAGTGAGCGACTGGCCGCCGACGTCCAGCAGATGCTGCTTGAATTCGGAGTCGTGTCTGAGCGC
TATTGCCATACTGTCAATGAGTACAAGGTTGTCATAGCTAACCGCGCTCAAGTAGAAATGTTTTTCACCCAAGTCGGTTT
CGGTGTTACTAAACAAGCTAAGCTTATCCGGGACGTGGTATCTATGTCTCCATGCGTTGGCATGGATATCAACTGCGTAC
CAGGTTTGGCCACTTTCATTCGTAAGCATTGTGATAACCGCTGGGTCGAGGAAGACTCATTTAATCAGCATAATGTTGAT
TGCGTCCAACATTGGCACCATCATAGCGCGGAAATCGTCGGCCACATCGCCGATCCCGATATTCGTGCCATCGTGACTGA
CCTTACTGATGGCCGGTTCTACTACGCGCGCGTCGCGTCCGTGACTGATACCGGTATTCAACCTGTGTTCAGTCTACATG
TGGACACCGAGGATCATTCGTTTTTGACTAATGGATTCATCAGCCATAACACCGAGGCTCGGCTTACTCCATTGGCGATG
GAAATGTTGCGCGAGATCGACGAGGAGACAGTTGATTTCATATCTAACTACGATGGCCGGGTGCAGGAACCGATGGTGTT
GCCTAGCCGTTTTCCCAACCTGTTGGCTAATGGTTCTGGCGGTATCGCGGTCGGCATGGCTACCAATATCCCGCCGCACA
ACCTGTATGAGCTCGCCGACGCTGTGTTTTGGTGCCTAGAGAACCATGACGCTGACGAAGAGACGATGCTGGTCGCTGTT
ATGGAACGGGTCAAAGGTCCTGATTTCCCTACCGCCGGGTTGATTGTCGGTTCGCAAGGCATTGCCGATGCTTACAAGAC
TGGCCGTGGTTCCATTCGGATACGCGGAGTTGTTGAGGTTGAAGAAGATTCACGCGGAAGGACGTCATTGGTCATCACTG
AGCTACCGTATCAGGTCAACCACGACAACTTCATCACTTCTATCGCTGAGCAAGTCCGCACTGGCCGGCTAGCCGGCATC
TCCAATGTAGAAGACCAAGGCAGCGACCGGGTTGGTGTACGTATCGTCATCGAGATCAAGCGTGACGCGGTGGCCAAAGT
GGTGCTCAATAACCTGTACAAGCATACTCAGCTGCAAACTAGTTTCGGAGCCAACATGTTGTCAATCGTTGACGGCGTGC
CGCGCACTTTGCGGTTGGATCAGATGATTTGTTATTATGTCGAACATCAACTGGACGTCATTGTCCGGCGCACTACCTAC
CGATTGCGTAAAGCCAACGAGCGGGCTCATATTTTGCGTGGATTGGTCAAAGCGCTCGATGCGTTAGATGAGGTTATTAC
GTTGATTCGGGCATCGCAGACCGTGGATATTGCTCGTGTTGGGGTGGTCGAGTTACTCGATATCGACGACATTCAGGCTC
AAGCTATCCTGGACATGCAGCTGCGGCGTTTGGCGGCTTTGGAGCGTCAACGCATTATTGATGATCTCGCTAAGATTGAG
GTCGAGATCGCTGATCTGGGAGATATTCTGGCTAAGCCGGAGCGTCGGCGTGGTATCATTCGTAATGAACTGACTGAGAT
CGCAGAGAAGTACGGTGATGACCGTCGTACTCGGATAATAGCGGTTGATGGTGATGTCAACGACGAGGATTTGATTGCTC
GTGAAGAGGTCGTTGTCACGATAACTGAAACTGGATATGCTAAACGTACTAAAACTGACCTGTATCGCAGCCAGAAACGC
GGCGGGAAAGGTGTTCAAGGCGCCGGTTTGAAGCAGGACGACATCGTCCGGCATTTCTTCGTGTGTTCAACTCACGATTG
GATCCTGTTTTTCACCACCCAAGGCCGCGTATACCGGGCCAAGGCCTATGAATTGCCAGAGGCTTCTCGAACGGCACGCG
GGCAACACGTGGCCAATTTGCTTGCATTCCAGCCTGAAGAGCGCATCGCTCAGGTAATTCAGATCCGTAGCTATGAAGAC
GCTCCATACTTGGTCCTTGCCACGCGCGCCGGTCTGGTTAAGAAGTCAAAGTTGACCGATTTTGACTCTAATCGTTCGGG
TGGGATCGTGGCAATTAATTTACGTGACAACGATGAGTTGGTCGGTGCAGTGTTGTGCGCGGCCGACGGCGACTTGCTTC
TGGTATCGGCTAACGGCCAGTCTATCCGGTTCTCAGCGACTGACGAGGCCTTGCGTCCGATGGGGCGGGCTACCTCTGGT
GTGCAGGGCATGCGGTTTAACGCCGATGATCGACTGTTGTCGTTGAATGTGGTTCGCGAAGATACTTACCTGCTTGTCGC
AACGTCTGGGGGTTACGCTAAACGCACCTCGATTGAGGAGTACCCGATGCAGGGCCGTGGCGGAAAGGGTGTTCTAACGG
TCATGTACGATCGTCGGCGCGGTAGCTTGGTTGGGGCCATCGTGGTTGATGAAGACAGCGAGTTGTACGCGATCACCTCA
GGGGGTGGGGTAATTCGTACAACGGCACGCCAGGTTCGCCAGGCAGGACGCCAGACCAAGGGTGTTCGGTTGATGAACTT
AGGTGAGGGCGACACGCTGTTAGCCATCGCACGTAATGCCGAAGAAAGCGCCGACGGCGGTGTCGGTTAA

>>MEG_3182|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGACGACGAGAAGCCCGACGAGCAGAACCAGGCCGACCGTCAAGGATTGGTGACCGGCCGTCACGTCGGAATCCA
GCCGGTCGAGATTCGTGACGAGATCCAGAACGCGTACCTCGACTACGCGATGAGCGTCATCGTCGGGCGTGCCCTGCCCG
ATGTGCGCGACGGCCTCAAACCGGTACACCGTCGGGTCATCTACGCGATGTACGACGGCGGTTACCGCCCCGACCGTGGC
TGGAATAAGTGTTCCCGCGTCGTCGGTGACGTCATGGGTAAGTACCACCCTCACGGCGACTCGGCCATTTACGACACCTT
GGTGCGTCTGGCTCAGCCATGGGCTATGCGATACAAGCTTGTCCAGGGTCAGGGTAACTTCGGGTCCCAGGGCAACGATG
GTGCGGCTGCCATGCGATATACCGAGTGCAAGATGGCGCCGCTGGCCATGGAGATGGTGCGCGACATCGACCAGGACACT
GTCGATTTCCAGCCCAATTATGACAACAAGGAGACCGAACCGGTCGTCTTGCCGTCGAGGTTCCCCAACCTGCTTGTCAA
TGGTTCTTCAGGTATCGCGGTGGGCATGGCCACCAACATCCCGACCCATAATCTGCGCGAGGTCAACGAGGCCGTGCAGT
GGTCTTTGGCTCATCCCAATGCTTCCCACGAGGAACTGCTCGAGGCGTGCATGGAGCGCATTAAGGGTCCGGATTTCCCC
GGCGGCGCCCTCATCGTGGGTCGGCAGGGCATCGAGGACGCCTACCGCACCGGCCGCGGTTCGGTGACGATGCGTGCCGT
CATCGACATGGAAGAGGACAAGAAGGGACGCCAGTGCCTGGTCGTCACCGAGTTGCCTTATATGTGCAACCCGGACAACC
TCGCCACCAAGATCGCCGACCTGGTGAACTCCGGTCGCATCAACGGTATCGCCGACATCCGTGACGACTCCTCAGCCCGT
ACTGGTCAGCGTTTAGTCATCGTCCTCAAGCGTGACGCTCAGCCGCGTGTCGTCATGAACAACCTGTACAAGCACACGGC
TTTGCAGGACACCTTCGGCTGCAACATGCTGGCTCTGGTGGACAACGTGCCGCGCACTTTGCGTCTGGACCAATTCATCA
GCTACTGGATTGACCACCAGATGGAGGTCATCCGCAGGCGTACCGAGTACCGCCTGGCTCAGGCCGAAAAAGACGCCCAT
ATCCAGCGGGCTCTCGTTAAAGCCCTCGATATGCTCGACGAGGTCATCGCGCTCATCCGTCGCTCCCCGAACACTGAGGC
CGCCAGCACCGGCCTACAGGAACTGCTCGATATCGACGAGATTCAGGCTCGCGCCATCCTCGATATGCAGTTGCGTCGTC
TGGCTGCCCTGGAGCGTCAAAAGATCATCGACCGACTTGAGGAACTCGAGCGCCTCATCGCTGATTACAAAGCAATTCTG
GCTAGCGAGGACCGCCAGCGCGAGATCATCTCTACCGAGCTTGCCGAGATCGTCGATAAGTACGGTGACGAGCGTCGCAC
CCGCATTATCGCCGCCGATGGGGACTTTTCTGAGGAAGACTTCATCCCCGACGATGACGTCGTCGTCACCATTACCCGGG
GCGGCTACGCCAAGCGCACCCGCACTGACCTGTACCGGGTCCAGAAACGCGGTGGCAAGGGTGTTCGCGGCGCCAGCCTG
CGCACTGACGATGAGGTGGCACAGCTATTCACTACCACGAACCACCAGTGGATCCTCTTCTTCACGAATATGGGTCGGGT
CTATCGCACCAAGGTATGGCAGCTGCCGGAGGCTGGTCGTGACGCCAGGGGGGGTCACGTCGCTGGGTTGCTGAGCTTCC
TGCCTGACGAGAAGATCGCCCAAGTCATGACCCTACGGTCCTACGACGACGCCGAGTACCTCCTCCTGGCCACTCGCAAG
GGTATGGTCAAGAAGACGGCGCTCAAGGCTTATGACTCGTCTCGTCAGGCCGGCGTTATTGCCGTTAATTTCCGTACCGA
GGACGATGAGCTTATCGGCGCCGAGCAGTGCTCCGCCGCTGACGACGTGCTGCTTATCAGCCGTAAGGGGCAGGCGATCC
GGTTCTCTGCCGGCGACGACCAGTTGCGCCCGATGGGGCGTGCGACTTCGGGCGTTACCGGCATGAAGTTCCGTGGTGAT
GACGAGTTGCTGTCAATGTCGATTATTCACTCCGACATGCCTGAGGATGATCGGTTCGTTTTCACAGCAACCGGTGGCGG
CTACGCCAAGCGCACTGCTGTGTCGGAGTACCGTCAGCAGAGGCGTGGGGGAGTCGGCATCAAAGCGATGGCCCTCAGTG
AGGAGCGCGGCTCCCTGGTTGGTGGCCTGGTGGTCAGCGAGGCTGACGAAATCATCGCGATTAAGACGTCAGGTCAGATC
ACCCGATCGGCCGTGTCTGAGGTGCCCGCCAAGGGACGCTCCACGATGGGGGTGAAGTTCGTCTCCGTACGCGGTGACGA
CGCTGTCTCAATCATCGCTGTCAACCCCGAACATACCGTCGAGGAGGAAGTCGCTGACGAATCGGTGGAAACTGTTGAAG
GCGATGCCACGAAGGCCCAATCGGGAGATGTGGTTCGGCGAAGCGATACTGTGGATGACGACCGTGCCGTCGATACGGCG
GGAAACGACATGAAGCCGGAGGACAACGGTGAGTGA

>>MEG_3183|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TCAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTATTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACGGTTTCGCAAACGGGTTATGCAAAAACTCAACCTCTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAGCAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACTTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAGGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGCGGTATGCGCGTGAGTTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAACAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGTGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3184|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACGGATTCAATCCATTCCTCTATTACCCCAGTCAATATTGAAGAAGAACTAAAATCTTCTTACCTTGACTACGCCAT
GTCGGTGATTGTTGGGCGTGCTTTGCCTGATGTGCGTGACGGTTTAAAACCGGTGCATCGACGTGTGCTTTTCTCCATGG
ATCAATCTGGCATCACTGCCGGCAAAAAATACGTAAAATCTGCCCGTGTGGTAGGTGATGTAATCGGTAAATATCACCCG
CACGGTGATTCTGCAGTGTACGACACCATTGTGCGTATGGCACAGCCGTTCTCATTGCGCTACATGTTGGTAGATGGGCA
AGGTAACTTCGGTTCAATCGACGGTGATGCGCCAGCGGCAATGCGTTATACCGAAGTCCGTATGCAAAAAATCACCCAAG
CGTTATTAACTGACTTGGATAAAGAAACCGTAAATTTCTCGCCAAACTATGATGGCGAATTAATGATTCCGGATGTATTA
CCAACTCGTATTCCTGCACTTTTAGCAAACGGTTCTTCCGGTATTGCGGTGGGGATGGCAACCAACATTCCACCACACAA
CTTAAATGAAGTTTTAGATGGATGCTTGGCTTATATTGATAACGAAAACATCACCATTGATGAGTTAATGCAATATATCC
CGGGCCCAGACTTCCCAACAGCGGCATTAATTAATGGCCGTAAAGGGATTGAAGAAGCTTATCGCACTGGTCGCGGCAAA
GTGTATGTTCGCGCTCGCGCTAGCGTAGAAACCACAGATAAAGGCAAAGAGCAAATTATTGTGACCGAATTGCCTTATCA
AGTGAACAAAGCCAAATTAGTGGAAAAAATTGCTGAGCTTATCAAAGATAAAAAAATCGAAGGCATCAGCAATATTATCG
ACCTTTCGAACAAAGAAGGGATTCGCATTGAAATTGACATCAAACGTGATGCCGTAGGCGAAGTAGTATTAAATCACCTC
TATGCGCTTACCCAAATGCAGGTAACCTTCGGGATTAACATGGTGGCCTTGGATCACGGTCAACCACGTTTATTCAACTT
AAAACAAATCATTGAAGCCTTTGTGATGCACCGTCGCGAAGTGGTGATTCGCCGTTCTTTATTTGAATTGCGTAAAGCCC
GCGAGCGTACCCATATTTTAGAAGGTTTAGCGGTTGCAACATCAAATATCGATGAAATCATCGATATCATCCGTCAATCG
AAAGAGCGTAAAGAAGCGGCAGAAAAATTAATCTCTCGCCCTTGGAAATTGAATAACGAAATTTTAGGTTTACTTGATGC
AGCGGCACGTCCAGCTGAGTTAGCGGCTGAATTTGGTATTAAAGGTTCGGATTACTATCTTTCTCCAGAACAAGTTGATG
CAATCTTAGAACTTCGCTTGCATCGTTTAACCGGTCTTGCTACCGAAGAAGTAATCAATGAATACAAAGAGTTATTGGTT
AAAATTGCAGAACTTCTCCACATCATCAACAGCCCTGAGCGTTTGATGGAAGTGATTCGTGAAGAGCTTGAACAAGTACG
CGCACAATTCGCGGATGAACGTCGTACCGAAATTACTGCGGCTTCTGGTGATATTGATTTAGAAGATTTAATTGCTCAAG
AAGATGTGGTAGTGACCCTTTCTCACGAAGGTTATGTGAAATATCAACCGCTTACCGACTACGAAGCACAACGTCGTGGT
GGTAAAGGTAAATCCGCAACGAAGATGAAAGATGAAGACTTCATTGAAAAACTCTTAGTAGCGAATACTCACGATACGAT
TCTCTGTTTCTCTAGCCGCGGTCGCTTATATTGGTTGAAAGTCTATCAATTACCACAAGCAAGCCGTGGTGCGCGTGGTC
GTCCGATTGTGAATATTCTACCGTTGCAAGAAAACGAGCGTATCACCGCAATCTTGCCAATCTCTGCTTATGAAGAAGAT
AAATTCGTCATCATGGCAACGGCTGGTGGTATTGTGAAGAAAATTGCGCTAACCGAATTCAGCCGTCCACGTTCAAGCGG
TATCATCGCCTTGAACTTACGTGATGAAGATGAATTAATCGGCGTGGATATCACCGATGGTTCTAACGAAATCATGTTGT
TCTCTTCGCAAGGTCGCGTAGTACGTTTCGCTGAAAGTGCAGTGCGTGCAATGGGTCGTTTAGCAACAGGTGTACGCGGT
ATTAAACTCGCCCTAACCAACGACATCGCTGACGATGAAAGTGCGGTCGAAATTGAAGAGGTTTCCGATGATAATGCAGA
AGAAACCCTCGATCTCAATATCGATAAAGTGGTTTCCTTAGTTGTGCCGAAAAATGACGGCGCAATCCTTACGGCGACGC
AAAACGGTTACGGTAAACGCACACAATTAAGCGAATACCCAACCAAATCCCGTAATACCAAAGGGGTGATTTCGATTAAA
GTGAGCGAACGTAACGGTAAAGTCGTTGCGGCGACACAAGTGGAAGAAACCGACCAAATTATGCTTATCACTGATGCGGG
TACCTTAGTGCGTACTCGTGTAAGTGAAGTGAGCATCGTTGGCCGTAACACCCAAGGGGTTCGTTTAATTCGTACCGCAG
AAGATGAGCACGTAGTCAGTCTTGAACGTGTTTGTGATGTGGATGATGAAGACGAAGGCACTGAAGATGTGACTTCTGAA
GAATAA

>>MEG_3185|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCAAAGCAACAAGATCAAGTAGATAAGATTCGTGAAAACTTAGACAATTCAACTGTCAAAAGTATTTCATTAGCAAA
TGAACTTGAGCGTTCATTCATGGAATATGCTATGTCAGTTATTGTTGCTCGTGCTTTACCTGATGCTAGAGATGGACTTA
AACCAGTTCATCGTCGTGTTCTTTATGGTGCTTATATTGGTGGCATGCACCATGATCGTCCTTTTAAAAAGTCTGCGAGG
ATTGTTGGTGATGTAATGAGTAAATTCCACCCTCATGGTGATATGGCAATATATGACACCATGTCAAGAATGGCTCAAGA
CTTTTCATTAAGATACCTTTTAATTGATGGTCATGGTAATTTTGGTTCTATAGATGGTGATAGACCTGCTGCACAACGTT
ATACAGAAGCAAGATTATCTAAACTTGCAGCAGAACTTTTAAAAGATATTGATAAAGATACAGTTGACTTTATTGCTAAT
TATGATGGTGAGGAAAAAGAACCAACTGTTCTACCAGCAGCTTTCCCTAACTTACTTGCAAATGGTTCTAGTGGGATTGC
AGTTGGAATGTCAACATCTATTCCTTCCCATAATCTCTCTGAATTAATTGCGGGTTTAATCATGTTAATTGATAATCCTC
AATGCACTTTTCAAGAATTATTAACTGTAATTAAAGGACCTGATTTTCCAACAGGAGCTAACATTATCTACACAAAAGGA
ATTGAAAGCTACTTTGAAACAGGTAAAGGCAATGTAGTAATTCGTTCTAAAGTTGAGATAGAACAATTGCAAACAAGAAG
TGCATTAGTTGTAACTGAAATTCCTTACATGGTTAACAAAACTACCTTAATTGAAAAGATTGTAGAACTTGTTAAAGCTG
AAGAGATTTCAGGAATTGCTGATATCCGTGATGAATCCTCTCGAGAAGGAATAAGGTTAGTGATTGAAGTAAAACGCGAC
ACTGTACCTGAAGTTTTATTAAATCAACTTTTTAAATCAACAAGATTACAAGTACGCTTCCCTGTTAATATGCTTGCTTT
AGTTAAAGGAGCTCCTGTACTTCTCAACATGAAACAAGCTTTGGAAGTATATCTTGATCATCAAATTGATGTTCTTGTTA
GAAAAACAAAGTTTGTGCTTAATAAACAACAAGAACGTTATCACATTTTAAGCGGACTTTTAATTGCTGCTTTAAATATT
GATGAGGTTGTTGCAATTATTAAAAAATCAGCAAATAACCAGGAAGCAATTAATACATTAAATACAAAGTTTAAGCTTGA
TGAAATTCAAGCTAAAGCAGTTCTTGACATGCGTTTAAGGAGCTTAAGCGTACTTGAAGTTAACAAACTTCAAACTGAAC
AAAAAGAGTTAAAAGATTCAATTGAATTTTGTAAGAAAGTGTTAGCTGATCAAAAATTACAGCTAAAAATAATCAAAGAG
GAATTGCAAAAAATCAATGATCAGTTTGGTGATGAAAGAAGAAGTGAAATTCTCTATGATATCTCTGAGGAAATTGATGA
TGAATCATTGATAAAAGTTGAGAATGTAGTGATAACTATGTCTACAAATGGTTATCTAAAAAGGATTGGAGTTGATGCTT
ATAATCTTCAACATCGTGGTGGAGTTGGGGTTAAAGGGCTAACTACTTATGTTGATGATAGTATTAGTCAATTATTGGTC
TGTTCAACTCACTCTGACTTATTATTTTTTACTGATAAGGGTAAGGTTTATAGAATTAGAGCTCATCAAATTCCCTATGG
TTTTAGAACAAATAAAGGTATTCCCGCTGTTAACTTAATCAAAATTGAAAAGGATGAAAGAATTTGTTCATTGTTATCTG
TTAATAACTATGATGATGGTTATTTCTTTTTCTGTACTAAAAATGGAATTGTTAAAAGAACGAGCTTGAATGAATTCATC
AACATCTTAAGTAATGGTAAGCGGGCTATATCTTTTGATGATAATGACACTTTGTATTCAGTAATTAAAACCCACGGAAA
TGATGAGATTTTTATTGGTTCTACCAATGGATTTGTTGTTCGCTTCCATGAAAATCAACTCAGAGTTCTTTCAAGAACAG
CAAGAGGTGTATTTGGTATCAGTTTAAATAAAGGAGAATTTGTTAATGGACTATCAACTTCAAGCAACGGTAGCTTACTT
TTATCAGTCGGTCAAAATGGAATAGGTAAATTAACGAGCATAGATAAATATAGACTCACAAAACGTAATGCTAAGGGAGT
TAAAACTCTAAGGGTTACTGATAGAACAGGCCCTGTTGTTACAACAACCACTGTTTTTGGTAATGAGGATCTTTTAATGA
TTTCCTCTGCTGGTAAAATTGTGCGTACCAGTTTACAAGAACTTTCAGAACAAGGTAAAAACACTTCTGGTGTTAAGTTA
ATTAGATTAAAAGATAATGAACGTTTAGAAAGAGTAACTATCTTTAAAGAAGAGTTAGAAGACAAAGAAATGCAACTAGA
AGATGTTGGATCCAAACAAATTACGCAATAA

>>MEG_3186|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATCTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCACGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTGATCAATGGTGTACTTAGCTTAAGTAAGAATCCTGATATTTCAATTGCTGAGTTAATGGAAGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGCGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTTGTTCGTGACAAGAAAATTGACGGTATTACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCCAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCTCTAGTGAATGGTAGACCGAAGCTGATTAA
TTTAAAAGAAGCGTTAGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGGTTACGTATTGCGTTAGATCATATCGATGAAATTATTTCAACGATTCGTGAA
TCAGAAACAGATAAAGTCGCAATGGAAAGTTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGCTTC
GGTGATGATCGTCGTACTGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAGGACTTAATTCCAGAAGAACAAAT
TGTAATTACTTTGAGCCATAATAACTATATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTAAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAATCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGATAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGCGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAGGATGCAGACGAAGAAAATGAAGATGAACAATCTACTGTATCTGA
AGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAGTGATTGATT
CAGAAGTAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGACCGTGTTGAAGAAGACATACAACAATCA
TCAGATGATGATGAAGAATAA

>>MEG_3187|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCGGTCTATGACACGATCGTCCGCATGGCGCAGCCATTCTCGCTGCGTTATATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCTATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCGGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGCGTATATTGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTG
TATATCCGCGCTCGCGCAGAAGTGGAAGTTGACGCCAAAACCGGTCGTGAAACCATTATCGTCCACGAAATTCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTTGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCGATGCTCGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGTCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGTTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGTGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAGTATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGCGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACTCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTATCAGTTGCCGGAAGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTGCCGCTGGAGCAGGACGAACGTATCACTGCGATCCTGCCAGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACCGTGAAGAAAACTGTCCTCACCGAGTTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGACGGCGATGAGCTGATCGGCGTTGACCTGACCAGCGGCGAAGACGAAG
TAATGCTGTTCTCCGCTGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAACACCACCGGT
GTTCGCGGTATTCGCTTAGGTGAAGGCGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAAAACGGTTACGGTAAACGTACCGCAGTGGCGGAATACCCAACCAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCGGAAATCAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAACGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>>MEG_3188|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACACAGTTCGCCAAGGAAACGCTGCCGATCAGCCTCGAGGAGGAAATGCGCCACTCCTACCTGGATTACGCCATGAG
CGTGATCGTGGGGCGGGCGCTGCCCGATGCGCGCGACGGCCTGAAGCCGGTGCACCGCCGGGTGCTGTACGCGATGCACG
AGCTTTCCAACGACTGGAACCGCGCCTACAAGAAGTCGGCGCGTATCGTCGGCGACGTCATCGGTAAGTACCACCCGCAT
GGCGACTCGGCGGTGTACGACACCATCGTGCGCATGGCGCAGGATTTCTCGCTGCGCTACATGCTGGTCGACGGCCAGGG
CAACTTCGGCTCGGTCGACGGCGACAACGCCGCGGCGATGCGTTACACCGAAATCCGCATGGCGCGCATCGGTCACGAAC
TGCTGGCCGACATCGACAAGGAAACGGTGGATTTCGGGCCGAACTACGACGGCTCGGAAAAAGAGCCGCTGATCCTGCCG
GCCCGCATCCCCAATCTGCTGATCAACGGTTCCTCCGGTATCGCGGTCGGCATGGCGACCAACATCCCGCCGCACAACCT
GGGCGAAGTGGTCGATGCCTGTCTCAAGCTGCTCGAAGATCCGGAAACCGACCTCGAAGCGCTGATCGAAATCGTCAAGG
CGCCCGACTTCCCCACCGCGGGTCTGATCTACGGCCTGCACGGCGTGCACGAAGGCTATCGCACCGGCCGCGGCCGGGTG
GTGATGCGCGCCCGCACCCATATCGAGCCGATCGGCAAGAACAGCGACCGCGAAGCCATCATCGTCGACGAGCTGCCCTA
CCAGGTGAACAAGCGCACCCTGCTGGAGCGCATCGCCGAGCTGGTCAACGAAAAGAAGGTCGAGGGCATCAGCGAGATCC
GCGACGAGTCGGACAAGTCCGGCATGCGCGTGGTGATCGAACTGAAGCGCAACGAAATGCCCGAGGTGGTGCTCAACAAC
CTGTACAAGCACACCCAGCTGCAGGACACCTTCGGCATGAACATGGTGGCGCTGGTGGACGGCAAGCCCCGCCTGCTCAA
CCTCAAGCAGATGCTGGTGTGCTTCCTCGAGCACCGCCGCGAGGTCGTCACCCGCCGCACCATCTTCGAACTGAAGAAGG
CGCGCGACCGCGGCCACATCCTCGAAGGCCTGGCGGTGGCGCTGTCCAACGTGGACGAGATCATCGCCCTGATCAAGGCC
GCGCCGACGCCGGCGGATGCCAAGCGCGGCCTGATGGAACGCACGTGGCGCTCGCCGCTGGTGGAAGAAATGCTGTCGCG
CGCGCTCGCCGACAGCTACCGCCCGGAAGGGCTGGACCCCGAGTTCGGCTTCTCGGCCCAGGGTTACAAGCTGTCCGACG
CCCAGGCCCAGGCCATCCTGGAACTGCGCCTGCAGCGCCTGACCGGCCTCGAACAGGACAAGATCGTCGGCGAGTACCGC
GAGGTGATGGATCTCATCACCGACCTGCTCGACATCCTGGCCCGTCCCGAGCGCATCACCGCGATCATCGTCGAGGAGCT
GACCGCGATCCGCAACCAGTTCGGCGACCCGCGCCGTTCCGAGATCGTGCTCAGCACCGCCGAGATCAACATCGAGGACC
TGATCACGCCGGAAGACATGGTGGTGACGCTGTCGCACACCGGTTACTTCAAGCGCCAGCCGCTCGCCGACTACCGCGCC
CAGCGTCGCGGCGGCCGCGGCAAGCAGGCCACCTCGATGAAGGACGAGGACTTCATCGACCACCTCTTCGTCGCCAATAC
CCACGACACCGTGCTGTGCTTCTCCAGCCGCGGCCGCGCCTACTGGCTGAAGGTGTACGAGGTGCCCGAAGGCACCCGCA
ACTCGCGCGGCAAGCCGATCGTGAACCTGTTCCCGTTGATCGAGGGCGAGAAGATCACCGCGGTGCTGCCGGTGCAGACC
TTCGATGAAGAGCATTTCGTGTTCATGGCGACTTCGGAAGGCACGGTCAAGAAGACTGCGCTCACCGCTTTCGCCAACCC
GCGCAAGGCCGGCATCATCGCGGTCAACCTCGATGACGGCGACCACCTGATCGGCGTCGCGATCACCGACGGTGAGTGCG
ACGTGATGCTGTTCTCCGACGCCGGCAAGGCCGTGCGCTTTGCCGAGAGCGACGTGCGCCCGATGGGCCGCGAAGCGCGC
GGCGTGCGCGGCATGACGCTGGAAGACGGCCAGCGCGTGATCGCGATGCTGGTCGCCAAGGGCGAAACCCAGTCGGTGTT
GACGGCTACCGAAAACGGTTATGGCAAGCGCACCCCGGTGGCGGAATACACCCGCCACGGCCGCGGCACCAAGGGCATGA
TCGCGATCCAGACCTCGGACCGCAACGGCAAGCTGGTCGGCGCGGTGCTGGTCGATCCGACCGACGAGGTGATGCTGATC
TCCACCGGTGCGGTGCTGATCCGCACCAAGGTGCAGGACATCCGCGAGCTTGGCCGCGCCACCCAGGGCGTGACGCTGAT
CAACCTCGATGAGGGCACGTACCTGGCCGGGATCGAGAAGGTGGCCGAGTCCGGCGCCGAGGCGGACGAACTGGTGGAAG
GTGGCGAAGAGGGCGCCGCGGACGGCGAGGATGCCGGCGCGCCGGGCGCCGCGGGTGAAGGAGAACAGGAATGA

>>MEG_3189|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTTAAGAACTCTTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCAGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCACCCGCAC
GGCGACTACGCGGTATACGACACCATCGTGCGTATGGCGCAGCCGTTCTCGCTGCGTTACATGCTGGTGGACGGCCAGGG
TAACTTTGGTTCCATCGACGGCGACTCCGCCGCGGCGATGCGTTATACCGAAATTCGTCTGGCGAAAATCGCTCATGAGC
TGATGGCCGATCTTGAAAAAGAGACGGTCGATTTCGTCGACAACTATGACGGTACGGAGCGTATTCCGGACGTCATGCCG
ACCAAAATTCCTAACCTGCTGGTGAACGGCGCCTCCGGGATCGCCGTAGGGATGGCCACCAACATACCGCCACATAACCT
GACGGAAGTGATTAACGGCTGTCTGGCGTATGTTGACGATGAAGACATCAGCATTGAAGGGCTGATGGCGCATATTCCTG
GCCCTGATTTCCCGACCGCCGCCATTATCAATGGCCGTCGCGGCATCGAAGAGGCCTATCGCACCGGTCGCGGTAAAGTG
TACATTCGCGCGCGCGCGGAAGTGGAAGTGGACGCGAAATCCGGCCGCGAAACCATCATCGTGCACGAAATTCCGTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTCAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGATAAAGACGGGATGCGCATCGTGATTGAAGTGAAGCGCGATGCGGTAGGGGAAGTGGTGCTTAACAACCTC
TATTCCCAGACCCAGCTGCAGGTCTCCTTCGGCATCAACATGGTAGCTCTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAGGACATCATCGCCGCGTTTGTACGCCACCGCCGTGAAGTGGTGACCCGTCGTACGATTTTCGAACTGCGCAAAGCGC
GCGACCGGGCGCATATCCTCGAAGCGCTGGCCGTTGCGCTGGCCAACATCGACCCGATTATCGAACTGATCCGTCGCGCG
CCGACCCCGGCAGAAGCGAAAACGGCGCTGGTTGCCCAGGCGTGGGATCTCGGTAACGTTGCGGCGATGCTGGAGCGCGC
CGGGGATGACGCCGCGCGTCCGGAATGGCTGGAACCAGAGTTCGGCGTGCGCGACGGTAAATACTACCTGACCGAGCAGC
AGGCTCAGGCGATTCTGGATCTGCGTCTGCAGAAACTGACCGGCCTTGAGCATGAAAAACTGCTCGACGAATATAAAGAG
CTGCTGGAGCAGATCGCAGAGCTGCTGCACATTCTCGGCAGCGCCGACCGTCTGATGGAAGTGATTCGCGAAGAGCTGGA
GCTGATCCGCGACCAGTTCGGCGACGAACGTCGTACCGAAATCACCGCCAACAGCGCTGATATTAACATCGAAGATCTGA
TCAACCAGGAAGATGTGGTGGTCACCCTGTCGCATCAGGGGTATGTGAAGTATCAGCCGCTGACCGACTACGAAGCACAG
CGTCGTGGCGGTAAAGGCAAATCGGCAGCGCGCATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCTAACACCCA
TGACACCATCCTCTGCTTCTCAAGCCGCGGCCGTCTGTACTGGATGAAGGTCTATCAGCTGCCGGAAGCCAGCCGCGGCG
CGCGCGGTCGGCCGATCGTCAACCTGCTGCCGCTGGAAGCCGATGAGCGCATTACCGCCATCCTGCCGGTCCGCGAGTAC
GAAGAGGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACCGCGCTGACCGAGTTCAGCCGTCCGCG
TTCCGCCGGTATCATCGCGGTCAACCTGAACGAAGGCGATGAGCTGATCGGCGTCGATCTGACCTCTGGTCAGGATGAAG
TGATGCTGTTCTCCGCGGCCGGTAAGGTTGTACGCTTCAAAGAAGACGCCGTTCGCGCCATGGGCCGTACCGCCACCGGC
GTACGCGGTATTAAGCTTGCGGAAAACGACAGCGTCGTCTCGCTGATTATTCCACGCGGCGAAGGCGCGATCCTGACGGT
GACGCAAAACGGTTACGGTAAACGTACCGCGGCGGCGGAGTATCCGACCAAGTCGCGTGCCACCCAGGGCGTTATTTCGA
TCAAAGTCACCGAGCGTAACGGTTCCGTGGTCGGCGCCGTGCAGGTGGATGACTGCGATCAGATCATGATGATCACCGAC
GCCGGGACGCTGGTGCGTACCCGCGTTTCCGAAGTGAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGCAC
CGCGGAAGATGAAAACGTGGTAGGTCTGCAGCGCGTGGCTGAGCCGGTGGATGATGAAGAGCTGGATGCCATCGACGGTA
GCGCGGCAGAAGGCGATGATGATATCGCCCCGGAAGCGGATACCGATGACGACATCGCCGAAGACGAAGAATAA

>>MEG_3190|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAGAATATTTTTAGCAAAGATTCTGATATTGAACTTGTAGATATAGAAAATTCTATAAAAAGTAGTTATTTAGACTA
TTCTATGAGTGTTATTATAGGTCGTGCTTTGCCTGATGCAAGAGATGGTTTAAAGCCTGTTCATAGAAGAATTTTATATG
CTATGCAAAATGATGAGGCAAAAAGTAGAACAGATTTTGTCAAATCAGCCCGTATAGTGGGTGCTGTTATAGGTCGTTAT
CACCCGCATGGAGATACAGCAGTTTATGATGCTTTAGTTAGAATGGCTCAAGATTTTTCTATGAGATATCCAAGTATTAC
AGGACAAGGTAACTTTGGATCTATAGATGGCGATAGTGCTGCTGCGATGCGTTATACTGAAGCAAAAATGAGTAAACTTT
CTCATGAGCTTTTAAAAGATATAGATAAAGATACGGTCGATTTTGTTCCAAATTATGATGGTTCAGAAAGTGAACCTGAT
GTTTTACCTTCTAGGGTTCCAAATTTATTATTAAATGGTTCAAGTGGTATAGCTGTAGGTATGGCGACAAATATCCCACC
TCATAGTTTAAATGAGTTGATAGATGGACTTTTATATTTGCTTGATAATAAAGATGTAAGCTTAGAAGAGATTATGCAGT
TTATCAAAGGTCCAGATTTTCCAACAGGTGGAATAATTTATGGTAAAAAAGGCATTATAGAAGCTTATCGCACAGGGCGT
GGTCGTGTGAAAGTGCGCGCTAAAACTCATATTGAAAAAAAGACAAATAAAGATGTTATTGTTATAGATGAGCTTCCTTA
TCAAACCAATAAAGCTAGGCTTATAGAGCAGATTGCAGAGCTTGTTAAAGAAAAGCAAATTGAAGGAATATCTGAAGTAA
GAGATGAGAGCAATAAAGAAGGAATCCGTGTTGTTATAGAGCTTAAACGTGAGGCTATGAGTGAAATTGTTTTAAATAAT
CTATTTAAATCTACCACTATGGAAAGTACTTTTGGTGTGATTATGTTAGCAATTCACAATAAAGAACCTAAAATTTTCTC
TTTGCTAGAACTTTTAAATCTTTTCTTAACCCATAGAAAAACAGTTATTATTAGAAGAACGATTTTTGAACTTCAAAAGG
CAAGAGTAAGAGCTCATATTTTAGAAGGTCTTAAAATTGCACTTGATAATATAGATGAAGTGATTGCTTTAATTAAAAAT
AGTTCCGACAATAATACCGCAAGAGATTCTTTGGTAGCTAAATTTGGTCTTAGTGAACTTCAAGCGAATGCTATTTTAGA
TATGAAACTGGGTCGTTTAACAGGACTTGAAAGAGAAAAAATTGAAAATGAACTTGCAGAATTAATGAAAGAAATTGCAA
GACTTGAAGAAATTTTAAAAAGTGAAACTTTGCTTGAAAATTTAATTCGCGATGAATTAAAAGAAATTAGAAGCAAATTT
GATGTACCACGTATTACTCAAATTGAAGATGATTATGATGATATTGATATTGAAGATTTGATTCCTAATGAAAATATGGT
TGTAACTATCACGCATCGTGGTTATATTAAGCGTGTGCCTAGTAAACAATATGAAAAGCAAAAACGAGGCGGAAAAGGAA
AATTAGCCGTTACGACTTATGATGATGATTTTATAGAAAGTTTCTTTACGGCAAATACACATGATACGCTTATGTTTGTA
ACAGATCGTGGACAGCTTTATTGGCTTAAAGTTTATAAAATTCCTGAAGGCTCAAGAACGGCTAAAGGAAAAGCAGTGGT
AAATCTTATCAATTTACAAGCTGAAGAAAAAATCATGGCTATTATTCCAACCACGGATTTTGACGAGAGTAAATCTTTAT
GTTTCTTTACTAAAAATGGTATTGTAAAGCGTACAAATTTGAGTGAATATCAAAATATCAGAAGTATTGGAGTTAGAGCG
ATCAACTTAAATGAAAATGATGAGTTGGTAACTGCTATTATTGTTCAAAGAGATGAAGATGAAATTTTTGCCAGTGGTGG
TGAAGAAAATTTAGAAAATCAAGAAATTGAAAATTTAGATGATGAAAATCTTGAAAATGAAGAAAGTGCAAGTACACAAG
GTAAAATGCTCTTTGCAGTAACCAAAAAAGGTATGTGTATCAAATTCCCGCTTGTTAAAGTGCGTGAAATCGGCCGTGTA
AGTCGTGGGGTGACAGCTATTAAGTTTAAAGAGAAAAATGACGAATTAGTAGGTGCAGTTGTTATAGAAAATGATGAGCA
AGAAATTTTAAGCGTAAGTGCAAAAGGTATAGGAAAACGCACCAATGCTGGAGAATATAGATTGCAAAGTAGAGGTGGTA
AGGGTGTAATTTGCATGAAGCTTACAGAAAAAACTAAAGATCTTATTAGTGTAGTTATAGTAGATGAAACTATGGATTTG
ATGGCTCTTACAAGTTCAGGCAAGATGATACGTGTTGATATGCAAAGCATTAGAAAAGCAGGGCGTAATACGAGTGGCGT
CATCGTGGTTAATGTGGAAAATGACGAGGTGGTTAGCATCGCTAAGTGTCCTAAAGAGGAAAATGATGAGGATGAGTTAA
GCGATGAAAACTTTGGTTTAGATTTGTAA

>>MEG_3191|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGAAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>>MEG_3192|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTATTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCATTTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACGGTTTCGCAAACGGGTTATGCAAAAACTCAACCTCTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAGCAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACTTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAGGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGCGGTATGCGCGTGAGTTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAACAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGTGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3193|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCAATGAGTGTAAT
CGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCTTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TCAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGCGATAGCGCCGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGGTAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACCGGTCCTG
ATTTCCCTACAAGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CTCCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTCAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCAGAAGAGCAAGTGGTATTAACTGTTTCACAAACAGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCAAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGTCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCTGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTGCCTGAGACAGGTG
AAGTACTGTGTGCGAGTGCCAACGGCTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTTGTTGGCGTAGTTTCAATTGAAACTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3194|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACCGACGCAACCATCCGCCACGACCACAAATTCGCCCTCGAAACCCTGCCCGTCAGCCTTGAAGACGAAATGCGCAA
AAGCTATCTCGACTACGCCATGAGCGTCATTGTCGGGCGCGCGCTGCCGGACGTTCGCGACGGCCTAAAGCCGGTGCACC
GGCGCGTACTGTACGCGATGCACGAGCTGAAAAATAACTGGAATGCCGCCTACAAAAAATCGGCGCGCATCGTCGGCGAC
GTCATCGGTAAATACCACCCCCACGGCGATTTCGCAGTTTACGGCACCATCGTCCGTATGGCGCAAAATTTCGCTATGCG
TTATGTGCTGATAGACGGACAGGGCAACTTCGGATCGGTGGACGGGCTTGCCGCCGCAGCCATGCGCTATACCGAAATCC
GCATGGCGAAAATCTCACATGAAATGCTGGCAGACATTGAGGAAGAAACCGTTAATTTCGGCCCGAACTACGACGGTAGC
GAACACGAGCCGCTTGTACTGCCGACCCGTTTCCCCACACTGCTCGTCAACGGCTCGTCCGGTATCGCCGTCGGTATGGC
GACCAACATCCCGCCGCACAACCTCACCGACACCATCAACGCCTGTCTGCGTCTTTTGGACGAACCCAAAACCGAAATCG
ACGAACTGATCGACATTATCCAAGCCCCCGACTTCCCGACCGGGGCAACCATCTACGGCTTGGGCGGCGTGCGCGAAGGC
TATAAAACAGGCCGCGGCCGCGTCGTTATGCGCGGTAAGACCCATATCGAACCCATAGGCAAAAACGGCGAACGCGAAGC
CATCGTTATCGACGAAATCCCCTATCAGGTCAACAAAGCCAAGTTGGTCGAGAAAATCGGCGATTTGGTTCGGGAAAAAA
CGCTGGAAGGCATTTCCGAGCTCCGCGACGAATCCGACAAATCCGGGATGCGCGTCGTTATCGAGCTGAAACGCAACGAA
AATGCCGAAGTCGTCTTAAACCAACTCTACAAACTGACTCCGCTGCAAGACAGTTTCGGCATCAATATGGTTGTTTTGGT
CGACGGACAACCGCGCCTGTTAAACCTGAAACAGATTCTCTCCGAATTCCTGCGCCACCGCCGCGAAGTCGTTACCCGAC
GTACGCTTTTCCGGCTGAAGAAGGCACGCCATGAAGGGCATATCGCCGAAGGCAAAGCCGTCGCACTGTCCAATATCGAT
GAAATCATCAAGCTCATCAAAGAATCGCCCAACGCGGCCGAGGCCAAAGAAAAACTGCTTGCGCGCCCTTGGCGCAGCAG
CCTCGTTGAAGAAATGCTGACGCGTTCCGGTCTGGATTTGGAAATGATGCGTCCGGAAGGATTGGCTGCAAACATTGGTC
TGAAAAAACAAGGTTATTACCTGAGCGAGATTCAGGCAGATGCTATTTTACGCATGAGCCTGCGAAACCTGACCGGCCTC
GATCAGAAAGAAATTATCGAAAGCTACAAAAACCTGATGGGTAAAATCATCGACTTTGTGGATATCCTCTCCAAACCCGA
ACGCATTACCCAAATCATCCGTGACGAACTGGAAGAAATCAAAACCAACTATGGCGACGAACGCCGCAGCGAAATCAACC
CGTTCGGCGGCGACATTGCCGATGAAGACCTGATTCCGCAACGCGAAATGGTCGTGACCCTGACCCACGGCGGCTATATA
AAAACCCAGCCGACCACCGACTATCAGGCTCAGCGTCGCGGCGGGCGCGGCAAACAGGCGGCTGCCACCAAAGACGAAGA
CTTTATCGAAACCCTGTTTGTTGCCAACACGCATGACTATTTGATGTGTTTTACCAACCTCGGCAAGTGCCACTGGATTA
AGGTTTACAAACTGCCCGAAGGCGGACGCAACAGCCGCGGCCGTCCGATTAACAACGTCATCCAGCTGGAAGAAGGCGAA
AAAGTCAGCGCGATTCTGGCAGTACGCGAGTTTCCCGAAGACCAATACGTCTTCTTCGCCACCGCGCAGGGAATGGTGAA
AAAAGTCCAACTTTCCGCCTTTAAAAACGTCCGCGCCCAAGGCATTAAAGCCATCGCACTCAAAGAAGGCGACTACCTCG
TCGGCGCTGCGCAAACAGGCGGTGCGGACGACATTATGTTGTTCTCCAACTTGGGCAAAGCCATCCGCTTCAACGAATAC
TGGGAAAAATCCGGCAACGACGAAGCGGAAGATGCCGACATCGAAACCGAGATTTCAGACGACCTCGAAGACGAAACCGC
CGACAACGAAAACACCCTGCCAAGCGGCAAAAACGGCGTGCGTCCGTCCGGTCGCGGCAGCGGCGGTTTGCGCGGTATGC
GCCTGCCTGCCGACGGCAAAATCGTCAGCCTGATTACCTTCGCCCCTGAAACCGAAGAAAGCGGTTTGCAAGTTTTAACC
GCCACCGCCAACGGATACGGAAAACGCACCCCGATTGCCGATTACAGCCGCAAAAACAAAGGCGGGCAAGGCAGTATTGC
CATTAACACCGGCGAGCGCAACGGCGATTTGGTCGCCGCAACCTTGGTCGGCGAAACCGACGATTTGATGCTGATTACCA
GCGGCGGCGTGCTTATCCGTACCAAAGTCGAACAAATCCGCGAAACCGGCCGCGCCGCAGCAGGCGTGAAACTGATTAAC
TTGGACGAAGGCGAAACCTTGGTATCGCTGGAACGTGTTGCCGAAGACGAATCCGAACTCTCCGGCGCTTCTGTAATTTC
CAATGTAACCGAACCGGAAGCCGAGAACTGA

>>MEG_3195|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCAGAAGAAACTGCTCGGTTTCCAAAAGTCGATATTAGCCACGAAATGAGAGAATCGTTCATTAGCTATGCGATGAG
CGTTATCGTCAGTCGGGCTTTGCCTGACGTTCGCGATGGTTTGAAGCCTGTACACAGGCGTATTTTGTATGCCATGCACG
ATATGGGCCTTACTCCTGACAAGCCGTTCCGTAAATCGGCAAACGTTGTCGGGGAAGTAATGGCGAACTACCATCCGCAT
GGTGACTCTTCCATCTATGAAGCGATGGTACGTATGGCCCAAGATTTTAACATGCGCTACATGCTGGTTGAAGGGCAAGG
GAACTTCGGTTCTGTAGACGGCGACCCGGCAGCGGCGATGCGTTATACGGAGTCGCGTTTTTCCAAGCTCGCGCTGGAGC
TTTTGCGCGATATTGATAAAGAAACGGTCGATTTCATTCCTAACTACGACGGACGCAAAGAAGAGCCGGTTGTATTGCCT
TCTCGTTTCCCGAACCTGCTTTTGAATGGTGCATCAGGGATTGCTGTAGGTATGGCTACCAATATTCCGCCACATAACTT
GACGGAAGTTGTTGATGGTGTCATTGCCATGATCGACAATCCTGATATTACGATTCAAGATTTGATGAAAATCATCAAGG
GACCTGACTTCCCTACAGCGGGGGAGATTCTCGGTTACAGTGGTATTCGCCGTGCCTATGAAACAGGCCGTGGTTCCATT
ATTATGCGCGCCAAAACCCAGATTGAAGAGGATGGGAAAGGCAAACCACGCATCATCGTAACAGAGATCCCTTATCAGGT
AAACAAGGCTAGACTCGTGGAAAAAATCGCGGAGCTAGTGCGCGAGAAAAAAATCGAAGGCATTACCGACCTTCGTGATG
AGTCTGACCGCAAAGGTATGCGTATTGTCATGGAATTGCGCCGTGACGTCATTCCAAAGGTTGTATTGAACAATCTATTT
AAGCATACCCAAATGCAGTCTACATTTGGTGTGAATATGCTGGCACTCGTTGATAGTCGTCCGCGTGTATTGAATCTGCG
TGACATGCTCTATTACTATTTGGAGCACCAACGTGTCATTATCCGCAGAAGGACCGAATACGATCTCAAGCAAGCAGAAG
CCCGTGCGCACATCTTGGAAGGCTTGCGTATTGCATTGGATCATATTGACGAGATTATCAGCTTGATTCGTTCTTCTCAA
ACCACGGAAGAAGCTCGCACAGGACTCATGGAGAATTACTCCTTGTCCTACGAGCAGGCACAGGCGATTCTCGATATGCG
TCTGCAACGCCTGACTGGTTTGGAACGAGAAAAAATCGAGAACGAATACCAGGAGCTCATGGTAAAAATCGCAGAACTGC
GTGCTATTCTTGCAGACGAAGCTAAAATCTACGCGATCATCCGCGATGAGCTGGGTGAGATCAAAGAGAAGTTTGGCGAT
GAAAGACGCACAGAAATTACTTTCGATGAGAATCATATCGAAGATGCTGATTTGATCCCAGAGGAAGATGTCGTAATCAC
CCTGACGCATGACGGTTATATCAAGCGTCTGCCTGTTTCGACCTACCGTTCGCAAAAACGTGGTGGACGTGGCGTGCAGG
GATTGGGAACCAAGGATGACGATTTTGTCGAGCATCTGTACATTACCAACTCGCATGATTACATCATGTTCTTTACGAGC
AAAGGGAAGGTGTATCGCCTAAAAGGATTTGAGATTCCTGACCTGAGCCGGACAGCAAAAGGTACCCCAATCATCAATCT
CATTCAGATTGAAAAAGGGGAGCGGGTTAGTGCGGTAATCCCTGTGAAAGAGTTTGATCAAGAACATTACCTGTTCTTTG
CGACCAAGAAGGGGATTATTAAGAAAACTACGCTGGAGTCCTATGAAAACATTCGCAAAGGCGGGCTAATTGCGGTTAAC
CTGCGCGAAGATGATGAGTTGATTGGTGTTCGTCTGACGGATGGCCAACAACAAATCATTATGGGTACTCATAAAGGTAT
GTCCGTCCGTTTCAATGAGGGAGACGTACGCACGATGGGACGTAACGCCACCGGTGTGAAGGGGATTACCCTTGACGACG
ATGATGATGTCATCGATATGGACGTTATCAAGCCAAATGCAGAAGTGCTCATTGTAACGGCGAATGGTTACGGAAAACGG
ACTCCTGTCGATGAATACCGCATTCAATCTCGTGGCGGTAAAGGAATTAAGACACACAATGTAACGGATCGTAGCGGTCC
GGTCGTCGGTCTGAAAGTCGTTGAGCCTGAAGAAGATCTGATGATTATTACCACTTCCGGTATCATCATTCGTACAGAAA
TGAAAGGTATTTCTGTGATGGGGCGCTACACGCAAGGTGTGAAACTGATCCGTTTGTCTGAAAATGAGCAAGTGGGATCA
GTCGCCAAATGTCCTCCGACTGAGGAAGAGGATATGACGGATGAAGATGCAGAAGAGGGAATCGAAGATCTGCAAGACGG
AGAGACTGTCGAAGCAACCGAGCCTATCGAACCTACCGAACCGACAGAGGAATAA

>>MEG_3196|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCTAAACGAAGGAAAGATTTTGCCTGTAGATGTAAGTAAAGAAATGAAGAAATGTTATATAGACTATGCCATGAGTGT
AATAGCTGGCCGTGCATTACCAGATGTAAGAGATGGGTTAAAGCCAGTACATAGAAGAATAATATATTCAATGCAGGGAT
TAGGATTAGCTCCAGAAAAAGGTTATAGAAAATGTGCGAGAATTGTAGGGGATGTACTAGGTAAGTATCATCCTCATGGA
GATACAGCAGTTTATGAAGCTTTAGTAAGAATGGCTCAGAATTTTTCAATAAGATATACATTAGTAGATGGTCATGGAAA
TTTTGGTTCTGTAGATGGTGATGGAGCAGCAGCAATGAGATATACAGAAGCTAAGATGAGTAAAATATCTATGGAACTTA
TAAAAGACATAAATAAAAATACAGTTGATTTTATTCCTAACTTTGATGGGGAAGAAGAAGAACCATCTGTATTACCATCA
AGGTTTCCTAATCTTTTAGTTAATGGTTCTTCAGGTATAGCAGTAGGTATGGCTACTAATATTCCACCTCATAATTTAAC
AGAGGTTATAGATGGAATAATAATGCTAATAGAAAATGAAGATGTAAATATACTTGATTTAATGACTAAAATAAAAGGAC
CAGATTTCCCTACTTCTGGATTAATCGTAGGTACAAGAGGAATAAGGGAAGCTTATGAAACTGGTAGAGGAAAAGTTATA
ATTAGAGCTAAAGCTGAGATTGAAGAGGAAAAAGGGAAAAATAAGATAATAGTTACAGAAATACCTTATCAAGTTAATAA
AGCTAGACTTATAGAAAATATGGCTAACCTTGTAAAGGATAAAAAAATAAATGGAATTTCAGATTTAAGAGATGAATCAG
ATAGAGATGGTATGAGAATTGTTATAGAATTAAAAAGGGATGCAAATCCTAATATAGTTTTAAACCAATTATATAAGCAT
ACAAAACTTCAAGATACCTTTGGAATAATCATGTTAGCTTTAGTTAATAACCAACCTCAAATTTTAAATTTAAAAGAAAT
ATTAGTTAATTATGTGGAATTCCAAAAGGAAGTAATAAGAAGAAGAACTAGATTTGACTTAGATAAAGCATTAGCAAGGG
CTCACATATTAGAAGGTTTAAGAATAGCCTTAGATCATATTGATGAAGTTATAAAACTTATAAGAGCATCTAAAAATACA
GCTGAAGCTAAAGAAGGATTAATGAATAACTTTAATCTTTCAGAAAAACAAGCTCAAGCTATATTAGATATGAAGTTACA
AAGGCTTACAGGTTTAGAAAGAGAAAAAATAGAAGAAGAATATAAAGAACTTATGGAAAAGATAAGTTATTTTAGAGAAA
TATTAGATAAAGAAGAATTAGTACTAAGTATAATAAAAGAAGAATTAATAGAGATAAAAAATAAATATGGTGATGAAAGA
AAAACAGAAATAGTAAAAGGTGAACATGATATAGACATAGAGGACTTAATTGAAGATAAAAAGGTGATAGTAACTTTAAC
TCATGGTGGATACATAAAAAGATTAGATATGGATACATACTCTTCACAAAAAAGAGGAGGAAAGGGTATTCAAGCTACAT
CTACAAAACAGGATGATTTTATAGAAAATATGTTTGTAACATCTACTCATAGTACTATATTATTCTTTACTAATAGGGGT
AAGGTATATAAACTTAAAGCTTATGAAATACCAGAAGCAGGAAGAACAGCTAAAGGTACAAATATAGTAAATCTTATACC
TATAGAAAATAATGAGAAAATACAAACAGTAATAGGTTTAAAAGACATAGATGACATGAAGCATTTTGTAATGTGTACGA
GAAATGGAATAATTAAAAAGACAGAGATAAGTAAATATTCTTCCATAAGAAAAGGTGGATTAAATGCCATAAATTTAAGA
GAAGATGATGAATTAATAGATGTAAAAATGACCAAAGGAAATGATGAAATAATAGTAGTAACACAAAATGGGTACTGTAT
AAGATTTAATGAAGAAGATGTAAGACCTATGGGAAGAGTTGCAACAGGTGTTAAGGCTATAACACTAAGAAAAACTGATA
AGGCTGTATCTATGGATGTAGTAATAGAAGATGAAACACTATTATCTATAAGTGAAAATGGATTTGGTAAACGAACAGAC
ATAGAAGAATATCCTATCCATAGAAGAGGTGGAAAAGGTGTTATAACTTATAAGATAACTGACAAAACAGGACCTATAGT
TGGAGCAAGGTTTGTAAAAGAAGATGATGAACTTATGCTTGTAAATAGTGGTGATGTTGCAATAAGAATAAATGTTTCGG
AAATATCTAAAACTAGTAGAAATGCTATGGGTGTAAAACTAATGAGAACTAGTGAAGAAGAAAAAATAGTAGCTATAGCT
AAAATAAAGAGTGAAGACATAATAGAAGAAGAAATTTTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAAAA
TCTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAAAATCTAAATGAAGAATAA

>>MEG_3197|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGAGCGATCTGATCCAAATCGAGGAAGAGCTCAAGAAGTCCTATCTGGAATATTCCTTGAGCGTCATCATAGGCCGCGC
CATCCCCGATGTGCGCGACGGCCTCAAACCCGTGCACCGGCGCATTCTCTACGCCATGCACGATCTGTCCAACACCTACA
ACCGGCCCTACAAGAAATCCGCCCGCGTCGTCGGTGACGTCATCGGTAAATACCATCCCCACGGCGACCAATCCGTGTAC
GACGCCCTGGTCCGCATGGCCCAGGACTTCTCCATGCGCGACGCCATCGTGGATGGCCAGGGCAACTTCGGCTCCATCGA
CGGCGACGCCGCGGCGGCCATGCGATACACCGAAGTCCGCATGTCCCGCCTGGCCGGCGAGTTCTTGGCCGACATCGAAA
AGGAAACCGTCGATTTTCGGCCCAACTACGACAACAGCCTGGAAGAGCCGGCCGTCCTGCCCACCAAGGTGCCCAATCTG
CTTTTAAACGGCTCCTCGGGCATCGCCGTCGGCATGGCCACCAACATCCCGCCCCACAACCTGGGCGAGCTGTGCGACGG
CCTGCTGCACCTGCTCGACACGCCCTCCTGCCCGGTCACCGACATCATCGGCCTGGTCAAGGGGCCGGACTTCCCCACCG
GCGCGGCCATCTACGGCGGCAAGGGACTCACCGAAGCCTACACCACCGGACGCGGCACCATCAAAATCCGGGGCCGGGCC
GAGGTCGAGGAACGCAAGAAAGATTATGTTTCCGTGGTCATCCGGGAAATCCCGTATGCGCTCAACAAGTCTTCCCTGGT
GGAAAAGATCGCGGCGCTCATTAACGACGGCCGCATCGAGGGCGTGTCCGACCTGCGCGACGAGTCCGACCGCAAGGGCA
TCCGCATTGTCCTGGATCTCAAAAAGGGCGTCATCCCCGACATCGTCATCAACGCCCTGTACAAGTACACGCCGCTGGAA
ACCTCGTTCGGCATCAACATGCTTGTGGTTGCCGACAACCGGCCGGCGCTTTTAAACATCAAGCAGGTCCTGGAGCACTT
CCTCACCCACCGCCGCGACGTCATCCTGCGCCGCACCCGGTTCGATCTGCGAAAGAGCGAGGAGCGCGCCCACATCCTCG
AAGGCCTGCGCATCGCCCTGGACAACATCGACGAAGTGGTCTCCATCATCCGGGCCTCCAAAAACGCCGTCGAAGCCCGG
GAACGGTTGATGGAGCGCTTCGGCCTGTCCGAGCGCCAGGCCCAGGCCATCCTGGACATGCGCCTTCAACGCCTGACCAA
CCTGGAGCGCCAAAAGCTCATCGACGAGTACAACGAGCTCATCAAGCTCATTGAATACCTGCGCTCGATCCTGGAAAACG
ACGAGGTGCTGCGCGGCGTCATCCGCGACGAAATCAAGGAAATCCAGGACCGTTACGCCACCCCGCGCAAGACTGAGATT
CTGGAGGACCTTGAAGGCATCAACATCCTCGATCTCATCCCCGACGAGGACGTGGTCATCACCCTGTCGCGCCGGGGCTA
CATCAAGCGCACCAAAATCGATAATTACCAGCAACAAAAGCGCGGCGGCAAAGGCATCGCCGGGGTGGCCACGGCCGGCG
ACGACTTTGTCCAGTCGTTTTGCGCCACCACCAACCACCAGCAGTTGTTGCTTTTTACCAACCTCGGCCGCATGTTCATG
CTGCCCGTGCACCAGATTCCCGAAGGCCAGCGCACGGCCAAGGGCGCGCACATCGCCAACCTGCTGCCCATGGACAAGGA
AGAGTTCGTGGCCACGGCCCTGTCCATCCGCGAGTTCTCCGAGGAGCGCTATTTCCTGTTCGTGACCCGCAAGGGCATGG
TCAAGCGCACCTGCACCGACCTCTACAAGAACTGCCGTTCCACGGGCATCATCGCCGTGGGGCTTAAGGAAAACGACGAA
CTCCTGACCGTCAAGGAGATCGACGACGAGACCGAAGTCTTGCTGGCCACCCAGCAGGGCCTGTCCAACCGCTTCCACAT
CAGCGGCGTGCGCCCCACCGGCCGGGGCGCGGCCGGCGTCAAGGGCATTGCCCTTAAGGGCAACGACCGTGTGGCCGCCG
GCGTGGTCATCACCAGCGTCAGCCGCTCCGAGGTGCTCACTGTCTCAGCCAACGGCTACGGCAAGCGCACCTCCATCGAA
CACTACCCTATCCGCAACCGGGGCGGCTCCGGCGTCATCAACATGCGCGTGACGCCCAAGACCGGTCAGGTCATCGGCGC
GGTCATGGTCGGCGACGACGACGAACTGCTGCTGTTAACCTCCGCCAACAAGATCATCCGCCTGTCCGTCTCCGGCATCT
CGTCCGTGGGCCGGGCCACCCAGGGCGTCATGCTGGTGCGCATGGACGAAAACGATACCGTCATGGGCTTTGACCTGGTC
GATCCGAGCGACCTCGACCGGTGCGCGCCCTCCGGCGAATAG

>>MEG_3198|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAGGATAAAAATTTAGTGAATGTCAATCTGACAAAGGAGATGAAGGCAAGTTTTATCGACTACGCCATGAGTGTTAT
CGTAGCGCGAGCTCTTCCTGATGTTCGAGATGGCTTAAAACCTGTTCACCGTCGCATTCTCTACGGAATGAATGAATTGG
GTGTGACCCCAGACAAACCCCATAAAAAATCTGCTCGTATTACAGGGGATGTCATGGGTAAATACCACCCACACGGGGAT
TCCTCTATTTATGAAGCCATGGTCCGTATGGCTCAATGGTGGAGCTACCGTTACATGCTTGTAGATGGTCATGGGAATTT
TGGTTCCATGGATGGAGATAGTGCTGCCGCTCAACGTTATACCGAGGCACGTATGAGCAAGATTGCTCTGGAAATGCTTC
GTGATATCAACAAAAATACAGTTGATTTCGTTGATAACTATGATGCCAATGAACGGGAACCCTTGGTCTTGCCAGCGCGT
TTTCCAAACCTTTTGGTTAATGGAGCAACTGGTATCGCGGTTGGGATGGCAACCAATATTCCACCTCATAATCTGGGTGA
AACCATTGATGCAGTGAAGTTGGTCATGGATAATCCTGAAGTGACTACCAAGGACTTGATGGAAGTCTTGCCTGGACCAG
ATTTTCCAACTGGTGCTCTTGTCATGGGGAAATCAGGTATCCATAAGGCTTATGAAACAGGTAAAGGTTCGATTGTCCTA
CGTTCTCGTACAGAGATTGAAACGACTAAGACTGGTCGTGAGCGTATCGTTGTAACAGAATTTCCTTACATGGTCAATAA
AACCAAGGTGCATGAGCATATTGTTCGCTTGGTTCAGGAAAAACGCATTGAGGGTATCACAGCAGTACGTGATGAGTCAA
ACCGTGAAGGTGTTCGATTTGTTATTGAAGTCAAGCGCGACGCCTCAGCCAATGTTATTCTCAATAACCTCTTCAAAATG
ACCCAAATGCAAACCAATTTTGGTTTCAATATGCTCGCTATCCAAAATGGTATACCGAAAATTTTGTCTCTTCGTCAGAT
TTTGGATGCTTATATTGAGCACCAAAAAGAAGTGGTTGTTCGTCGTACACGTTTTGATAAGGAAAAAGCGGAAGCGCGCG
CTCATATCTTAGAAGGTCTCTTGATTGCGCTAGACCATATCGACGAAGTGATTCGTATCATCCGTGCTAGTGAAACGGAT
GCGGAAGCTCAAGCTGAGTTGATGAGCAAGTTTAAGCTTTCTGAACGTCAAAGTCAAGCTATCCTTGATATGCGTCTTCG
TCGTTTGACAGGTTTGGAACGCGATAAGATTCAATCTGAGTATGATGACCTCTTGGCTCTGATTGCGGATTTAGCAGATA
TTCTTGCTAAGCCTGAACGTGTTTCTCAAATTATCAAAGACGAATTGGATGAAGTTAAACGTAAATTTTCTGATAAACGC
CGTACAGAGTTGATGGTTGGACAGGTCTTGAGTCTCGAGGATGAGGACTTGATTGAAGAATCGGATGTCTTGATTACCCT
TTCTAACAGAGGCTACATTAAGCGTTTGGATCAGGACGAGTTCACTGCTCAAAAACGTGGGGGTCGTGGTGTCCAAGGAA
CGGGAGTGAAAGATGATGACTTTGTTCGTGAGTTAGTGTCAACTAGTACCCATGATCATCTGCTCTTCTTCACAAACAAG
GGACGTGTCTATCGTCTTAAAGGTTATGAAATTCCTGAGTATGGTCGGACTGCCAAAGGGCTACCAGTAGTCAATCTCTT
GAAATTGGATGAAGACGAAAGTATTCAGACGGTTATCAATGTTGAGTCTGATCGCAGTGATGATGCTTATCTCTTCTTTA
CAACCCGTCACGGTATTGTGAAGAGAACCAGTGTTAAGGAGTTTGCCAATATTCGTCAAAATGGTCTCAAAGCGCTGAAT
TTAAAGGATGAAGATGAGTTAATCAATGTCTTGTTGGCAGAAGGAGATATGGATATTATCATTGGTACCAAGTTTGGTTA
TGCAGTTCGCTTTAATCAATCAGCCGTTCGTGGTATGAGCCGTATCGCCACTGGTGTGAAAGGTGTTAACCTTCGTGAAG
GAGACACAGTTGTTGGTGCCAGCTTGATTACTGATCAAGATGAGGTTCTTATTATCACAGAAAAAGGATATGGTAAGCGT
ACAGTCGCTACTGAATACCCAACAAAAGGTCGTGGTGGTAAGGGAATGCAGACAGCTAAAATTACCGAAAAAAATGGCTT
GCTGGCCGGTCTTATGACTGTTCAAGGGGATGAGGATTTGATGATTATCACTGATACAGGTGTCATGATTCGAACCAATC
TTGCCAATATTTCACAAACAGGACGTGCAACTATGGGAGTTAAAGTAATGCGCCTGGATCAAGATGCTCAGATAGTGACT
TTCACAACGGTTGCGGTGGCAGAAAAAGAAGAAGTTGGGACAGAAAACGAAACAGAAGGTGAAGCATAA

>>MEG_3199|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATTAATGAACGAAATATAACCAGTGAAATGCGTGAATCATTCTTAGACTATGCTAT
GAGTGTTATCGTTTCTCGTGCATTACCTGATGTTAGAGACGGATTAAAGCCAGTACATCGTCGTATTCTTTATGGTTTAA
ATGAACAAGGTATGACGCCCGATAAACCTTATAAGAAATCTGCACGTATAGTCGGGGATGTCATGGGTAAATATCACCCT
CATGGTGATTCTTCAATTTATGAAGCAATGGTAAGAATGGCCCAAGACTTTAGTTATCGTTATCCACTTGTAGATGGTCA
AGGTAACTTTGGCTCTATGGATGGTGACGGTGCAGCCGCAATGCGTTATACCGAAGCACGTATGACTAAAATAACATTAG
AACTTTTACGTGATATCAACAAAGACACAATTGATTTTATTGACAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCACGTTTCCCTAACTTACTAGTAAATGGTGCGGCAGGAATTGCCGTAGGTATGGCTACAAATATTCCTCCCCACAA
TTTAACTGAAGTTATTGATGGTGTGCTCAGTTTAAGTAAGAATCCAGACATCACAATTAATGAGCTGATGGAAGACATCC
AAGGTCCTGATTTTCCTACAGCCGGTTTAGTACTAGGAAAAAGTGGTATTCGTCGAGCTTATGAAACAGGTCGTGGGTCA
ATTCAAATGCGTTCTCGTGCTGAAATAGAAGAACGTGGTGGTGGCCGTCAACGTATTGTCGTAACGGAAATACCTTTCCA
AGTCAATAAAGCGCGTATGATTGAAAAAATCGCAGAGTTAGTTAGAGATAAGAAAATCGACGGTATTACAGATTTACGTG
ATGAAACAAGTTTGCGTACAGGTGTAAGAGTAGTTATTGATGTACGTAAAGATGCAAATGCGAGTGTTATTTTAAATAAT
TTATATAAACAAACGCCATTACAAACATCATTTGGTGTAAATATGATTGCTTTAGTGAATGGTAGACCTAAACTAATCAA
TTTAAAAGAAGCACTTATTCATTACTTAGAACACCAAAAAACAGTGGTTAGACGACGTACTGAATATAATCTTAAAAAAG
CAAGAGACCGTGCACATATTCTAGAAGGTTTACGAATAGCACTAGATCATATTGATGAAATTATCACAACAATTCGTGAA
TCGGACACTGATAAAATTGCGATGGCAAGTTTACAAGAGCGTTTTAAACTTACTGAACGTCAAGCTCAAGCAATTTTAGA
TATGCGTTTAAGACGTTTAACTGGATTAGAAAGAGATAAAATAGAATCTGAGTATAATGAACTTCTAGAATATATTAAAG
AGTTAGAAGAGATTTTAGCTGATGAAGAAGTACTATTACAATTAGTTCGTGATGAATTGACTGAAATTAAAGAACGTTTC
GGCGATGAACGTCGCACTGAAATTCAATTAGGTGGTCTAGAAGATCTTGAAGATGAAGACTTAATCCCTGAAGAACAAAT
TGTTATTACATTAAGTCATAATAACTATATTAAACGTTTACCAGTATCTACATATCGTTCTCAAAATCGTGGTGGTCGTG
GCATACAAGGTATGAACACGTTGGATGAGGACTTCGTTAGTCAATTGGTAACAATGAGTACACATGATCATGTTCTGTTC
TTTACGAATAAAGGTCGTGTATATAAACTCAAAGGTTATGAAGTTCCTGAGTTGTCACGTCAATCCAAAGGCATACCTAT
TATTAATGCGATTGAACTCGAAAATGACGAAACAATAAGTACGATGATTGCAGTTAAAGACCTTGAAAGTGAAGAAGATT
ATCTCGTATTTGCGACAAAACAAGGTATCGTTAAACGTTCATCATTAAGTAACTTCTCCCGTATTAACAAAAACGGTAAA
ATTGCAATTAACTTTAAAGAAGATGATGAATTAATTGCAGTACGTCTAACAACAGGTAATGAAGATATTCTTATTGGAAC
TGCACATGCATCATTAATTAGATTCTCTGAATCTACATTACGCCCATTAGGCCGTACAGCAGCAGGTGTGAAAGGTATTT
CTCTACGTGAAGGGGATACTGTCGTAGGTCTTGATGTTGCAGATTCAGAAAGTGAAGATGAAGTATTAGTAGTTACTGAA
AATGGTTACGGTAAACGTACACCTGTTAGCGAATATCGTTTATCAAATCGTGGTGGTAAAGGAATCAAAACTGCGACAAT
TACCGAGCGTAATGGTAACATCGTTTGTATCACAACTGTAACCGGTGAAGAGGATTTAATGGTTGTAACTAACGCTGGTG
TTATTATTCGTCTTGACGTTCATGATATTTCTCAAAATGGACGTGCAGCACAAGGTGTACGCCTTATGAAACTCGGAGAT
GGTCAATTTGTTTCTACTGTTGCTAAAGTAAACGAAGAAGACGATAATGAGGAAAATGCAGATGAAGCGCAACAATCTAC
TACTACTGAAACAGCAGATGTAGAAGAGGTAGTCGATGATCAGACACCAGGCAATGCGATTCATACAGAAGGTGATGCAG
AAATGGAATCTGTAGAGTCTCCTGAAAATGATGATCGTATTGATATTAGACAAGATTTTATGGATAGAGTGAATGAAGAT
ATCGAGAGTGCTTCAGATAATGAAGAAGATAGTGATGAATAA

>>MEG_3200|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGTGAAGAAATTAAAGAAAACATTCAAGACGTCAATCTGACCAGCGAAATGAAAGAATCTTTCATTGACTACGCAAT
GAGTGTTATCGTAGCCCGCGCGTTACCTGACGTTCGTGACGGTTTAAAACCTGTTCATCGCCGAATCTTATATGGAATGA
ACGAATTAGGGGTAACCCCTGATAAACCACACAAAAAATCAGCCCGGATTGTTGGGGATGTTATGGGTAAATATCACCCC
CATGGGGACAGTGCGATTTACGAATCAATGGTGCGGATGGCACAACCTTTTAGTTATCGGGCTATGTTAGTTGACGGCCA
CGGAAACTTCGGTTCCGTCGATGGTGACGGCGCTGCCGCTATGCGTTATACCGAAGCACGTATGAGTAAAATTGCTTTAG
AAATGCTACGAGATATTAACAAAAATACAGTCGATTTCCAAGGAAACTATGATGATTCAGAACAAGAACCAGTAGTTTTA
CCTGCTCGTTTTCCAAACTTACTAGTTAACGGAACAACGGGGATTGCGGTGGGGATGGCAACAAATATTCCACCACACAA
TTTAAGTGAAGTGATTGATGCAACAAGTTTATTGATGGACAATCCTGATGTAACGACGAATGAATTGATGGAAGTGTTAC
CTGGACCAGATTTTCCAACAGGCGGTTTAGTGATGGGGAAATCAGGGATTCGCCGAGCATATGAAACAGGGAAAGGTTCG
ATTACTGTTCGTGCAAAAGTTGAATTGACTGAAATGCCGAATGGAAAAGAACGTATTTTAGTAACTGAATTGCCTTATAT
GGTGAATAAAGCCAAATTAATCGAACGAATTTCTGAATTACACAGAGATAAACGAATTGAAGGAATTACTGATTTGCGGG
ATGAATCTTCTCGTGAAGGCATGCGGATTGTCATCGATGTTCGTCGAGATGTGAGTGCCTCTGTTGTGTTAAACAACTTG
TACAAAATGACTGCCTTACAAACATCTTTTGGTTTTAACATGTTAGCCATCGAAAAAGGCGTACCGAAAATTTTAAGCTT
GAAACGTATTTTAGAAAACTACGTCGAGCACCAAAAAGAAGTCATTACTCGCCGGACGATTTTTGACAAAAACAAAGCAG
AAGCACGGGCGCATATTTTAGAAGGTCTACGAATTGCCTTAGATCATATCGATGAAATCATTGCCATTATCCGTGGGTCA
CAATCAGATGACGAAGCAAAAGCAACGTTAATTGAACGCTTTGAATTTTCAGATCGTCAAGCGCAAGCGATTTTAGATAT
GCGTTTACGCCGTTTAACAGGCTTAGAACGCGACAAAATTGAAAATGAATATCAAGAGCTATTGAAATTCATTGCGGACT
TAGAGGACATTTTAGCCCGCCCAGAACGCGTCATTGAAATCATTAAAACAGAGTTAAATGACGTTCGCACAAAATTTGGT
GATGCACGACGCACAGAATTATTAGTAGGTGAAGTCCTAAGTCTTGAAGATGAAGATTTAATCGAAGAAGAAGAAGTCGT
GATTACATTAACCAATAACGGCTACATTAAGCGGATGGCAAACTCCGAATTCCGGGCGCAACGCCGCGGCGGACGTGGTG
TCCAAGGCATGGGCGTTCATGATGATGATTTCGTGAAAAACCTAGTTTCTTGTTCAACACATGACACGTTATTATTCTTT
ACGAACACTGGGAAAGTTTACCGAGCAAAAGGTTACGAAATCCCTGAATACGGTAGAACAGCAAAAGGAATTCCAGTGAT
TAACTTACTGGGAATTGATTCTGCAGAAAAAATTCAAGCGATTATTTCTGTTGAGGGCAAAGCGGAAGCAGGTAAATACT
TGTTCTTCACAACCTTAAAAGGAACCGTCAAACGGACAGCCGTAACAGCCTTTTCTAATATCCGTAGTAATGGATTAATC
GCCATTAGCTTAAAAGAAGATGATGAGTTAGTTAACGTAGTAACGACTAATGGCAATCAGAAGATGATTATCGGAACACA
TGCAGGATACTCTGTCACATTTGATGAAAATACTGTACGTGATATGGGCCGGACAGCATCAGGTGTTCGTGGAATCCGTC
TCCGCGAAAATGATTATGTGGTCGGCGCAGCGATTCTGGATGAAAATAAAGAAGTCCTAGTCATTACTGAAAATGGTTAT
GGTAAGCGTACAAAAGCCTCTGAATATCCAGTTAAAGGACGTGGCGGTAAAGGGATTAAGACAGCAAATATCACTGAGAA
AAATGGTCCATTAGCTGGTTTAACCACGGTCAATGGTGATGAAGATATCTTATTGATTACGAACAAAGGCGTCATTATCC
GCTTTAACGTTGATTCTGTTTCTCAAACAGGACGCGCAACATTAGGGGTTCGTTTAATGAGAATGGAAGATGGTGCCAAA
GTGGTAACAATGGCTGTTGTAGAACCAGAAGAAGTGGAAGAAGAAATCGTTGAAGTTGTAGAAACAACAGAAAACGAAAC
AACATCAGAAACAGAAGAATAA

>>MEG_3201|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTTAACATCGAGGAAGAGCTGAAGAGCTCCTATCTGGACTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGACGTCCGCGATGGCCTGAAGCCGGTACACCGTCGCGTACTATACGCCATGAACG
TATTGGGCAATGACTGGAATAAAGCCTACAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGATTCCGCGGTGTACGACACCATCGTTCGTATGGCGCAGCCTTTCTCGCTGCGTTACATGCTGGTAGATGGTCAGGG
TAACTTTGGTTCTATCGACGGCGACTCCGCCGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAGC
TGATGGCCGACCTGGAAAAAGAGACGGTTGATTTCGTTGATAACTACGATGGCACGGAAAAAATTCCTGACGTCATGCCA
ACGAAGATCCCTAACCTGCTGGTGAACGGTTCGTCCGGTATCGCCGTAGGGATGGCGACCAACATTCCGCCGCACAACAT
CACCGAAGTGATCAACGGCTGCCTGGCCTATATCGACGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GCCCGGACTTCCCGACGGCGGCCATCATCAACGGTCGTCGTGGTATTGAAGAAGCGTACCGCACCGGTCGCGGCAAGATT
TACATCCGTGCCCGCGCCGAAGTGGAAGCAGATGCCAAAACCGGCCGTGAAACCATCATTGTTCACGAGATCCCGTATCA
GGTGAACAAAGCGCGACTGATTGAAAAAATCGCCGAGCTGGTAAAAGAAAAACGTGTTGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGATAAAGACGGTATGCGCATCGTGATTGAAATCAAACGCGACGCGGTGGGCGAGGTTGTGCTGAACAACCTG
TACTCTCAGACCCAGCTGCAGGTCTCCTTCGGTATCAACATGGTTGCACTGCACCATGGTCAGCCGAAGATCATGAACCT
GAAAGAGATCCTGAGCGCGTTTGTCCGTCACCGCCGCGAAGTGGTGACCCGTCGTACCATTTTCGAACTGCGCAAAGCGC
GTGACCGTGCCCACATCCTTGAGGCACTGGCCGTGGCGCTGGCCAACATCGACCCGATCATTGAACTGATCCGTCGCGCG
CCAACCCCGGCGGAAGCGAAAACCGCGCTGATTTCCCGTCCGTGGGATCTGGGCAACGTTGCGGCAATGCTGGAGCGTGC
CGGTGATGACGCCGCGCGTCCTGAGTGGCTGGAACCTGAATTCGGCGTGCGTGATGGTCAGTACTACCTGACTGAACAGC
AAGCCCAGGCGATTCTGGATCTGCGTCTGCAGAAACTGACCGGCCTTGAGCATGAAAAACTGCTCGACGAATATAAAGAG
CTGCTGGAGCAGATCGCTGAACTGCTGCACATCCTGGGCAGCGCAGAGCGCCTGATGGAAGTGATCCGCGAAGAGCTGGA
GCTGATCCGCGATCAGTTCGGCGATGAGCGTCGCACCGAAATCACCGCCAACTCCGCAGATATCAACATCGAAGACCTGA
TCAACCAGGAAGACGTTGTTGTGACCCTGTCTCACCAGGGCTACGTGAAGTATCAGCCGTTAACTGACTACGAAGCACAG
CGTCGTGGTGGTAAAGGCAAATCTGCGGCACGTATTAAAGAAGAAGACTTTATTGACCGTCTGCTGGTGGCGAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGTCGTCTGTACTGGATGAAGGTCTACCAGTTGCCGGAAGCGAGCCGTGGTG
CACGTGGTCGTCCGATCGTTAACCTGCTGCCGCTGGAAGCGAACGAACGTATCACCGCCATTCTGCCGGTACGCGAGTAC
GAAGAGGGCGTGAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACCGCGCTGACCGAGTTCAGCCGTCCACG
TTCTGCCGGTATCATCGCGGTGAACCTGAACGAAGGCGATGAGCTGATTGGCGTCGATCTGACTTCAGGCAAAGATGAAG
TCATGCTCTTCTCCGCAGCCGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGCGCAATGGGTCGTACCGCAACGGGC
GTTCGCGGTATCAAACTGGCGGGCGAAGACAGCGTCGTTTCTCTGATTATTCCGCGCGGGGAAGGGGCTATCCTGACCGT
GACGCAGAATGGTTACGGTAAACGTACCGCGGAAGGGGAATACCCAACCAAGTCGCGTGGCACGCAGGGCGTTATCTCTA
TCAAGGTGACCGAGCGCAACGGTTCCGTTGTGGGCGCGGTGCAGGTAGACGATGCCGACCAGATCATGATGATCACCGAT
GCCGGTACGTTGGTGCGTACCCGCGTGTCGGAGATTAGCGTGGTGGGTCGTAATACCCAGGGCGTTATCCTCATCCGTAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGTGTTGCTGAGCCAGTGGACGACGAAGAGCTCGACTCCATCGACGGTA
GCGTCGCGGAAGGTGATGATGATATCGCACCGGAAGTGGACACCGACGATGATGCAGCGGATGATGCTGACGAGTAA

>>MEG_3202|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGTATACCTAGCCAAAGAAGTCTTACCAGTCAACATAGAAGACGAATTGAAGCAATCCTATTTGGATTATGCGATGAG
TGTCATTGTAGGCCGAGCATTGCCTGATGTACGTGATGGTTTAAAACCGGTGCATAGGCGAGTTCTTTTTGCGATGAGCG
AGTTGGGTAATGATTGGAATAAACCTTATAAAAAATCTGCTCGTGTAGTAGGGGATGTCATCGGTAAATACCATCCTCAC
GGGGATACAGCTGTTTATGACACTATTGTCCGTATGGCCCAACCTTTTTCCATGCGCTACCTTTTAATCGATGGACAGGG
TAATTTTGGCTCTGTAGATGGAGATGCTCCAGCTGCTATGCGTTACACTGAAGTAAGAATGTCCAAAGTGGCACATGCTT
TACTGGCTGACTTGGATAAGGAAACCGTTGATTTTAGTCCTAACTATGATGAAACAGAATTTGCTCCAGTGGTATTGCCA
TCGAGAATTCCCAATTTGCTAGTTAATGGCTCTTCCGGTATTGCGGTAGGGATGGCTACTAATATTCCACCACATAATCT
TACTGAAGTAATCAATGCATGTATTGCCTTAGTGGATGAACCTGACACGAGTCTTGAAGATTTAATGGAAATTATTCCTG
GCCCTGATTTTCCTACAGCAGCAATTATTAATGGTCGTGCTGGAATTATTGAAGGTTATCGTACTGGAAAAGGGCGGGTT
GTTATCAGGGCACGCACAGAAATTGAAACGGATGAAAATTCAGGCCGTCAGTCAATTATTATTCAGGAATTACCTTATCA
GGTGAATAAAGCGCGTTTGATCGAGCGTATCGCTGAATTGGTAAGGGACAAGAAAATCGAGGGAATTTCCGGCTTGAGGG
ATGAGTCAGACAAGCAGGGAATGAGAGTAGTCATTGAATTAAAACGCAATGAAGTAGCAGATGTGGTATTGAATAACCTG
TTCGCTCATACTCAAATGCAAAATGTATTCGGGATTAATATGGTTGCCCTGGTAGATGGCCAACCGCGTACTTTGAATTT
GAAGCAAATACTGGAATATTTTATAAAACATCGAAGAGAGGTTGTTACCAGGCGCACAATATTTGAGTTGAAAAAAGCCA
GAAATCGAGCCCATTTATTGGAGGGCTTGGGAATCGCCTTAGCTAATATCGATGAAATGATCGCGTTAATTAAGCAATCT
CCTACTCCTCAAGACGCAAAAAATGCTTTATTAAGCAAAATATGGCAACCTGGCTTGGTAAAGGCTATGTTGGAAAAGGC
TGGCTCAAACGCGTCAAGGCCTGATGATTTAACTGAAGAGTATGGTTTGCATGAGAACGGATATAAATTATCTGAAGCAC
AGGCACAAGCAATACTTGAATTAAGATTACATAGGCTAACAGCTCTTGAACAAGATAAAATAATTAACGAATTTGAAGAG
CTATTGAATTTAATTAAAGAATTGCTTGATATATTGGCTTCACCTGAAAGACTTATGCAAGTTATTCGTGATGAATTGAT
AGAGATTAAATCCCAATTTGGTGATGAGAGACGAACGGAAATAACAGCCTCACAAGAAGATTTGACTATTGAAGATTTGA
TTACCGAAGAAGACGTTGTGGTCACTTTATCTCATCAAGGTTATGTAAAATATCAGCCCATTACAGCCTATCAGGCTCAG
CGCCGAGGTGGCAAAGGCAAATCAGCAACTCATGTCAAGGATGAGGATTTTGTTGAGCGTTTGGTTATTGCGAGTACTCA
TGACACCTTATTATGTTTCTCCAATCATGGCAAATTATATTGGCTAAAAGCGTATCAATTGCCTCAAGCAAGCCGCACTT
CGAGAGGAAGGCCTATAATTAATATTCTTCCTTTGGCAGAAGGTGAAGAGATTAATGCTATGCTCCCTGTTCGTGAGTAT
AAAGACGGCAGCTATGTGTTTATGGCAACCAAGAAGGGAACAGTTAAAAAAGTACCTTTAAACGCATTTAGCAGGCCGCG
TTCCAATGGTATTATTGCTGTGGACCTGGAAGAAGATGACAGTCTCGTTGGAGTCGATATTACTGATGGTGCTCGCGATA
TTATGTTGTTTACCGATGCAGGCAAAGTAATCCGCTTTGATGAAAGTAAAGTGCGACCTATGGGACGCACGGCTCGAGGA
GTTCGCGGAATTAGGGTAGAAAAGGATCAAGCCGTTAAATCCCTTGTGGTAGTCGACCCAAGTGGAGGTACCATTTTGAC
GGCAACTGAAAACGGCTACGGCAAGAGAACTCATATTGATGAATACCGAGTGTCAGGAAGGGGGGGGCAAGGCGTTATTT
CCATTCAGGTTACTGAACGAAATGGTAAAGTGGTCCGCTCCCTACAGGTTACAGATAATGACGAAGCCATGTTAATTACA
GATAAAGGAACTTTGGTTCGTTTTAAAGTTAATGAATTATCTGTGATAGGCAGAAATACACAAGGAGTTCGCCTGATTAA
TGTCAGTTCTGGTGAGACAGTTGTTGGAATGCAAAAAATTGTAGATCTTGGAGAAGAGTTAGAAGAATCAGAAGATTCAT
CCCTTAATGCTGATGACAACAGTGATGAATAG

>>MEG_3203|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACGGATTCAATCCAATCATCTATCACCCCTGTCAATATCGAAGAAGAACTTAAATCTTCCTACCTTGACTACGCGAT
GTCGGTTATCGTTGGGCGTGCATTACCTGACGTTCGAGATGGTTTAAAACCTGTTCACCGCCGCGTACTATTCTCAATGG
ATCGCGAAGGCAATACCGCCAATAAAAAATACGTAAAATCAGCGCGTGTTGTGGGTGATGTAATCGGTAAATATCACCCG
CATGGTGACTCAGCCGTGTACGATACAATCGTTCGTATGGCACAACCCTTCTCACTTCGCTATATGTTGGTTGATGGGCA
AGGTAACTTTGGTTCAATTGACGGCGATGCACCTGCTGCAATGCGTTATACCGAAGTGCGTATGCAAAAAATTACGCAAG
CATTGCTCACGGATTTGGATAAAGAAACCGTCAATTTCTCGCCAAACTATGATGGCGAATTAATGATTCCAGATGTATTG
CCGACTCGTATTCCAGCACTTTTAGCAAATGGTTCTTCTGGTATTGCGGTGGGGATGGCAACTAACATTCCCCCTCACAA
CTTAAACGAAGTATTAAATGGTTGTTTGGCTTATATTGACAACAATGAAATTACCATTGATGAATTAATGCAACATATTC
CGGGCCCAGACTTTCCAACCGCTGCATTAATTAATGGTCGTAAAGGGATTGAAGAAGCCTATCGCACTGGTCGTGGTAAA
GTGTATGTTCGTGCTCGTGCAACCGTAGAAACCAACGAAAAAGGACGCGAGCAAATTATCGTGTCTGAATTGCCATACCA
AGTAAATAAAGCAAAATTAGTCGAGAAAATCGCCGAATTAATTCGCGAGAAAAAAATCGAAGGTATCAGCAATATTACTG
ACCTTTCAAATAAAGAAGGGATCCGTATTGAAATTGATATTAAACGTGATGCAGTGGGGGAAGTGGTATTAAACCATCTT
TACTCACTCACTCAAATGCAAGTGACCTTTGGTATCAATATGGTGGCATTGGATCACGGTCAGCCACGTTTATTTAATCT
TAAAGAAATTATTGAAGCCTTTGTTTTACACCGCCGTGAAGTCGTTACACGTCGTTCTATCTTTGAGCTTCGCAAAGCAC
GTGAACGTACGCATATTTTGGAAGGTTTAGCGGTTGCTCGTTCTAATATCGATGAAATGATTGCGATCATTCGTAACTCT
AAAAACCGTGAGGAAGCGGCAACAGCAATCAGTTCACGCTCTTGGACGTTACATAGCGATATTATTAATCTTCTTGATGC
TTCTGCTCGTCCTGATGAGTTAGAAGAAAATCTTGGTATTCAAGGCGAACAATATTACTTATCGCCAGCGCAAGTAAACG
CAATTCTAGAACTTCGTTTACACCGTTTAACGGGCATTGCGTTTGAAGAAGTTATAAAAGAATATGAAGAATTATTAGTT
AAAATTGCGGATCTTCTTCATATTTTAAGTAGCGCAGAACGTTTAATGGAAGTAATTCGTGAAGAATTGGAAGAAGTAAA
AGCACAATTTGGTGATGATCGTTTAACTGAAATTACCGCTGCTTCTGGCGATATTGATTTAGAAGATTTAATCGCACAAG
AAGACGTGGTTGTGACGCTTTCTCACGAAGGTTATGTGAAATACCAACCACTGACTGACTATGAAGCACAACGCCGTGGC
GGTAAAGGCAAATCTGCAACGAAGATGAAAGAAGAAGATTTCATCGAAAAATTACTGGTAGCAAATACTCACGATACCAT
CCTCTGCTTCTCTAGCCGTGGTCGTTTATATTGGTTGAAAGTATATCAACTTCCGCAAGCGAGCCGTGGCGCACGCGGGC
GTCCAATTGTGAATATTCTTCCGTTACAAGAAAACGAACGTATTACTGCAATCTTGCCAGTTTCTGCTTACGAAGAAGAT
AAATTCGTAGTCATGGCAACTGCTGGCGGTATTGTGAAGAAAATCGCCTTAACCGAATTTAGCCGTCCACGTTCAAACGG
TATCATCGCATTGAATTTACGTGACGAAGATGAATTAATCGGCGTGGATATTACTAATGGCAGCAACGAAATTATGTTGT
TCTCATCGCAAGGTCGCGTGGTGCGTTTTGCTGAAAATGCCGTGCGTGCAATGGGGCGTTTAGCAACAGGTGTTCGCGGT
ATCAAACTGGCTTTAACAAACGATATTTCTGACGATGAAAGTGCGGTAGAAATTGAAGATATTTCTGATGACAACGCTGA
AGCATCATTAGACTTAAATATCGATAAAGTGGTTTCTCTCGTTGTGCCAAAAGGTGAAGGGGCAATTTTAACCGCAACAC
AAAACGGCTACGGAAAACGCACACAATTAAGTGAATACCCAACTAAATCACGTAATACAAAAGGTGTGATTTCGATTAAA
GTGAGTGAACGCAATGGTAAAGTCGTTGCCGCAACTCAAGTAGAAGAAACAGACCAAATTATGTTGATCACTGATGCAGG
AACGCTTGTTCGCACACGCGTAAGCGAAGTGAGCATTGTAGGGCGTAACACGCAAGGTGTCCGTTTAATTCGTACCGCAG
ATGATGAACACGTAGTAAGTTTAGAGCGTGTTTGTGATGCGGATGAAGAAGATTCTTTGGAAGAAAGTAGTTCTGAAGAA
TAA

>>MEG_3204|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAAGATCATTTAGTCAATGAAACAAAAAATATTGTAGAAGTGGGGATTGATTCTTCTATTGAAGAGAGCTATTTGGC
TTATTCCATGAGCGTGATCATAGGGCGCGCCTTACCGGACGCTAGAGACGGCTTAAAGCCTGTGCATAGGCGTATTTTGT
ATGCGATGCATGAATTAGGCCTTACTTCCAAAGTCGCTTATAAAAAAAGCGCTAGGATCGTGGGTGATGTGATTGGTAAA
TACCACCCTCATGGCGATAACGCAGTTTATGATGCGTTGGTGAGAATGGCGCAAGATTTTTCTATGCGCTTGGAATTAGT
GGACGGGCAGGGCAACTTTGGCTCTATTGATGGCGATAACGCCGCAGCGATGCGTTACACTGAAGCCAGAATGACCAAGG
CGAGTGAAGAAATTTTAAGGGATATTGATAAAGACACCATTGATTTTGTACCTAATTACGATGACACTTTAAAAGAGCCG
GATATTCTACCAAGCCGTCTGCCTAACCTTTTAGTCAATGGGGCTAATGGGATCGCCGTAGGGATGGCGACTTCTATCCC
CCCCCACAGGATTGATGAAATCATAGACGCTTTAGCGCATGTCTTAGAAAACCCTAACGCTGAATTAGATGAAATCTTAG
AATTTGTCAAAGGGCCTGACTTTCCTACTGGTGGGATCATCTATGGCAAGGCGGGTATTGTTGAAGCCTATAAAACGGGG
CGAGGGCGCGTGAAAGTGCGGGCCAAAGTGCATGTGGAAAAGACAAAAAATAAAGAAATCATCGTTTTAGATGAAATGCC
TTTTCAAACCAATAAAGCCAAATTAGTGGAACAAATCAGCGATTTAGCACGAGAAAAACAAATTGAAGGCATTAGCGAAG
TGCGCGATGAGAGCGATAGAGAGGGAATTAGAGTGGTGATTGAATTAAAAAGAGACGCGATGAGTGAAATTGTCTTAAAC
CACCTTTACAAACTCACCACCATGGAGACCACTTTTAGCATCATTTTACTCGCTATTTACAATAAAGAGCCTAAGATTTT
CACGCTTTTAGAGTTGTTGCGCCTTTTCTTAAACCACAGAAAGACCATTATTATAAGACGCACGATTTTTGAATTAGAAA
AGGCTAAGGCCAGAGCGCATATTTTAGAGGGCTATCTGATCGCCTTGGACAATATTGATGAAATCGTGCGACTCATTAAA
ACAAGCCCAAGCCCAGAAGCGGCTAAAAACGCCTTAATGGAGCGTTTTAGTTTGAGCGAGATCCAAAGCAAAGCCATTTT
AGAAATGCGTTTGCAACGCTTGACAGGCCTTGAAAGGGATAAGATCAAAGAAGAATACCAAAACTTATTAGAGCTTATTG
ATGATCTCAATGGGATTTTAAAGAGCGAAGATCGCTTGAATGAAGTCGTCAAAACAGAGCTTTTAGAAGTCAAAGAGCAG
TTTTCTTCTCCAAGGCGCACTGAAATTCAAGAATCTTACGAAAGCATTGACACAGAAGATTTGATCGCTAATGAGCCTAT
GGTAGTGAGCATGAGCTATAAAGGCTATGTGAAAAGAGTGGATTTAAAAGCCTATGAAAGGCAAAATCGTGGCGGTAAAG
GCAAGCTTTCAGGCAGCACTTATGAAGACGATTTCATTGAAAACTTTTTTGTGGCTAACACGCATGATATTTTGCTCTTT
ATCACCAATAAGGGGCAATTGTATCATTTGAAAGTCTATAAAATCCCAGAAGCGAGCCGGATCGCTATGGGTAAAGCTAT
TGTGAATTTAATCTCACTCGCTCCTAATGAAAAGATCATGGCAACCCTAAGCACTAAAGATTTTAGCGATGAACGCTCTT
TAGCTTTCTTCACAAAAAATGGCGTGGTGAAGCGCACCAATTTGAGCGAATTTGGCGGTAATAGGAGTTATAGCGGTATC
AGAGCGATTGTTTTAGATGAAGGCGATGAATTAGTGGGCGCAAAAGTTGTGGATAAAAACGCTAAGCATTTGCTCATCGC
ATCTTATTTGGGCATGTTCATTAAATTCCCTTTAGAAGACGTGCGCGAAATAGGAAGAACTACTCGTGGGGTTATGGGTA
TTAGACTGAATGAAAATGATTTTGTTGTCGGCGCGGTCGTCATTAGCGATGATAGCAACAAGCTTTTGAGCGTGAGCGAA
AACGGGCTTGGCAAGCAAACTTTAGCCGAAGCGTATAGAGAGCAATCTCGTGGAGGTAAGGGGGTCATTGGCATGAAGCT
CACTCAAAAGACCGGTAATTTGGTGAGCGTTATCAGCGTGGATGATGAGAACCTGGATTTAATGATCCTTACTGCGAGCG
CGAAAATGATCAGAGTTTCCATTAAAGACATTAGAGAAACCGGAAGAAATGCCAGTGGGGTAAAACTCATAAACACCGCT
GATAAAGTCGTGTATGTCAATTCTTGCCCTAAAGAAGAAGAGCCAGAAAATTTAGAAACCTCACGTGCGCAAAATTTGTT
TGAGTGA

>>MEG_3205|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCCAGAGAAATTACACCGGTCAACATTGAGGAAGAGTTAAAGAACTCCTATCTGGATTACGCGATGTC
GGTTATTGTCGGCCGCGCGCTTCCGGATGTCCGAGATGGCCTCAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TGTTGGGCAATGACTGGAATAAAGCCTACAAAAAATCCGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGTGATTCCGCCGTTTACGATACCATTGTACGTATGGCTCAGCCGTTCTCGCTGCGTTATACGCTGGTGGATGGTCAGGG
CAACTTCGGTTCTATCGACGGCGACTCCGCCGCGGCGATGCGTTATACGGAAATCCGTCTGGCGAAGATCGCCCATGAAC
TGATGGCCGACCTCGACAAAGAAACCGTTGATTTTGTAGACAACTATGACGGCACGGAAAAAATCCCTGACGTCATGCCG
ACCAAAATCCCGAACCTGCTGGTAAACGGTTCATCCGGTATCGCCGTCGGGATGGCGACGAACATTCCGCCGCATAACCT
GACGGAAGTGATTAACGGCTGCCTCGCGTATATCGATGATGAAGATATCAGCATCGAAGGGCTGATGGAGCACATTCCTG
GCCCGGATTTCCCGACGTCCGCCATTATCAACGGCCGTCGCGGCATTGAAGAGGCGTATCGCACCGGGCGCGGCAAAATC
TACATTCGCGCGCGCGCGGAAGTGGAAGTCGATCCGAAAAACGGCCGCGAAACCATTATCGTGCACGAAATTCCGTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGACAAACGCGTCGAAGGCATCAGCGCGCTGCGCG
ACGAGTCTGACAAAGACGGTATGCGCATCGTCATTGAGATCAAACGCGACGCCGTCGGCGAAGTGGTGCTCAATAATCTC
TATTCCCAGACGCAGCTTCAGGTGTCTTTCGGTATCAACATGGTCGCGCTGCACCACGGTCAGCCGAAGATCATGGCGCT
GAAAGAGATTCTGGCGGCGTTCGTTCGCCACCGTCGTGAAGTCGTGACCCGCCGCACCATCTTTGAACTGCGCAAAGCCC
GCGAGCGTGCGCATATCTTAGAAGGTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATTGAGCTGATTCGCCGCGCG
CCGAACCCGTCCGAAGCGAAAGCGGGCCTCATCGCCCAGGCGTGGGAGCTGGGCACCGTTTCCGCGATGCTGGAGCGCGC
CGGCGACGACGCCGCGCGTCCGGAATGGCTGGAGCCGGAGTTCGGTATTCGCGATGGCAAATACTGGCTGACCGAGCAGC
AGGCACAGGCGATCCTCGATCTGCGTCTGCAGAAACTCACCGGCCTTGAGCATGAAAAACTGCTCGACGAGTATAAAGAG
CTGCTGGAGCAGATCGCTGAGCTGCTGCATATCCTCGGCAGCGCCGACCGCCTGATGGAAGTAATCCGCGAAGAGCTGGA
GCTGATCCGCGATCAGTTCGGCGATGAGCGCCGCACCGAAATCACCGCCAACAGCGCCGATATCAACATCGAAGATCTGA
TCAACCAGGAAGATGTGGTGGTCACCCTGTCTCACCAGGGCTATGTGAAGTATCAGCCGCTGACGGATTACGAAGCGCAG
CGCCGCGGCGGTAAAGGCAAATCCGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCCAACACCCA
CGATACGATCCTCTGCTTCTCAAGCCGTGGACGTCTCTACTGGATGAAAGTCTACCAGTTGCCGGAAGCGAGCCGCGGCG
CCCGCGGACGTCCTATCGTCAACCTGCTGCCGCTGGAAGCGAACGAGCGTATCACCGCGATTCTGCCGGTACGCGAGTAT
GAAGAAGGCGTTAACGTCTTTATGGCGACCGCGAGCGGCACCGTGAAGAAAACGGCGCTGACCGAGTTCAGCCGTCCGCG
TACCGCCGGTATCATCGCGGTGAACCTGAACGAGGGCGATGAGCTGATCGGCGTCGACCTGACCGCAGGTAAAGACGAAG
TGATGCTGTTCTCCGCGCAGGGCAAAGTGGTGCGCTTCAAAGAAGACGCGGTGCGTCCGATGGGTCGTACCGCCACTGGC
GTGCGCGGTATTCGCCTCGGCGAGGGCGACAGCGTTGTGTCGCTTATCGTACCGCGCGGCGAAGGCGCTATCCTGACCGC
CACCCAGAACGGTTACGGCAAGCGTACCGCGGTGGAAGAGTACCCGACCAAGTCGCGCGCGACGAAAGGGGTTATCTCCA
TCAAGGTGACCGATCGCAACGGGCCGGTCGTCGGCGCGGTGCAGGTCGATGACGCAGACCAGATCATGATGATCACCGAT
GCCGGCACCCTGGTGCGTACGCGCGTATCGGAAATCAGCGTGGTGGGCCGTAACACCCAGGGCGTTATCCTCATCCGCAC
CGCGGAAGATGAAAACGTGGTGGGTCTGCAACGTGTCGCCGAACCGGTAGATGACGAAGAGCTCGACTCTATCGACGGCA
GCGTGGCGGAAGGCGACGATGAAATCGCGCCGGAAACCGACGTTGACGACGACGCGGCGGACGACGCCGACGAGTAA

>>MEG_3206|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCCGACGAGAACACCCCCGTCACCCCCGAAGAGGGCGGCGAACTCGTGATGCGTGTCGAGCCCGTCGGGCTTGAGAC
GGAGATGCAGCGCTCGTACCTGGACTACGCGATGTCCGTCATCGTGTCCCGTGCGCTGCCCGACGTCCGGGACGGTCTCA
AGCCCGTCCACCGCCGTGTGCTGTACGCGATGTACGACGGCGGCTACCGCCCCGAGCGCGGCTTCTACAAGTGCGCCCGT
GTCGTCGGCGACGTCATGGGCAACTACCACCCGCACGGCGACTCCTCCATCTACGACGCCCTGGTGCGCCTCGCCCAGCC
GTGGTCGATGCGGATGCCGCTGGTGGACTCCAACGGCAACTTCGGCTCCCCGGGCAACGACCCCGCGGCGGCCATGCGCT
ACACCGAGTGCAAGATGGCGCCGCTGTCGATGGAGATGGTCCGGGACATCGACGAGGAGACCGTCGACTTCACGGACAAC
TACGACGGCCGCTCCCAGGAGCCGACCGTCCTGCCGGCCCGCTTCCCGAACCTGCTGATCAACGGCTCGGCCGGTATCGC
GGTCGGCATGGCCACCAACATCCCGCCGCACAACCTGCGCGAGGTCGCGGCCGGCGCCCAGTGGTACCTGGAGAACCCCG
AGGTCTCCCACGAGGAGCTGCTGGACGCGCTCATGGAGCGCATCAAGGGCCCCGACTTCCCGACCGGCGCCCTGGTGGTG
GGCCGCAAGGGCATCGAGGAGGCGTACCGCACCGGCCGCGGCTCCATCACGATGCGCGCGGTGGTCGAGGTCGAGGAGAT
CCAGGGCCGCCAGTGCCTGGTGGTCACCGAGCTGCCGTACCAGGTGAACCCGGACAACCTGGCGCAGAAGATCGCCGACC
TGGTGAAGGACGGCAAGATCGGCGGCATCGCGGACGTCCGCGACGAGACCAGCTCGCGCACCGGCCAGCGCCTGGTGATC
GTCCTGAAGCGGGACGCGGTCGCCAAGGTCGTGCTGAACAACCTGTACAAGCACACGGACCTCCAGACGAACTTCGGCGC
CAACATGCTGGCGCTGGTCGACGGCGTGCCGCGCACCCTGTCCCTGGACGCGTTCATCCGCCACTGGGTGACGCACCAGA
TCGAGGTCATCGTCCGCCGGACCCGGTTCCGGCTGCGCAAGGCCGAGGAGCGCGCCCACATCCTGCGCGGTCTGCTGAAG
GCCCTCGACGCCATCGACGAGGTCATCGCGCTGATCCGGCGCAGTGAGACCGTCGAGATCGCGCGCAGCGGCCTGATGGG
CCTCCTGGAGATCGACGAGATCCAGGCGAACGCCATCCTTGAGATGCAGCTGCGCCGGCTGGCGGCCCTGGAGCGGCAGA
AGATCGTCCAGGAGCACGACGAACTCCAGGCGAAGATCAACGAGTACAACGAGATCCTCGCCTCGCCGGTGCGCCAGCGC
GGGATCGTCAGCGAGGAGCTGGCCGCGATCGTCGAGAAGTACGGCGACGACCGCCAGACCAAGCTGATCCCGTACGAGGG
CGACATGTCCATCGAGGACCTGATCGCCGAGGAGGACATCGTCGTCACCGTCACGCGCGGCGGCTACGTCAAGCGGACGA
AGACGGACGACTACCGGGCGCAGAAGCGCGGCGGCAAGGGCGTGCGCGGCACGAAGCTGAAGGAAGACGACATCGTCGAC
CACTTCTTCGTCTCCACCACGCACCACTGGCTGCTGTTCTTCACCAACAAGGGCCGGGTGTACCGGGCGAAGGCGTACGA
GCTGCCCGAGGCCGGCCGGGACGCGCGCGGCCAGCACGTGGCGAACCTGCTCGCCTTCCAGCCGGACGAGGCGATCGCCG
AGATCCTGGCGATCCGTGACTACGAGGCGGCGCCGTACCTGGTGCTGGCCACCAAGTCGGGCTTGGTCAAGAAGACGCCA
CTGAAGGATTACGATTCGCCTCGCTCCGGCGGTGTCATCGCCATCAACCTGCGGGAACGCGAGGACGGTTCGGACGACGA
GCTGATCGGCGCCGAGCTGGTCTCGGCGGACGACGATCTGCTGCTGATCAGCAAGAAGGCGCAGTCGATCCGGTTCACCG
CCTCGGACGAGTCCCTGCGCCCGATGGGCCGCGCCACCTCCGGCGTCAAGGGGATGAGTTTCCGGGAGGGCGACGAGCTT
CTCTCGATGAATGTGGTGCGACCCGGTACGTTCGTGTTCACTGCCACCGACGGTGGGTACGCGAAGCGGACCGCCGTCGA
CGAGTACCGCGTCCAGGGCCGCGGCGGCCTCGGCATCAAGGCCGCCAAGATCGTGGAGGACCGTGGTTCGCTCGTCGGCG
CGCTGATCGTCGAGGAGAACGACGAAATCCTCGCGATCACCCTCTCCGGCGGTGTGATTCGCACGCGAGTCAGCGAGGTC
AGGGAGACGGGCCGTGACACCATGGGCGTCCAACTGATCAATCTGGGCAAGCGCGATGCCGTGGTCGGTATCGCACGTAA
CGCCGAAGCGGGGCGCGAGGCGGAGGAAGTCGACGGCGACGTGGCCGTGGACGAGACCGCCGAGGGTGCCGCGATCACCG
GCACGGACGAGGGTGAGGCACCCTCGGCCGAGTAG

>>MEG_3207|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCTACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAACTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACGCCACTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>>MEG_3208|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACATTGCCAGAGAAATCACACCAGTTAATATCGAAGAAGAGCTGAAAAGCTCATATTTGGATTATGCGATGTC
CGTTATTGTAGGACGCGCATTACCCGATGTTCGAGACGGACTGAAGCCAGTACACCGCCGAGTGCTATTTGCGATGAATG
TACTGGGAAACGATTGGAATAAACCTTATAAAAAATCAGCCCGTGTTGTTGGGGATGTAATCGGTAAATATCACCCGCAC
GGTGACAGTGCTGTCTATGAAACGATTGTTCGTTTAGCACAGCCTTTTTCTATGCGCTACATGTTGGTTGACGGTCAGGG
TAACTTCGGGTCAGTTGATGGTGACTCCGCGGCGGCTATGCGTTATACCGAAGTTCGTATGGCGAAGATCGCCCATGAAC
TGCTGGCGGATTTGGAAAAAGAGACGGTCGACTTTGTTCCTAACTATGATGGAACAGAAAATATACCGGCTGTTATGCCA
ACCCGTATTCCAAACTTGTTAGTTAATGGCTCTTCAGGTATTGCCGTTGGGATGGCAACGAATATCCCTCCGCATAACCT
CGGTGAAGTTATCGACGGTTGTCTTGCCTATGTTGATAATGAAGACATCACCATAGAAGAATTAATGGAATATATTACCG
GGCCTGATTTTCCGACTGCTGCGATTATTAATGGTCGCAGAGGAATATTAGATGCTTATCGTACAGGGCGTGGAAAGATT
TATATCCGTGCTCAGGCTGATATTGAAACTGATGAGAAAACAGGTCGCGAAACCATTATCGTGACAGAAATTCCTTATCA
GGTGAATAAAGCCCGTTTAATTGAAAAAATTGCGGAGCTTGTAAAAGATAAACGTATTGAAGGTATCAGCGGATTACGTG
ACGAGTCTGATAAAGACGGTATGCGTATTGTTGTTGAGATCAAACGTGATGCAGTCGGTGAAGTAGTATTAAATCACCTC
TTTTCACAAACTCAAATGCAAGTCTCTTTTGGTATTAATATGGTTGCGCTTCATCAAGGCCAACCAAAATTATTGAACCT
AAAAGAAATTATCGCAGCCTTTATTCGCCATCGTCGTGAAGTGGTGACTCGTCGTACCATTTTTGAATTACGTAAAGCAC
GTGATCGTGCTCATATCTTAGAAGCACTTGCGGTCGCTTTGGCCAATATCGATCCTGTGATTGAATTAATTCGTCAAGCA
CCAACCCCAGCAGAAGCGAAAGCGGCATTAATTGCCCAACCTTGGGATCTCGGTAGCGTGTCTACGATGTTAGAGCGTGC
TGGTGATAGCAATGTTGCTCGCCCTGAGTGGTTAGAGCCACAATTTGGTGTGCATGACGGTAAATACTATCTAACAGAAC
AACAAGCACAAGCCATTTTAGATTTGCGGTTGCAGAAACTGACCGGACTTGAGCATGAAAAACTGCTAGATGAATATCGT
GAATTACTGCTACAAATTGCTGAGTTATTGCATATTTTGAGAAGCCCTGAGCGTTTAATGGACGTTATTCGTGAAGAGCT
AACAGCAATTAAAACACAATATAACGATCCTCGTCGTACTGAAATCACTGAAAATACCGCTGATATTAATATCGAAGATC
TGATTAATGAAGAAAATGTGGTTGTGACACTATCTCACCAAGGTTACGTTAAATATCAGCCATTGACTGATTATGAAGCG
CAACGTCGTGGAGGAAAAGGTAAGTCAGCCGCAAGGATCAAAGAAGAAGACTTTATCGATCGCCTACTGGTGGCTAATAC
ACACGATACTATTTTGTGTTTCTCAAGTCGTGGTCGCCTGTACTGGATGAAAGTTTATCAGTTACCAGAAGCGAGCCGCG
GTGCTCGTGGTCGCCCAATTATCAATTTGTTACCTCTAGAACAAGATGAGCGGATCACCGCTATTCTTCCAGTAAGAGAG
TATGAAGAAGGTAAATTTGTCTTTATGGCAACGGCGAGCGGTACGGTTAAAAAGACACCATTACAAGACTTCAGTCGTCC
TCGTAGTGCCGGTATTATCGCGGTTAATTTAAATGATGGCGATGAGCTTATCGGTGTTGATTTAACCGACGGTAGTAATG
AAGCTATGCTGTTCTCAGCAGATGGTAAAGTGGTTCGTTTCGCAGAAGAGTGTGTTCGTCCAATGGGTCGTACTGCGACA
GGTGTTCGTGGTATGAAACTGGTTGATGATGATAAAGTGGTTTCACTGATCATTCCTCGTGGCGAAGGTGATATCTTAAC
AGTGACTGAAAACGGTTATGGTAAACGTACCGTTCAAAGTGAATACCCAACCAAAAACCGTGCAACACAAGGCGTTATCT
CGATTAAAGTGAGTGAGCGTAATGGTAAAGTGGTAGGCGCTATTCAAGTTGAAGAAACTGACCAGATTATGATGATCACC
AATGCCGGAACGTTAGTGCGTACCCGAGTATCAGAAGTCAGCATTGTGGGACGTAATACACAAGGTGTTACCTTGATCCG
TACTACAGAAGACGAGCTAGTCGTTGGCTTACAACGTGTTGAAGATGAAGATGATGCGTTAGATGATGATGAAGTTGATG
AAATGATCAGCGACAATATCTCTGATGTTCCAGAGTCTGAACCAACAGATGATGCGGATAGTGAAGAAGAATAA

>>MEG_3209|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGTATACCTAGCCAAAGAAGTCTTACCAGTCAACATAGAAGACGAATTGAAGCAATCCTATTTGGATTATGCGATGAG
TGTCATTGTAGGCCGAGCATTGCCTGATGTACGTGATGGTTTAAAACCGGTGCATAGGCGAGTTCTTTTTGCGATGAGCG
AGTTGGGTAATGATTGGAATAAACCTTATAAAAAATCTGCTCGTGTAGTAGGGGATGTCATCGGTAAATACCATCCTCAT
GGGGATACAGCTGTTTATGACACTATTGTTCGTATGGCTCAGCCCTTTTCCATGCGTTATATGCTGATTGATGGGCAGGG
TAATTTTGGTTCTGTAGACGGAGATGCTCCAGCTGCCATGCGTTACACTGAAGTACGAATGTCCAAGGTGGCGCATGCTT
TACTGGCTGATTTGGATAAGGAAACCGTTGATTTTAGTCCTAACTATGATGAAACAGAATTTGCTCCAGTGGTATTGCCA
TCGAGAATTCCCAATTTACTAGTTAATGGCTCTTCCGGTATTGCGGTAGGGATGGCTACTAATATTCCACCACATAATCT
TACCGAAGTAATCAATGCATGTATTGCCTTAGTGGATGAACCTGACACGAGTCTTGAAGATTTAATGGAAATTATTCCTG
GCCCTGATTTTCCTACAGCAGCAATTATTAATGGTCGTGCTGGAATTATTGAAGGTTATCGTACTGGAAAAGGGCGGGTT
GTTATCAGGGCACGCACAGAAATTGAAACGGATGAAAGTTCAGGACGTCAGTCAATTATTATTCAGGAATTACCCTATCA
GGTGAATAAAGCGCGTTTGATCGAGCGTATTGCTGAATTGGTAAGAGACAAGAAAATCGAAGGAATTTCCGGCTTGAGGG
ATGAGTCAGATAAGCAGGGAATGAGAGTAGTCATTGAGTTAAAACGCAATGAAGTAGCAGATGTGGTATTGAATAACCTG
TTCGCTCATACTCAAATGCAAAATGTATTCGGGATTAATATGGTTGCCCTGGTGGATGGCCAACCGCGTACTTTGAATTT
GAAGCAAATACTGGAATATTTTATAAAACATCGAAGAGAGGTTGTTACCAGACGCACAATATTTGAATTGAAAAAAGCCA
GAAATCGAGCCCATTTATTGGAGGGCTTGGGAATCGCCTTGGCTAATATCGATGAAATGATCGCATTAATTAAGCAATCT
TCTACTCCTCAAGACGCAAAAAGTGCTTTATTAAGCAAAATATGGCAACCTGGCTTGGTAAAGGCCATGTTGGAAAAGGC
TGGCTCAAACGCGTCAAGGCCTGATGATTTAACTGAAGAGTATGGTTTGCATGAGAACGGATATAAATTATCTGAAGCGC
AGGCACAAGCAATACTTGAATTAAGATTACATAGGCTAACAGCTCTTGAACAAGATAAAATAATTAATGAATTTGAAGAG
CTATTGAATTTAATTAAAGAATTGCTTGACATATTGGCTTCACCTGAAAGACTTATGCAAGTTATTCGTGATGAATTGAT
AGAGATTAAATCCCAATTTGGTGATGAGAGGCGAACGGAAATAACAGCCTCACAAGAAGATTTGACTATTGAAGATTTGA
TTACCGAAGAAGACGTTGTGGTCACTTTATCTCATCAAGGTTATGTAAAATATCAGCCCATTACAGCCTATCAGGCTCAG
CGCCGAGGTGGCAAAGGCAAATCGGCAACTCATGTCAAGGATGAGGATTTTGTTGAGCGTTTGGTTATTGCGAGTACTCA
TGACACCTTATTATGTTTCTCCAATCATGGCAAATTATATTGGCTAAAAGCATATCAATTGCCTCAAGCAAGCCGTGCTT
CGAGAGGAAGGCCTATAATCAATATTCTTCCTTTGGCTGAAGGCGAAGAGATTAATGCTATGCTCCCTGTCCGTGAGTAT
AAAGACGGCAGCTATGTATTTATGGCAACCAAGAAGGGAACAGTTAAAAAAGTGCCTTTAAACGCATTTAGCAGGCCGCG
TTCCAATGGTATTATTGCTGTGGACCTGGAAGAGGATGACAGTCTCGTTGGAGTGGATATTACTGATGGTGCTCGCGATA
TTATGTTGTTTACTGATGCAGGCAAAGTGATCCGCTTTGATGAAAGTAAAGTGCGACCTATGGGGCGCACGGCTCGAGGA
GTTCGTGGAATTAGGGTAGAAAAGGATCAAGCCGTTAAATCTCTTGTGGTAGTCGATCCAAGTGGAGGCACCATTTTGAC
GGCAACTGAAAACGGCTACGGCAAGAGAACTCATATTGATGAATATCGAGTGTCAGGACGGGGCGGGCAAGGTGTTATTT
CCATTCAGGTTACTGAACGAAATGGTAAAGTGGTCCGCTCCTTGCAGGTTACCGATAATGACGAAGCCATGTTAATTACA
GATAAAGGGACTTTGGTTCGTTTTAAAGTCAATGAATTATCTGTGATAGGCCGAAATACACAAGGAGTTCGTCTGATTAA
TGTCAGTTCTGGTGAGGCAGTTGTTGGAATGCAAAAAATTGTAGATCTTGGAGAAGAATTAGAAGAGGCAGAAGACTCAT
CCCTTAATGCTGAAGACAGCAGTGATGAATAG

>>MEG_3210|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
GTGGCACAGCCAGAATTATTTCATGATTTACCGTTAGAAGAAGTAATCGGCGACCGTTTCGGACGCTACAGTAAATACAT
TATTCAAGACAGGGCGCTGCCCGACGCTCGTGACGGTTTAAAGCCGGTGCAGCGGAGAATTTTATACGCCATGCACGCGG
ACGGAAATACATTCGATAAAAATTTCCGTAAAGCGGCGAAAACGGTCGGAAACGTTATCGGTAATTATCATCCGCACGGT
GACAGCTCTGTTTATGAAGCGATGGTGCGGATGAGCCAGGATTGGAAAGTGCGGAATGTGCTGATTGAGATGCACGGCAA
CAATGGAAGCATTGACGGTGATCCGCCGGCTGCCATGCGTTATACGGAAGCGAGATTATCTTCTATCGCGTCAGAGCTTT
TGCGTGACATCGATAAAAATACGGTTGAATTCGTTCCGAACTTTGATGACACTAGTAAAGAACCGGTTGTTTTGCCCGCC
ATGTTCCCTAACTTGCTTGTCAACGGATCAACCGGGATTTCAGCGGGCTATGCGACTGATATTCCCCCTCATCATCTGGG
TGAGGTCATTGATGCCGTCATTAAACGGATTGAATCTCCGGATTGCACCGTCGATGACTTGATGCAGGTGATTAAAGGGC
CTGACTTTCCGACAGGAGGCATTATTCAAGGAGTCGACGGCATTCGGAAGGCTTATGAAACCGGGAAAGGCAAAATTATT
ATCCGCGGCAAGGCTGAAGTGGAATCCGTAAGAGGTGGACGGGAGCAGATCGTCATTACAGAAATTCCGTTTGAAGTAAA
CAAAGCCAATCTCGTAAAGAAAATGGACGAATACCGCATAGACAAAAAAGTCGAAGGCATTTCTGAAGTCCGGGATGAAA
CTGACCGCACGGGGCTTCGGGTCGTCGTTGAGTTAAAGAAAGAAGCCGATGCAAAAGGCATTTTGAATTTCTTATATAAA
AACACTGATCTGCAGACAACTTATAACTTTAATATGGTCGCCATACATAACCGCCGGCCGATGCTGATGAGTCTTACGGC
CATCCTGGATGCGTATATTTCCCATCAGAAGGAAGTGGTGACAAACCGCTCCGTCTTTGAATTGCAAAAAGCAAAAGAGC
GGCACCACATCGTTGAAGGACTGATGAAGGCACTGTCTGTGTTAGATGAGGTCATAGCCGTCATCCGGGCAAGCAGCGAC
AAGAAAGATGCGAAACAAAACGTAATGTCTAAATTCACATTTACGGAGCCGCAGGCCGAAGCGATCGTATCCTTGCAGCT
GTATCGTCTGACAAACACGGATATTACGGCGCTAAAAGAGGAAGCGGAAGAGCTCAGCAAGAAAATTCAGGAGCTCGAAG
CCATTTTAAGTCATGATAAAAAGCTGTTAAAAGTCATTACAAGCAGCCTGAAAAAATTGAAAAAGACCTATGCTGACAGC
AGACGGTCTGTCATTGAAGAAAAGATTGAGGAAATTAAAATCAATCTTGAAGTCATGGTTGCCTCTGAGGACGTATATGT
GACAGTCACAAAAGACGGCTATGTAAAACGAACAAGTCAGCGGTCATTTGCCGCTTCTAACGGCCAGGATTTCGGTATGA
AGGATACTGACAGGCTGATTCACCAATTTGAAATGAATACAACGGATGTTCTCCTGCTCTTTACCAATAAGGGAAGCTAT
GTTTATTGTCCGGTTCACCAGCTTCCCGATATCAGGTGGAAAGACATGGGGCAGCACGTAACGAACATCATCACGATTGA
CCGTGATGAAACCATCGTGAAAGCTATACCGGTAAAAGAATTTGATCCATCTTCATATTTATTGTTTATGACGAAAAACG
GCATGGTGAAAAGAACTGAAATGACGCATTACAAAGCGCAGCGTTACTCGAAAGCGCTTGTTGCCCTTAACCTTAAAGGG
GACGACGAGCTGATTGATGTTCATGTCACAGACGGCGGCAGCCAGCTGTTTATCGCCACCCGTCTCGGGTACGGTTTATG
GTTCGGTGAAGATGAAGTAAATGTAGTCGGTGCCCGTGCGGCCGGCGTAAAGGGCATAAATGTAAAAGACGGTGATACCG
TCGTATCAGGACAAATCCTGCATGAGACAGATTCGCTTGTCCTTGTCACACAGCGGGGAGCAATCAAGCGGATGAACCTA
TCTGAATTCGAAAAAACATCCAGGGCGAAGCGCGGTGTCATCATGCTGCGTGAGCTTAAAAAGAACCCGCATCGCGCAGT
CGGCGTATTCGCGTGCGCTTTAGCCGACATGATCGCTGCGGAAACAGAAAAAGGCGAGAGAATCGAAATCGCCGTGAAGT
CCTTGCGGGCGAATGACCGATACAGCAACGGCTCCTTCTTTACCGATGAAGATGAGACAGGGCCGGTAACAGACGTATGG
CGTATCCCCGCGTCTGATGTTTAA

>>MEG_3211|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAAT
GAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACC
CGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGA
CACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAAT
GGAAATCCTCCGGGATATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCA
TGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCAT
CAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGCGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACAT
CCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGAT
CAATCACAATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTAT
CAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACGGATCTGCG
AGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACC
TGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTTGACGGACAGCCGAAGGTACTAAGC
CTGAAACAATGTCTGGAGCATTATCTTGATCACCAAAAGGTTGTGATCCGGCGCAGAACGGCTTACGAACTCCGCAAAGC
GGAAGCGAGAGCTCACATTCTGGAAGGTTTAAGAATTGCTCTCGATCATTTAGATGCCGTTATTTCTCTTATCCGCAATT
CCCAGACGGCTGAAATTGCGAGAACAGGTTTGATCGAACAATTCTCACTGACTGAAAAACAAGCGCAAGCCATTCTGGAT
ATGCGCCTTCAGCGATTAACCGGTCTGGAGCGCGAAAAGATTGAAGAGGAATATCAATCACTTGTTGCGCTTATCGCCGA
GCTGAAAGATATTTTAGCCAATGAAGCAAGAGTTCTTGAGATCATTCGTGAAGAGCTCAATGAAATCAAAGAGCGTTTCA
ATGATGAGAGACGCACTGAAATCGTGACGTCCGGTCTTGAAACAATTGAAGATGAAGATCTTATCGAGAGAGAAAATATC
GTCATCACACTGACCCATAACGGCTATGTTAAACGGCTCCCAGCGTCCACATACCGCAGCCAAAAACGGGGCGGAAAAGG
CGTACAGGGAATGGGAACGAATGAAGATGACTTTGTGGAACATTTAATTTCCACATCAACGCACGATACGATCCTGTTCT
TCTCTAATAAAGGGAAGGTATACCGTTCTAAAGGATATGAAATCCCTGAATACGGCCGTACGGCAAAAGGCATTCCGATT
ATTAACCTTCTGGAGGTTGAAAAAGGCGAATGGATTAATGCCATTATTCCGGTCAGCACGTTTGATGAGGAGCAATACCT
CTTCTTTACGACCAAACAAGGGGTGTCGAAACGTACGGCACTGTCCCAGTTTGCGAATATACGGAATAACGGGCTGATCG
CCCTAGGTCTCCGGGAAGACGATGAACTGATGGCCGTCCGCCTGACTGACGGCAAGAAACAAATCATCATCGGAACGAAG
AACGGTTTGCTGATCCGTTTCCCTGAAGAAGATGTAAGACAAATGGGACGCACAGCTGCGGGTGTTAAAGGCATCACGCT
GACAGACGATGATGTTGTGGTAGGCATGGAGATTCTTGAAGAAGACTCCCACGTCCTCATAGTGACAGAAAACGGCTACG
GCAAACGCACACCGGCTTCAGAATACAGAGTTCAAAGCCGGGGCGGAAAAGGCCTTAAAACATGTAAAATCACTGACAGC
AACGGTCCGTTAGTAACCGTGAAAGCAACAAAAGGCGAAGAGGACTTAATGATTATTACGGCAAGCGGCGTGTTAATCAG
AATGGATATTAATGATATCTCCACTACGGGACGCGTAACACAAGGCGTCCGTCTGATCCGCATGTCTGATCAAGAGCATG
TAGCCACTGTGGCGCTTGTGGAAAAGAATGAAGAAGAGCCGGAAGAAACGGAAGAAGTATAA

>>MEG_3212|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCGGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGTGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTA
TATATCCGCGCCCGTGCTGAAATGGAAGTTGACGCCAAAACCGGACGTGAAACCATTATCGTCCACGAAATTCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCAAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTTGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCGATGCTCGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGTTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGTGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAATATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGTGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACGCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTACCAGTTGCCGGAGGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTACTGCCGCTGGAGCAGGACGAACGTATCACCGCGATCCTGCCGGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACTGTGAAGAAAACCGTCCTCACCGAATTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGAAGGCGATGAGTTGATCGGCGTTGACCTGACCAGTGGCGAAGATGAAG
TAATGCTGTTCTCCGCCGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAATACCACTGGT
GTGCGCGGTATTCGCTTAGGCGAAGGCGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAAAACGGTTATGGTAAGCGTACCGCAGTGGCGGAATACCCAACCAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCAGAAATCAGCATCGTGGGCCGTAACACCCAAGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAACGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>>MEG_3213|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAAGAAGATGTACCAAGACTAAGAGAAAGACAAATAGACGAGGAAATGAAAGAATCGTTCATCGATTACGCGAT
GAGCGTCATTGTCAGCCGGGCGCTGCCAGACGTAAGGGATGGCATGAAGCCCGTGCATCGCCGTATTCTGTATGCCATGT
TTGAGCTTGGGATGACGCCAGACAAACCATATAAAAAGTCGGCGCGGATCGTAGGCGAAGTGCTTGGAAAGTACCACCCA
CACGGCGATACTTCTGTATATGACGCAATGGTACGGATGGCACAAGATTTTAGTTATCGTTATATGCTCGTCAACGGGCA
TGGCAACTTCGGTTCCATTGATGGCGACTCTGCCGCGGCGATGCGTTATACGGAATCAAAAATGTCCAAGATTTCCATGG
AACTAGTCCGGGATTTAAACAAAGATACCGTTGATTTTATCGATAACTATGACGGCACTGAGCGAGAACCGAAAGTGATG
CCTTCCCGTTTTCCGAATTTACTCGTCAATGGCACGTCGGGGATTGCAGTAGGGATGGCAACCAATATCCCGCCCCATCA
ATTAGGTGAAGTGATTGACGGTGTACTTGCTTTAGCAAAAAATCCTGACATTAGTATTCCTGAGCTCATGGAATATATTC
CAGGCCCTGATTTTCCAACAGGCGGCGAGATCCTCGGCCGCTCTGGCATACGCAAAGCCTATTCAACAGGACGAGGCTCG
ATTACCGTACGGGCTAAAACCGAAATTGTCGAAAACAAAGGCAAACAGTCGATTATCGTCACGGAACTGCCATACCAAGT
CAATAAAGCGCGTCTGATTGAAAAAATCGCGGAACTAGTGCGTGACAAGAAAATTGATGGCATTACCGAACTGCGTGATT
CCTCGGACCGCAATGGCATGAACATTGTCATCGATGTGCGTAGAGACGCAAATCCAAACGTCATTTTAAACAATTTGTTT
AAACAGACAGCTTTGCAAACAAGTTTTGGCATTAATATGCTTGCTCTTGTGAATGGCCGGCCTGAAGTCTTAAACTTAAA
ACAGACGCTGGAACAATATTTGGCTCACCAAGTAGAAGTGATCCGCAGGCGCACTCAGTTTGACCTAAACAAAGCGGAAG
CCCGCGCCCACATTTTGGAAGGCTTGCGCATTGCCCTTGACCATATTGATGAAATCATTGCCTTAATCCGTGGTTCGGAT
ACAGCAGAAATCGCTCGAAACGGCTTAATTGAGCGATTTGAACTCAGCTATGACCAAGCACAAGCGATTCTCGATATGCG
CTTGCAACGGTTAACTGGTTTGGAACGGGATAAGCTTGAACAAGAATACAAAGACGTGTTGGCGCGAATTGCTGAACTCC
GTGCAATTTTGGCTAGTGACGAGAAAGTCATTGACGTCATCCAAGAAGAAATCCTTGCCATTAAAGAGAAATTTAATGAC
GAACGGCGGACGGTCATTTCGGCGAGCGAAGAACATTTGGAAGATGAGGATTTAATCCCACGGCAAAATATTGTTATTAC
TATTACCCATAACGGCTACATTAAACGCTTGCCTATTTCTACGTACCGTGCTCAAAAACGGGGCGGAAAAGGCGTACAAG
GCATGGGTACGAATGATGACGACTTTGTCCAGCACTTGTTTACGACCAACACGCACCATACCGTGTTAGTCTTCACAAAC
AAAGGGAAAGCCTACCGCCTAAAAGGGTATGAAATCCCTGAACTAGGTCGAACAGCAAAAGGCATTCCGGCGATTAATCT
GTTGCCGTTTGATCCAGGCGAAACGATCAGTACAGTCATCCCAATTGAATGCTTTGATGACGATTCGTATTTGTTTTTCG
TAACAGAGCACGGCATTGCCAAACGAACAAAGTTGTCTGCATTTGCGAATATCCGTAAAGGTGGTTTGTTCGCGATCAAT
TTAAGAGAAGGCGATTCACTCCACGGCGTGCGTTTAACCGATGGCAACCGTGAAGTGATGATCGGGACGAAACAAGGAAT
GGCGATCCGTTTTCCAGAAACAGATGTCCGCCTAATGGGACGTACTGCAGGCGGCGTCAAAGGCATTACCCTATCTGAGA
ATGACGGTGTTGTCGGCATGGAAGTAGTGGATGAAAACCAAAGCGTGCTCGTCGTTACCGAGAAAGGCTACGGCAAACGG
ACGCCACTTGATGAATACCGGGTCCAAAGCCGCGGAGGAAAAGGGATTAAAACATGTAACATTACTGATAAAAACGGTCC
TCTTGTCTCTTTGAAAATGGTGGCCGACGAAGACGACATTATGATTGTTACCGCCAATGGGATTATTATTCGCACCAACG
TAGACGGCATTTCAACGACTGGCCGAAATACTCAAGGCGTGACGTTGATTCGTGTCAACGAAGGAGAAGAAGTAGCGACA
GTCGCCCGTGTGAACATTAACGACGACGAAGTCGATGACTTAGAAGACGATGATGAGCAAGAGCAACCGACATCAGAGGA
AAACGCAGAATAA

>>MEG_3214|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCAGAAACACCAAATCAACGAATAACAGAGATAAACTTAAATAAAGAAATGCGGACATCATTCCTAGACTATGCGAT
GAGTGTAATTGTTGCCCGTGCCCTACCTGATGTTCGTGACGGGTTAAAACCAGTTCACCGTCGTATTCTATATGCGATGA
ATGACTTAGGTATGACTTCTGATAAAGCCTATAAAAAATCGGCTCGTATCGTTGGTGAAGTAATTGGTAAGTATCACCCC
CACGGCGATACAGCGGTTTATTTTACAATGGTTCGTATGGCGCAAGATTTTAGTTATCGTAATATGCTAGTTGATGGACA
TGGTAACTTTGGTTCGGTCGATGGCGATATGGCGGCAGCGATGCGTTATACAGAAGCACGTATGTCAAAAATTTCGATGG
AACTACTGCGCGATATTAATAAAGACACAATTGATTACGCTGATAACTACGATGGTTCTGAACGTGAGCCAGTTATTTTA
CCAGCGCGTTTCCCTAACTTATTAGTCAATGGTTCGTCAGGTATCGCGGTTGGTATGGCAACAAATATTCCTACCCACCA
TCTTGGTGAAGTAATTGACGGCGTTTTAGCACTTAGTCACGATCCAGAAATTACTATTCGTGATTTAATGGAATATATTC
CAGGCCCTGACTTCCCAACTGCTGGGATGATTATGGGACGTAGCGGAATCCGTCGCGCTTACGAAAGTGGCCGTGGTTCG
ATTACTGTTCGTGGTCGTGTCGATATTGAAGAAAAGAAAAATGGTAAAGAAACTATCGTTATTACCGAAATTCCTTACCA
AGTGAATAAAGCACGCCTAGTTGAACGTATTGCCGAACTAGCTCGTGAGAAGAAAATCGACGGCATCACTTCCCTAAATG
ATGAGTCTGACCGTTCAGGAATGCGGATTGTTATTGAGGTTCGTCGTGATATTAGCGCCAGTGTTATCGTGAATAATTTA
TTCAAAATGACAGCACTTCAAACTACTTTTGGTATTAATATGCTTGCACTTGTCGATAACCATCCAAAAGTGCTTAATTT
AAAAGAAATTCTTTATTATTATTTGGAACATCAAAAAGTAGTTATTCGTCGACGTACAGAATTTGAGCTTCGTAAAGCAG
AAGCACGCGCACATATTTTAGAAGGTTTACGAATCGCTCTTGATAACATTGACGCGATTATTAAATTAATTCGTGGATCA
AAAACTTCCGATGTTGCTAAAGAAGGCTTGATGACACAATTCAACCTTTCTGACAAACAAGCGCAAGCCATTCTGGACAT
GCGTTTGCAACGTTTAACAGGTTTAGAACGCGAAAAAATTGAAGAAGAATATCAAAACTTAGTAGCATTAATTAATGATT
TAAAAGCTATTTTAGCTGATGATGAGCGTATTCTTGAAATTATTCGTGAAGAATTAGAAGAAATCAAAGTTAAATATGCG
GATAAACGTCGTACAGAAATCTTGGCTGGTGATTTAGTAAGCCTTGAAGATGAAGACTTAATCCCTGAAGAAGAAGTAGC
AATTACGCTAACTAAACGTGGTTATATTAAACGTTTACCACTGTCGACTTATCGTAGTCAGCGTCGAGGTGGTCGTGGTA
TTCAAGGTATGTCAACACATGAAGATGACTTCGTAGAACACCTAGTTGCAACGAGCACGCATGATACGTTACTATTCTTC
ACTAACACTGGTAAAGTTTACCGTTCGAAAGGTTATGAAGTACCTGAATACGGTCGTACCGCCAAAGGTATCCCAATAAT
CAACTTACTTGGAATCGAAAGCCAAGAACAAGTGAATGCCGTGATAAATCTATCCGAATTCACCGATGATAGCTACCTAT
TCTTCACGACGAAACATGGTGTCGTGAAGCGTACAACCCTTTCTCAATTTGCGAAAATCCGTCAAAGTGGCCTTCGTGCT
GTAGAACTTCGTGAAAACGATGAACTCATTTCTGTTCAAATGACAGATGGTAGCAAAAACATGATTATCGCAACGAAACA
TGGTCAATCTATCTACTTCCCAGAAGAAAATATCCGTGTAATGGGCCGTACAGCTGCTGGTGTTCGTGGTATTAGACTTC
GTGAAGACGATGAAGTTATCGGCATGGAAGTACTGGAGGACGATGAAAAAGTACTCGTTGTAACGGAAAAAGGTTATGGT
AAACAAACGCCAGCCTCCCAATATCCGCTTCGTAATCGTGGTGGTATGGGTGTTAAAACCGTTACAATCACAGAGAAAAA
TGGTAACTTAGTAGCAATGAAAACTGTTACTGGTGAAGAGGACTTAATGCTAATGACAGTAAGTGGCGTATTAATTCGTT
TCGAAATTGATACAGTATCACAAACTGGTCGTAGCGCAATGGGTGTTAAACTAATTCGTCTTGATGAAGATGAAAAAGTA
GCCACTGTTGCAAAAGTACCAAAAGAAGAAGATGAAGTTGAGCTTGAGGAAGAAATCGACGAAACATTAATCACGCAAGT
TCCTGATGAAAGTTTTGAAGATGCTCCTGGAAGCGACATAGAAGAATAA

>>MEG_3215|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCGGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATA
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAGGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTCAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGTGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACTGTTTCACAAACAGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCTATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCACGCGACCGTACTTTGCTTTACCAACGTGGGTAAAGTGTACCGTTTGAAAGTATTTGAGGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACTGCAATCTTGCCATTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGCGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTTGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3216|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGATCTAGCTAAAGAGATCACGCCCGTAAACATCGAAGACGAGCTACGCAGTTCGTATTTGGACTACGCGATGTC
GGTTATCGTGGGTCGTGCTCTTCCTGATGTGCGTGATGGCCTTAAACCAGTACACCGACGCGTACTGTTCGCGATGAATG
TGCTGGGCAACGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTGGTAGGTGACGTAATCGGTAAATATCACCCTCAT
GGTGACAGTGCGGTTTACGACACCATCGTGCGTATGGCGCAGCCTTTCTCACTTCGTTACATGTTGGTCGATGGCCAAGG
TAACTTTGGCTCGATCGACGGCGACTCCGCGGCGGCAATGCGTTATACCGAAGTTCGTATGTCGAAAATCGCGCACGAAC
TCTTGGCAGACCTAGACAAAGAAACCGTTGACTACGTTCCGAACTATGACGGCACCGAGCAGATCCCTGCGGTATTGCCG
ACAAAGATCCCGAACCTGCTGATCAACGGCGCATCTGGTATTGCGGTGGGTATGGCAACCAACATTCCTCCGCACAATTT
AGGTGAAGTGATCGATGGCTGTTTAGCCTACATCGATAATGAAGCGATCACCATTGATGAGTTGATGGACTACATTCCTG
GTCCAGATTTCCCAACCGCCGCGCTGATCAGTGGCCGTAAAGGCATCATTGACGCGTACAAAACCGGCCGCGGCAAGGTT
TACATGCGCTCGAAAGCGGAAATCGAAACCGATAAGAACGGCAAAGAAACCATTATCGTCAGCGAAATCCCTTATCAAGT
GAACAAAGCGCGCTTGATCGAAAAAATCGCTGAGTTGGTGAAAGAGAAAAAAGTCGAAGGGATCAGTGCACTGCGTGACG
AGTCTGACAAAGACGGTATGCGCATTGTGATTGAGTGTAAGCGTGATGCGGTTGGCGAAGTGGTTTTGAACAACCTGTAT
GCCAACACTCAGCTGCAAACCACCTTCGGTATCAACATGGTGGCACTCGATAACGGTCAGCCTAAGCTGTTTAACCTGAA
AGAGATGCTGAAGTGTTTCGTCGACCACCGCCGCGAAGTGGTGACTCGTCGTACTATTTTTGAACTGCGTAAAGCGCGTG
AGCGTGCCCACATCCTTGAAGGTTTGGCACTGGCTCTGGCTAACATTGATGAAATCATTGAACTGATCCGCCGTGCCGCC
ACGCCTGCAGAAGCAAAAGAAGGCTTAATTGCCCGTGGTTGGGATCTTGGCAACGTTGCGGCAATGCTTGAGCGTGCAGG
TACGGATGCGGCGCGTCCTGAGTGGCTTGAGCCACAATACGGCATCCGCGATGGCAAGTACTTCCTGACTGAGCAACAAG
CGCAAGCGATTCTGGATCTGCGTCTGCACAAGCTGACTGGTCTAGAGCACGAGAAGATCCTCGATGAGTACAAGCAGCTT
CTCGAAGAAATCGCGGCATTGATGCACATTCTGGCGAGCACAGAGCGCTTGATGGAAGTGATCCGTGAAGAGCTAGAAGC
GATTCGCGCTGGCTTTAGCGATGCGCGCCGCACTGAAATCACGGCAGCAACGCACGACATCGACATGGAAGAGCTGATCG
CTCGTGAAGATGTGGTTGTGACTCTGTCACACGAAGGTTATGTGAAGTATCAATTACTGAGCGACTACGAAGCACAGCGT
CGTGGTGGTAAAGGTAAGAGCGCAACCAAGATGAAAGAAGAGGACTACATTGAGCGTCTTCTGGTTGCCAATACTCACGA
TAACATTCTGCTGTTCTCGACTCGCGGCAAAACTTACCGTATGAAGGTATACCAACTGCCGCTCGCCAGCCGTACTGCGC
GTGGTAAGCCAATCGTGAACCTGCTTCCTCTGGAAGAAAACGAGCGCATCACCGCGATTCTGCCAGTGACTGAGTTTAGT
GAAGATAAATTCATCTTCATGGCAACCGGTGACGGTACTGTGAAGAAAACATCGCTGGATCAGTTTGCCAACGTTCGTGC
GAATGGTTTGATTGCGCTCAACCTGCGTGACGAAGACTCGCTGATTGGTGTGGATATCACCGATGGCGAAAGCGAAATTA
TGCTGTTCTCTAAATTCGGTAAAGTGGTTCGCTTTAAAGAGTCCGAAGAAACCGCGGTTGTGGATGAAAATGGTCAACCT
GTGCTGGATGAAAATGGCCAGCCAGAGATCAAGTTCAAAGGCGTAAGACCAATGGGTCGTACCGCTGCGGGTGTTCGCGG
CATGAAACTGGCTGATGGCGACCAAGTGGTATCGCTCATCGTGCCGAAGACCGAAGGTGACGTACTCACCGTAACTGAAA
ATGGTTACGGCAAACGTACCAGCCTATCTGAATACCCAACCAAAGGTCGTGGAACTCAGGGTGTGGTTTCGATCAAAGTC
TCTGAGCGTAACGGCAGCGTTGTGGGTGCAGTACAAGTGGCCGAGGGTGATGAGTTCATGATGATCACCAATGCCGGTAC
ACTGGTACGTACTCGCGTGGCGGAAGTGAGCCAAGTGGGCCGTAATACTCAAGGCGTGACCCTGATCCGTACTTCGGAAG
GTGAAAGTGTGGTAGGTCTGCAGCGTATCGATGAAATCGAAGAGTCGGAATTGCCAGAAGGTGAGGAAGCACTTGTCGAG
AACGATGCACCTGTTGCACAAGATGATGATGGTGAACAAGAGTAA

>>MEG_3217|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACCGACGCAACCATCCGCCACGACCACAAATTCGCCCTCGAAACCCTGCCGGTAAGCCTTGAAGACGAAATGCGCAA
AAGCTATCTCGACTACGCCATGAGCGTCATTGTCGGGCGCGCGCTGCCGGACGTTCGCGACGGTCTCAAGCCGGTACACC
GCCGCGTACTGTACGCGATGCACGAGCTGAAAAACAACTGGAATGCCGCCTACAAAAAATCGGCGCGCATTGTCGGCGAC
GTCATCGGTAAATACCACCCCCACGGCGATACCGCCGTATACGACACCATCGTCCGTATGGCGCAAAATTTCGCTATGCG
TTATGTGCTGATAGACGGACAGGGCAACTTCGGATCGGTGGACGGGCTTGCCGCCGCAGCCATGCGCTACACCGAAATCC
GCATGGCGAAAATTTCCCACGAAATGCTGGCAGACATTGAGGAAGAAACCGTCAATTTCGGCCCGAACTACGACGGTAGC
GAACACGAGCCGCTTGTACTGCCGACCCGTTTCCCCACACTGCTCGTCAACGGCTCGTCCGGCATCGCCGTCGGCATGGC
GACCAATATCCCGCCGCACAACCTTTCTGATACCGTCAATGCCTGCCTGCGCCTGCTCGATGCACCCGACACCGAAATCG
ACGAACTGATCGACATTATCCAAGCCCCCGACTTCCCGACCGGGGCAACCATCTACGGCTTGAGCGGCGTGCGCGAAGGC
TATAAAACAGGCCGCGGCCGCGTCGTTATGCGCGGTAAGACCCATATCGAACCCATAGGCAGAAACGGCGAACGCGAAGC
CATCGTTATCGACGAAATCCCCTATCAGGTCAACAAAGCCAAGCTGGTCGAGAAAATCGGCGATTTGGTTCGGGAAAAAA
CACTGGAAGGCATTTCCGAGCTCCGCGACGAATCCGACAAATCCGGTATGCGCGTCGTTATCGAGCTGAAACGCAACGAA
AATGCCGAAGTCGTCTTAAACCAACTCTACAAACTGACTCCGCTGCAAGACAGTTTCGGCATCAATATGGTGGTTTTGGT
CGACGGACAACCGCGCCTGTTGAACCTGAAACAGATTCTCTCCGAATTCCTGCGCCACCGCCGCGAAGTCGTTACCCGAC
GTACGCTTTTCCGGCTGAAGAAGGCACGCCATGAAGGGCATATTGCCGAAGGCAAAGCCGTCGCACTGTCCAATATCGAT
GAAATCATCAAGCTCATCAAAGAATCGCCCAACGCAGCCGAGGCCAAAGACAAACTGCTTGCGCGCCCTTGGCGCAGCAG
CCTCGTTGAAGAAATGCTGACGCGTTCCGGTCTGGATTTGGAAATGATGCGTCCGGAAGGATTGGCTGCAAACATCGGCT
TGAAAGAGCAAGGTTATTACCTGAGCGAGATTCAGGCAGATGCTATTTTACGCATGAGCCTGCGAAACCTGACCGGCCTC
GATCAAGAAGAAATTGTCGAAAGCTACAAAAACCTGATGGGTAAAATCATCGACTTTGTGGATATCCTCTCCAAACCCGA
ACGCATTACCCAAATCATCCGCGACGAACTGGAAGAAATCAAAACCAACTATGGCGACGAACGCCGCAGCGAAATCAACC
CGTTCGGCGGCGACATTGCCGATGAAGACCTGATTCCGCAACGCGAAATGGTCGTTACCCTGACACATGGCGGCTATATC
AAAACCCAGCCGACCACCGACTATCAGGCGCAGCGTCGCGGCGGGCGCGGCAAACAGGCGGCTGCCACCAAAGACGAAGA
CTTTATCGAAACCCTGTTTGTTGCCAACACGCATGATTATTTGATGTGCTTTACCAATTTGGGCAAGTGTCATTGGATTA
AGGTTTACAAACTGCCCGAAGGCGGACGCAACAGCCGCGGCCGTCCGATTAACAACGTCATCCAGTTGGAAGAAGGCGAA
AAAGTCAGCGCGATTCTGGCAGTACGCGAGTTCCCCGAAGACCAATACGTCTTCTTCGCCACCGCGCAGGGAATGGTGAA
AAAAGTCCAACTTTCCGCCTTTAAAAACGTCCGCGCCCAAGGCATTAAAGCCATCGCGCTCAAAGAAGGCGACTACCTCG
TCGGCGCTGCGCAAACAGGCGGTGCGGACGACATCATGCTGTTCTCCAACTTAGGTAAAGCCATCCGCTTCAACGAATAC
TGGGAAAAATCCGGCAACGACGAAGCGGAAGATGCCGACATCGAAACCGAAATTTCAGACGGCATCGAAGATGAAACCGC
CGACAGCGAAAACGCACTGCCGAGCGGCAAACACGGTGTTCGCCCGTCCGGTCGCGGCAGCGGCGGTTTGCGCGGTATGC
GCCTGCCTGCCGACGGCAAAATCGTCAGCCTGATTACCTTCGCCCCTGAAACCGAAGAAAGCGGTTTGCAAGTTTTAACC
GCCACCGCCAACGGATACGGAAAACGCACCCCGATTGCCGATTACAGCCGCAAAAACAAAGGCGGGCAAGGCAATATTGC
CATTAACACTGGCGAGCGAAACGGCGATTTGGTCGCCGCAACCTTGGTCGGCGAAACCGACGATTTGATGCTGATTACCA
GCGGCGGCGTACTTATCCGCACCAAAGTCGAACAAATCCGCGAAACCGGCCGCGCCGCAGCAGGCGTGAAACTGATTAAC
TTGGACGAAGGCGAAACCTTGGTATCGCTGGAACGTGTTGCCGAAGACGAATCCGAACTCTCCGACGCTTCTGTAATTTC
CAATGTAACCGAACCGGAAGTCGAGAACTGA

>>MEG_3218|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAGAATATTTTTAGCAAAGATTCTGATATTGAACTTGTAGATATAGAAAATTCTATAAAAAGTAGTTATTTAGACTA
TTCTATGAGTGTTATTATAGGTCGTGCTTTGCCTGACGCAAGAGATGGTTTAAAGCCTGTTCATAGAAGAATTTTATATG
CTATGCAAAATGATGAGGCAAAAAGTAGAACAGATTTTGTCAAATCAGCCCGTATAGTGGGTGCTGTTATAGGTCGTTAT
CACCCACATGGAGATACAGCAGTTTATGATGCTTTGGTTAGAATGGCTCAAGATTTTTCTATGAGATATCCAAGTATTAC
AGGACAAGGCAACTTTGGATCTATAGATGGTGATAGTGCCGCTGCGATGCGTTATACTGAAGCAAAAATGAGTAAACTTT
CTCATGAGCTTTTAAAAGATATAGATAAAGATACGGTCGATTTTGTTCCAAATTATGATGGTTCAGAAAGCGAACCTGAT
GTTTTACCTTCTAGGGTTCCAAATTTATTATTAAATGGTTCAAGTGGTATAGCTGTAGGTATGGCGACAAACATCCCACC
TCATAGTTTAAATGAGTTGATAGATGGACTTTTATATTTGCTTGATAATAAAGATGCAAGCCTAGAAGAGATTATGCAGT
TTATCAAAGGTCCAGATTTTCCAACAGGTGGAATAATTTATGGTAAAAAAGGTATTATAGAAGCTTATCGCACAGGGCGT
GGTCGCGTGAAAGTGCGAGCTAAAACTCATATTGAAAAAAAGACAAATAAAGATGTTATTGTTATCGATGAGCTTCCTTA
TCAAACCAATAAAGCTAGGCTTATAGAGCAGATTGCAGAGCTTGTTAAAGAAAGGCAAATTGAAGGAATATCTGAAGTAA
GAGATGAGAGCAATAAAGAAGGAATCCGCGTTGTTATAGAGCTTAAACGTGAGGCTATGAGTGAAATTGTTTTAAATAAT
CTATTTAAATCTACCACTATGGAAAGTACTTTTGGTGTGATTATGTTGGCAATTCATAATAAAGAACCTAAAATTTTCTC
TTTGTTGGAACTTTTAAATCTTTTCTTAACTCATAGAAAAACAGTTATTATTAGAAGAACGATTTTTGAACTTCAAAAGG
CAAGAGCAAGAGCTCATATTTTAGAAGGTCTTAAAATTGCACTTGATAATATAGATGAAGTGATTGCTTTAATTAAAAAT
AGTTCTGATAATAATACCGCAAGAGATTCTTTAGTAGCTAAATTTGGTCTTAGTGAGCTTCAAGCCAATGCTATTTTAGA
TATGAAACTTGGTCGTTTAACAGGACTTGAAAGAGAAAAAATCGAAAATGAACTTGCAGAATTAATGAAAGAAATTGCAA
GACTTGAAGAAATTTTAAAAAGTGAAACCTTGCTTGAAAATTTAATTCGCGATGAATTAAAAGAAATTAGAAGTAAATTT
GATGTGCCACGTATTACTCAAATTGAAGATGATTACGATGATATTGATATTGAAGATTTGATTCCTAATGAAAATATGGT
TGTAACTATCACACATCGTGGTTATATTAAGCGTGTGCCTAGTAAACAATATGAAAAACAAAAACGAGGTGGAAAAGGAA
AATTAGCCGTTACGACTTATGATGATGATTTTATAGAAAGTTTCTTTACGGCAAATACACATGATACGCTTATGTTTGTA
ACAGATCGTGGACAGCTTTATTGGCTTAAAGTTTATAAAATTCCTGAAGGCTCAAGAACGGCTAAAGGAAAAGCAGTGGT
AAATCTTATCAATTTACAAGCTGAAGAAAAAATCATGGCTATTATTCCAACCACGGATTTTGATGAGAGCAAATCTTTAT
GTTTCTTTACTAAAAATGGTATTGTAAAGCGTACAAATTTGAGTGAATATCAAAATATCAGAAGTGTAGGAGTTAGAGCG
ATCAACTTGGATGAAAATGATGAGTTGGTAACTGCTATTATTGTTCAAAGAGATGAAGATGAAATTTTTGCCACTGGTGG
TGAAGAAAATTTAGAAAATCAAGAAATTGAAAATTTAGATGATGAAAATCTTGAAAATGAAGAAAGTGTAAGCACACAAG
GTAAAATGCTCTTTGCAGTAACCAAAAAAGGTATGTGTATCAAATTCCCACTTGCTAAAGTGCGTGAAATCGGCCGTGTA
AGTCGTGGGGTGACGGCTATTAAGTTTAAAGAGAAAAATGACGAATTAGTAGGTGCAGTTGTTATAGAAAATGATGAGCA
AGAAATTTTAAGCATAAGTGCAAAAGGTATAGGAAAACGCACCAATGCTGGAGAATATAGATTGCAAAGCAGAGGTGGTA
AGGGTGTAATTTGTATGAAACTTACAGAAAAAACCAAAGATCTTATTAGCGTAGTTATAGTAGATGAAACTATGGATTTA
ATGGCTCTTACAAGTTCAGGTAAGATGATACGTGTTGATATGCAAAGCATTAGAAAAGCAGGGCGTAATACGAGTGGTGT
CATTGTAGTTAATGTGGAAAATGACGAGGTGGTTAGCATCGCTAAGTGTCCTAAAGAGGAAAATGACGAGGATGAGTTAA
GCGATGAAAACTTTGGTTTAGATTTGCAATAA

>>MEG_3219|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGAAGAAAATAACAAAATACTCCCTATTGAAATAGCGGAAGAAATGAAAAAATCGTATATTGATTATTCAATGAGTGT
TATAGCTGGACGTGCTCTTCCTGATGTTAGAGATGGTTTAAAGCCAGTTCATAGAAGAATATTATATTCAATGAGTGAGT
TAAATTTAACTCCAGATAAACCATACAGGAAGTCAGCTCGTATTGTTGGGGACGTTTTAGGTAAGTACCATCCTCATGGA
GATACTGCTGTTTATTATGCTATGGTAAGAATGGCACAAGATTTTTCAACTAGAGCACTTTTAGTAGATGGTCATGGTAA
CTTTGGTTCTGTTGATGGGGATTCACCAGCTGCTATGCGTTATACAGAAGCTAAAATGAGTAAATTATCATTAGAACTAC
TGAGAGATATTGAAAAGGAAACTGTAGACTTTAAACCAAACTTTGATGAGTCGTTAAAAGAGCCTTCAGTATTGCCAGCT
AGATATCCTAATTTATTAGTAAATGGCTCAAATGGTATAGCTGTTGGTATGGCAACTTCAATACCTCCACATAATTTAGC
AGAAGTAATTGATGCAACTGTATATTTGATAGATAATCCAGAGTGTAGTGTAGATGATTTAATAAAATTTGTTCAAGGAC
CAGATTTCCCTACAGCTGCAATTATAATGGGAAAAGAAAGTATAGCAGAAGCATACAGAACTGGAAGAGGAAAAGTTAAA
GTTAGGTCTAGAGCTTTTATAGAAGAGCTACCAAAAGGAAAACAGCAAATAATAGTTACAGAAATACCTTATCAAGTAAA
TAAGGCTAAACTGGTTGAAAGAATAGCAGAGTTAGTTAAAGAAAAGAGAATAGAAGGTATATCAGACCTAAGAGACGAAA
GTAATAGAAATGGTATGAGAATTGTTATAGAATTAAAGAGGGATGCTAATGCTAATATAGTATTAAATAATTTGTATAAA
CATTCTCAAATGGAAGATACTTTTAGTATAATAATGCTTGCACTTGTAGATGGTCAGCCAAGAGTTTTAAATCTTAAACA
AATATTATATCATTATATTAAACATCAAGAAGATGTTGTTACAAGAAGAACTAAATTTGAACTAAATAAAGCTGAAGCAA
GAGCACATATTTTAGAAGGATTAAAGATTGCTTTAGATAATATAGATGCTGTTATAAGCTTGATAAGAGCTTCAAAGACT
GGGCAAGAAGCTAAGCTAGGTTTAATAGAAAAATTCAAATTAACTGAAATCCAAGCACAAGCTATATTAGATATGAGACT
TCAAAGACTTACAGGTTTAGAAAGAGATAAGATAGAAGCTGAATATGAAGATTTAATCAAGAAGATAAATAGATTAAAAG
AGATTTTAGCTGATGAAAGATTACTTTTAAATGTAATAAAGGATGAAATTACAATAATAAAAGAAAATTACTCTGATGAG
AGAAGAACAGAAATAAGACATGCTGAAGGCGAAATAGATATGAGAGATCTTATAAGTGATGAAGAAATAGCAATAACTCT
TACTCACTTTGGATATATAAAAAGGCTTCCATCTGATACTTATAAGAGTCAAAAAAGGGGTGGAAGAGGTATTTCAGCAC
TTACAACTAGAGAAGAAGATTTTGTAAGGCACTTGGTAACTACAACTACTCATAGTAGACTATTATTCTTTACAAATAAA
GGTAGAGTATTTAAATTAAATGCATATGAAATACCAGAAGGTAAGAGACAGGCTAAAGGTACTGCTATAGTGAATTTACT
TCAATTGTCAGCAGATGAGAAAATTGCTACTCTAATACCTATTGATGGTAATGATGAAAATGAATATTTATTACTTGCAA
CGAAAAAAGGTATTGTTAAAAAGACTAAGAGAGAAGAGTTCAAAAATATAAATAAATCTGGTCTTATTGCAATAGGTTTA
AGAGATGATGATGAGCTTATTGGAGTAGAACTTACAGATGGAAAACAAGAAGTACTTTTAGTAACTAAAGAAGGTATGTC
TATAAGATTTGATGAAAATGATATAAGATATATGGGTAGAACAGCAATGGGTGTAAAAGGTATAACTTTAAGTAAAGAAG
ATTTTGTTGTGTCTATGAACCTTTGTAGTAAAGGTACAGATGTGTTAGTTGTAAGTAAGAATGGTTTTGGAAAGAGAACA
AATATAGAAGAGTATAGAAGTCAAATAAGAGCTGGTAAAGGAATTAAAACTTATAATATATCTGAAAAAACTGGTACAAT
TGTAGGTGCAGATATGGTCAACGAAGATGATGAGATAATGATTATAAATTCTGATGGAGTTCTTATTAGAATAAGAGTCA
ATGAAATATCACTGTTTGGAAGAGTTACAAGTGGTGTTAAATTAATGAAGACGAATGATGAAGTCAATGTAGTTTCGATT
GCCAAAATAAATATTGAAGAAGAATAG

>>MEG_3220|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGCGATTCCGCAGTGTATGACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGG
TAACTTCGGTTCTATTGACGGCGACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGGCGAAAATCGCCCACGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTGGATTTCGTGGATAACTATGACGGTACGGAAAAAATTCCGGACGTCATGCCG
ACCAAAATTCCGAATCTGCTGGTGAACGGTTCTTCCGGTATCGCAGTAGGTATGGCGACGAATATCCCGCCGCACAACCT
GACGGAAGTGATTAACGGCTGCCTGGCGTATATCGACAACGAAGACATCAGCATTGAAGGGCTGATGGAACATATTCCGG
GTCCGGACTTCCCGACCGCCGCGATCATCAACGGTCGTCGTGGTATCGAAGAAGCCTACCGTACCGGTCGTGGCAAAGTG
TACATTCGCGCCCGCGCGGAAGTTGAAGCTGACGCGAAAACGGGCCGTGAAACCATCATCGTCCATGAAATTCCCTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGATAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAATCCGACAAAGACGGGATGCGCATCGTGATTGAAGTAAAACGCGATGCGGTGGGCGAGGTGGTGCTTAATAATCTC
TACTCCCAGACCCAGCTACAGGTTTCCTTCGGTATTAACATGGTGGCGCTGCATCACGGCCAGCCGAAGATCATGAACCT
GAAAGATATCATTTCAGCGTTCGTGCGCCACCGCCGTGAAGTGGTGACGCGTCGGACTATTTTTGAACTGCGTAAAGCCC
GTGACCGCGCGCATATCCTTGAAGCTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATCGAACTGATTCGCCGCGCG
CCAACGCCGGCAGAAGCAAAAGCGGCGCTGATTTCGCGTCCGTGGGATCTGGGCAACGTTGCTGCGATGCTGGAGCGCGC
CGGTGATGACGCCGCGCGCCCGGAATGGCTGGAGCCAGAATTTGGCGTGCGTGACGGTCAGTACTACCTGACTGAGCAGC
AGGCGCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTGGAGCATGAAAAACTGCTCGACGAATACAAAGAG
TTGCTGGAGCAGATTGCTGAACTGCTGCACATTCTGGGCAGCGCCGATCGCCTGATGGAAGTGATCCGTGAAGAGATGGA
GTTAATTCGCGATCAGTTCGGCGATGAGCGTCGTACCGAAATCACCGCCAACAGCGCCGATATTAATATCGAAGATCTGA
TTAGCCAGGAAGATGTTGTCGTGACGCTGTCTCACCAGGGTTACGTCAAGTATCAACCGCTGACGGATTACGAAGCGCAA
CGTCGTGGTGGGAAAGGTAAATCTGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCCAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGCCGTCTGTACTGGATGAAGGTCTATCAGTTGCCGGAAGCCAGTCGTGGCG
CGCGCGGTCGTCCGATCGTCAATCTACTGCCGCTGGAAGCCAACGAACGTATCACCGCGATTCTGCCGGTTCGTGAGTAC
GAAGAAGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACGGCGCTGACCGAATTCAGCCGTCCGCG
TTCCGCCGGTATTATCGCGGTAAACCTCAACGACGGCGACGAGCTGATTGGCGTTGACCTGACTTCTGGTTCTGACGAAG
TCATGCTGTTCTCGGCCGCGGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGTGCGATGGGGCGTACCGCGACCGGT
GTGCGCGGTATTAAGCTGGCGGGAGACGATAAAGTCGTCTCTCTGATCATCCCACGCGGCGAAGGCGCTATTCTGACCGT
AACGCAAAACGGCTACGGGAAGCGTACCGCAGCGGACGAGTACCCGACCAAGTCTCGTGCGACGCAGGGCGTTATCTCTA
TCAAAGTGACCGAGCGCAACGGTTCCGTTGTCGGTGCGGTACAGGTAGACGATTGCGACCAGATCATGATGATCACGGAT
GCCGGTACTCTGGTGCGTACCCGTGTGTCCGAGATCAGCGTAGTGGGACGTAATACCCAGGGCGTTATCCTTATCCGCAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGCGTTGCTGAACCGGTAGATGACGAAGAACTCGACGCTATCGACGGCA
GCGTGGCGGAAGGGGATGAGGATATCGCCCCGGAAGCGGAAAGCGATGACGACGTTGCGGATGACGCTGACGAGTAA

>>MEG_3221|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAAGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGCGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCCGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATATAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACTGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGAGCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACTTTGAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTAAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCCGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGCGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAGGATGCAGATGAAGTAAATGAAGATGAACAATCTACTGTATCTGA
AGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAGTGATTGATT
CAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATACAACAATCA
TCAGATGAAGATGAAGAATAA

>>MEG_3222|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAGACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>>MEG_3223|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>>MEG_3224|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCCAGAGAAATAACACCGGTCAACATCGAGGAAGAGCTGAAAAGCTCCTATCTGGATTATGCGATGTC
CGTTATTGTCGGACGTGCGTTACCAGATGTCCGTGATGGACTGAAACCGGTGCACCGTCGCGTACTGTTTGCGATGAATG
TACTGGGTAATGACTGGAATAAACCATACAAAAAATCGGCCCGTGTAGTCGGGGACGTTATCGGTAAATACCACCCGCAT
GGTGACAGCGCGGTCTACGACACTATCGTGCGTATGGCCCAGCCGTTCTCACTGCGCTATATGCTGGTGGATGGGCAGGG
TAACTTCGGTTCCGTCGATGGTGACTCCGCCGCGGCGATGCGTTATACCGAAATCCGTATGTCTAAAATTGCTCACGAAT
TGTTAGCGGATTTAGAAAAAGATACCGTTGACTTCGTGCCTAACTATGATGGTACGGAACAAATTCCGGCTGTTATGCCG
ACCAGAATCCCTAACCTGCTGGTAAACGGTTCGTCGGGTATTGCGGTAGGGATGGCAACCAATATTCCGCCACATAATCT
TTCTGAGGTTATTGATGGCTGTCTGGCTTATATAGAAGATGAAAACATCAGCATTGAAGGGCTGATGGAGTATATCCCTG
GCCCAGACTTCCCAACAGCAGCCATTATTAATGGCCGCCGTGGTATTGAAGAGGCTTATCGTACTGGTCGCGGTAAGGTC
TATATCCGCGCACGTGCTGAAGTCGAAGCGGATGCCAAAACGGGCCGTGAAACCATTATTGTTCATGAGATCCCGTATCA
GGTGAACAAAGCACGGTTGATTGAGAAAATCGCCGAGCTGGTAAAAGAAAAACGTGTCGAAGGCATCAGCGCGTTACGCG
ATGAGTCTGATAAAGACGGCATGCGCATCGTGATTGAAATCAAACGTGATGCGGTCGGGGAAGTGGTGCTGAATAACCTC
TACTCTCTGACACAATTGCAGGTGACTTTCGGTATCAATATGGTGGCCTTGTCTCAGGGGCAACCGAAGCTGCTTAACCT
GAAAGACATTCTGGTTGCTTTTGTTCGTCACCGTCGTGAAGTGGTGACTCGCCGTACCATTTTTGAACTGCGTAAAGCAC
GTGATCGCGCCCATATCCTTGAAGCGTTGGCGATTGCACTGGCTAACATTGATCCGATTATCGAATTGATTCGCCGTGCA
TCGACCCCTGCGGAAGCAAAAGCCGGTTTGATTGCCAGTCCTTGGGAGTTAGGTAACGTTGCTTCCATGCTGGAACGTGC
TGGTGATGACGCGGCCCGCCCTGAGTGGCTGGAAGCGGAATTTGGTATCCGTGACGGTAAATATTACCTTACCGAGCAAC
AGGCTCAGGCTATTTTGGATCTGCGTTTGCAGAAACTGACAGGTCTGGAGCATGAGAAACTGCTGGATGAGTATAAAGAG
CTGCTCACCTTAATTGGCGAGCTGATCTTTATTCTAGAAAATCCGGATCGCCTGATGGAGGTTATCCGCGAAGAATTAGT
GGCGATCAAAGAGCAATATAACGATCTTCGTCGCACTGAGATCACCGCGAATACCTCTGATATCAATATTGAAGACCTGA
TTAATCAAGAAGATGTGGTTGTGACGTTGTCCCATCAGGGCTACGTCAAATACCAGCCGTTGAGTGATTACGAAGCTCAG
CGTCGTGGTGGTAAAGGTAAATCTGCTGCACGTATCAAAGAAGAAGACTTTATTGATCGCCTGCTCGTTGCCAATACCCA
CGATACCATCTTGTGCTTCTCCAGCCGTGGCCGTCTCTATTGGATGAAGGTCTATCAACTGCCGGAAGCCAGCCGTGGGG
CTCGTGGCCGTCCCATCGTCAACTTGTTGCCGCTTGAGCCAAATGAGCGTATTACCGCCATTCTGCCTGTGCGCGAATAT
GAAGAAGGCTGTCATGTCTTTATGGCTACCGCCAGCGGTACTGTGAAGAAAACGGCATTGACGGAGTTCAGTCGCCCACG
TAGCGCCGGTATTATCGCCGTTAATTTGAACGAAGGTGATGAGCTTATCGGTGTGGATCTGACGGATGGCAGCAATGAAG
TTATGCTGTTCTCAGCATTGGGTAAAGTGGTTCGTTTCCCAGAAGGGCAGGTTCGCTCTATGGGCCGTACCGCAACCGGT
GTCCGTGGGATCAACCTCAATGGCGATGATCGGGTTATTTCTCTGATCATTCCTCGTGGTGATGGTGAAATCCTGACCGT
AACTGAAAACGGTTATGGTAAGCGTACTGCAGTGGCAGAATATCCAACCAAGTCCCGTGCGACTCAGGGGGTTATCTCCA
TTAAAGTCAGTGAGCGTAATGGTAAGGTTGTCGGTGCTGTTCAAGTTGCACCAACTGACCAAATCATGATGATCACTGAT
GCTGGCACACTGGTACGTACTCGCGTATCCGAAGTGAGTGTCGTAGGGCGTAATACCCAAGGTGTGACCCTGATCCGTAC
CGCAGAAGATGAACATGTTGTTGGTTTGCAACGTGTCGCTGAACCTGAAGAGGATGATGATATCCTTGATGGCGAATCAT
CAGAAGGTGAAGAGGGCAGCGAAGAAAACGCGGCACTAAATGCACCATCAGATGATGTTGCCGATGAAGACACTGATGCA
GAAGACGACACTGATGTAGAAGACGACAACGCATAA

>>MEG_3225|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGCAGGATAAAAATTTAGTGAATGTCAATCTGACAAAGGAGATGAAGGCAAGTTTTATCGACTACGCCATGAGTGTTAT
CGTAGCGCGAGCTCTTCCTGATGTTCGAGATGGCTTAAAACCTGTTCACCGTCGCATTCTCTACGGAATGAATGAATTGG
GTGTGACCCCAGACAAACCCCATAAAAAATCTGCTCGTATTACAGGGGATGTCATGGGTAAATATCACCCACACGGGGAT
TCCTCTATTTATGAAGCCATGGTCCGTATGGCTCAATGGTGGAGCTACCGTTACATGCTTGTAGATGGTCATGGGAATTT
TGGTTCCATGGATGGAGATAGTGCTGCCGCTCAACGTTATACCGAGGCACGTATGAGCAAGATTGCTCTGGAAATGCTTC
GTGATATCAACAAAAATACAGTTGATTTCGTTGATAACTATGATGCCAATGAACGGGAACCCTTGGTCTTGCCAGCGCGT
TTTCCAAACCTTTTGGTTAATGGAGCAACTGGTATCGCGGTTGGGATGGCAACCAATATTCCACCTCATAATCTGGGTGA
AACCATTGATGCAGTGAAGTTGGTCATGGATAATCCTGAAGTGACTACCAAGGACTTGATGGAAGTCTTGCCTGGACCAG
ATTTTCCAACTGGTGCTCTTGTCATGGGGAAATCAGGTATCCATAAGGCTTATGAAACAGGTAAAGGTTCGATTGTCCTA
CGTTCTCGTACAGAGATTGAAACGACTAAGACTGGTCGTGAGCGTATCGTTGTAACAGAATTTCCTTACATGGTCAATAA
AACCAAGGTGCATGAGCATATTGTTCGCTTGGTTCAGGAAAAACGCATTGAGGGTATCACAGCAGTACGTGATGAGTCAA
ACCGTGAAGGTGTTCGATTTGTTATTGAAGTCAAGCGCGACGCCTCAGCCAATGTTATTCTCAATAACCTCTTCAAAATG
ACCCAAATGCAAACCAATTTTGGTTTCAATATGCTCGCTATCCAAAATGGTATACCGAAAATTTTGTCTCTTCGTCAGAT
TTTGGATGCTTATATCGAGCACCAAAAAGAAGTGGTTGTTCGTCGTACACGTTTTGATAAGGAAAAAGCGGAAGCGCGCG
CTCATATCTTAGAAGGTCTCTTGATTGCGCTAGACCATATCGACGAAGTGATTCGTATCATCCGTGCTAGTGAAACGGAT
GCGGAAGCTCAAGCTGAGTTGATGAGCAAGTTTAAGCTTTCTGAACGTCAAAGTCAAGCTATCCTTGATATGCGTCTTCG
TCGTTTGACAGGTTTGGAACGCGATAAGATTCAATCTGAGTATGATGACCTCTTGGCTCTGATTGCGGATTTAGCAGATA
TTCTTGCTAAGCCTGAACGTGTTTCTCAAATTATCAAAGACGAATTGGATGAAGTTAAACGTAAATTTTCTGATAAGCGC
CGTACAGAGTTGATGATTGGACAGGTCTTGAGTCTCGAGGATGAGGACTTGATTGAAGAATCGGATGTCTTGATTACCCT
TTCTAACAGAGGCTACATTAAGCGTTTGGATCAGGACGAGTTCACTGCTCAAAAACGTGGGGGTCGTGGTGTCCAAGGAA
CGGGAGTGAAAGATGATGACTTTGTTCGTGAGTTAGTGTCAACTAGCACCCATGATCATCTGCTCTTCTTCACAAACAAG
GGACGTGTCTATCGTCTTAAAGGTTATGAAATTCCTGAGTATGGTCGGACTGCCAAAGGGCTACCAGTAGTCAATCTCTT
GAAATTGGATGAAGACGAAAGTATTCAGACGGTTATCAATGTTGAGTCTGATCGCAGTGATGATGCTTATCTCTTCTTTA
CAACCCGTCACGGTATTGTGAAGAGAACCAGTGTTAAGGAGTTTGCCAATATTCGTCAAAATGGTCTCAAAGCGCTGAAT
TTAAAGGATGAAGATGAGTTAATCAATGTCTTGTTGGCAGAAGGAGATATGGATATTATCATTGGTACCAAGTTTGGTTA
TGCAGTTCGCTTTAATCAATCAGCCGTTCGTGGTATGAGTCGTATCGCCACTGGTGTGAAAGGTGTTAACCTTCGTGAAG
GAGACACAGTTGTTGGTGCCAGCTTGATTACTGATCAAGATGAGGTTCTTATTATCACAGAAAAAGGATATGGTAAGCGT
ACAGTCGCTACTGAATACCCAACAAAAGGTCGTGGTGGTAAGGGAATGCAGACAGCTAAAATTACCGAAAAAAATGGCTT
GCTGGCCGGTCTTATGACTGTTCAAGGGGATGAGGATTTGATGATTATCACTGATACAGGTGTCATGATTCGAACCAATC
TTGCCAATATTTCACAAACAGGACGTGCAACTATGGGAGTTAAAGTAATGCGCCTGGATCAAGATGCTCAGATAGTGACT
TTCACAACGGTTGCGGTGGCAGAAAAAGAAGAAGTTGGGACAGAAAACGAAACAGAAGGTGAAGCATAA

>>MEG_3226|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGGCGAACTGGCCAAAGAAATTCTCCCGGTCAATATCGAAGACGAGCTGAAACAGTCCTATCTCGACTACGCGATGAG
CGTGATCGTCGGGCGGGCCCTGCCGGATGCACGTGACGGCCTGAAGCCGGTGCACCGCCGTGTGCTTTATGCCATGAGCG
AGCTGGGCAACGACTGGAACAAGCCCTACAAGAAATCCGCCCGTGTGGTCGGCGACGTGATCGGTAAGTACCACCCGCAC
GGCGACACCGCGGTCTACGACACCATCGTGCGCATGGCGCAGCCGTTCTCGCTGCGCTACATGCTGGTAGACGGCCAGGG
CAACTTCGGTTCGGTGGACGGCGACAACGCCGCAGCCATGCGATACACCGAAGTGCGCATGGCCAAGCTGGCCCACGAAC
TGCTGGCGGACCTGGAAAAGGAAACCGTCGACTGGGTGCCCAACTACGATGGCACCGAGCAGATCCCGGCGGTCATGCCG
ACCAAGATTCCCAACCTGCTGGTCAACGGTTCCAGCGGTATCGCCGTGGGCATGGCGACCAACATCCCGCCGCACAACCT
CGGCGAAGTGATCGACGGCTGCCTGGCGCTGATGGACAACCCCGACCTGACCGTCGATGAGCTGATGCAGTACATCCCCG
GTCCGGACTTCCCCACCGCCGGCATCATCAACGGCCGCGCCGGGATCATCGAGGCCTACCGCACCGGTCGCGGGCGCATC
TACATCCGTGCCCGCGCCGTCGTCGAGGAGATGGAGAAGGGCGGCGGTCGCGAGCAGATTATCATCACCGAGCTGCCGTA
CCAGTTGAACAAGGCGCGGTTGATCGAGAAGATCGCCGAGCTGGTGAAAGAGAAGAAGATCGAGGGTATTTCCGAGCTGC
GCGACGAGTCTGACAAGGACGGCATGCGCGTGGTCATCGAGCTGCGTCGCGGCGAGGTGGGCGAGGTGGTCCTCAACAAC
CTCTATGCCCAGACCCAGCTGCAGAGCGTGTTCGGCATCAACGTGGTGGCCCTGGTCGACGGCCAGCCGCGCACGCTGAA
CCTGAAGGACATGCTCGAGGTGTTCGTCCGCCACCGCCGCGAAGTGGTGACCCGGCGTACCGTCTACGAGCTGCGCAAGG
CCCGCGAGCGCGGGCACATCCTGGAAGGCCAGGCGGTCGCCCTGTCGAACATCGACCCGGTGATCGAGCTGATCAAGAGT
TCGCCGACCCCGGCCGAGGCCAAGGAACGCCTGATCGCCACTGCCTGGGAGTCCAGCGCGGTGGAAGCGATGGTCGAGCG
TGCCGGCGCCGACGCCTGTCGTCCGGAAGACCTGGATCCGCAGTACGGCCTGCGCGACGGCAAGTACTACCTGTCGCCGG
AGCAGGCCCAGGCGATCCTCGAGCTGCGCCTGCATCGCCTGACCGGCCTGGAGCACGAGAAGCTGCTCTCCGAATACCAG
GAAATCCTCAACCTGATCGGCGAGCTGATCCGCATCCTGACCAACCCGGCGCGCCTGATGGAGGTGATCCGTGAGGAACT
GGAAGCGGTCAAGGCCGAATTCGGCGATGCTCGCCGCACCGAGATCGTGGCTTCCCAGGTCGACCTGACCATCGCCGACC
TGATCACCGAGGAAGACCGCGTGGTGACCATCTCGCACGGCGGCTACGCCAAGTCCCAGCCGCTGGCCGCCTACCAGGCG
CAGCGTCGCGGCGGCAAAGGCAAGTCCGCCACCGGGATGAAGGACGAGGACTACATCGAACACCTGCTGGTGGCCAACAG
CCATGCGACCCTCCTGCTGTTCTCCAGCAAGGGCAAGGTCTACTGGCTGCGTACCTTCGAGATTCCGGAAGCCTCGCGTA
CCGCGCGTGGCCGGCCGCTGGTGAACCTGCTGCCGCTGGATGAGGGCGAGCGGATCACCGCGATGTTGCAGATCGACCTG
GAGGCGCTGCAGCAGAACGGTGGCGCCGATGACGACCTCGACGAAGCCGAAGGCGCGGTGCTCGAGGGCGAGGTGGTCGA
GGCCGCCGAGGTCGAGGAAGTCGAGGGCGAGACCGCCGAGCTGGTGGCCGAGCCGACCGGCGCCTACATCTTCATGGCCA
CCGCCTTCGGTACCGTGAAGAAGACCCCGCTGGTGCAGTTCAGCCGTCCGCGCAGCAGCGGCCTGATCGCGCTCAAGCTG
GAAGAGGGCGACACCCTGATCGCCGCCGCGATCACCGATGGCGCCAAGGAAGTCATGCTGTTCTCCAGCGCCGGCAAGGT
GATCCGCTTCGCCGAGAGCGTGGTGCGCATCATGGGCCGCAACGCCCGCGGCGTACGTGGCATGCGCCTGGGCAAGGGGC
AGCAGCTGATCTCCATGCTGATTCCGGAGTCCGGGGCGCAGATCCTCACCGCCTCCGAGCGCGGCTTCGGCAAGCGTACC
CCGCTGAGCAAGTTCCCGCGTCGCGGCCGCGGCGGCCAGGGGGTGATCGCCATGGTCACCAACGAGCGCAACGGCGCGCT
GATCGCCGCGGTACAGGTCCAGGAAGGCGAGGAGATCATGCTGATTTCCGACCAGGGCACCCTGGTGCGGACGCGTGTCG
ACGAAGTCTCCCTGTCCGGCCGCAATACCCAGGGCGTAACCCTGATCAAGCTCGCCAGCGACGAGGTACTGGTCGGTCTG
GAGCGTGTCCAGGAGCCGTCGGGCGGAGATGACGAGGACCTGCCCGAGGGCGAGGAAGCTGCCGAATCTCTGGGCGAGTC
GGCCGAGTCCGAGTCCGAGCCCGCGGCGGAAGCGGAAGGCAACGAAGAGTAA

>>MEG_3227|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAAGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCAGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TACTAGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAT
GGTGACTCGGCAGTTTATGACACGATCGTCCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTAGACGGTCAGGG
TAACTTCGGTTCCATCGACGGCGACTCTGCGGCGGCAATGCGTTATACGGAAATCCGTCTGGCGAAAATTGCCCATGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTCGATTTCGTTGATAACTATGACGGCACGGAAAAAATTCCCGACGTCATGCCA
ACCAAAATTCCTAACCTGCTGGTGAACGGTTCTTCCGGTATCGCCGTAGGTATGGCAACCAACATCCCGCCGCACAACCT
GACGGAAGTCATCAACGGTTGTCTGGCGTATATCGATGATGAAGACATCAGCATTGAAGGGCTGATGGAACACATCCCGG
GGCCGGACTTCCCGACGGCGGCAATCATTAACGGTCGTCGCGGTATTGAAGAAGCTTACCGTACCGGTCGCGGCAAGGTA
TATATCCGCGCCCGTGCTGAAGTGGAAGTTGACGCCAAAACCGGACGTGAAACCATTATCGTCCACGAAATCCCGTATCA
GGTAAACAAAGCGCGCCTGATCGAGAAGATTGCGGAACTGGTAAAAGAAAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAGTCTGACAAAGACGGTATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTCGGTGAAGTTGTGCTCAACAACCTC
TACTCCCAGACCCAGTTGCAGGTTTCTTTCGGTATCAACATGGTGGCATTGCACCATGGTCAGCCAAAGATCATGAACCT
GAAAGACATCATCGCGGCGTTTGTTCGTCACCGCCGTGAAGTGGTGACCCGTCGTACTATTTTCGAACTGCGTAAAGCTC
GCGATCGTGCTCATATCCTTGAAGCATTAGCCGTGGCGCTGGCGAACATCGACCCGATCATCGAACTGATCCGTCATGCG
CCGACGCCTGCAGAAGCGAAAACTGCGCTGGTGGCTAATCCGTGGCAGCTGGGCAACGTTGCCGCGATGCTCGAACGTGC
TGGCGACGATGCTGCGCGTCCGGAATGGCTGGAGCCAGAGTTCGGCGTGCGTGATGGTCTGTACTACCTGACCGAACAGC
AAGCTCAGGCAATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTTGAGCACGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGATCAGATCGCGGAACTGCTGCGTATTCTTGGTAGCGCCGATCGTCTGATGGAAGTGATCCGTGAAGAGCTGGA
GCTGGTTCGTGAACAGTTCGGTGACAAACGTCGTACTGAAATCACCGCCAACAGCGCAGACATCAACCTGGAAGATCTGA
TCACCCAGGAAGATGTGGTCGTGACGCTCTCTCACCAGGGCTACGTTAAATATCAGCCGCTTTCTGAATACGAAGCGCAG
CGTCGTGGCGGGAAAGGTAAATCTGCCGCACGTATTAAAGAAGAAGACTTTATCGACCGACTGCTGGTGGCGAACACGCA
CGACCATATTCTGTGCTTCTCCAGCCGTGGTCGCGTCTATTCGATGAAAGTTTACCAGTTGCCGGAGGCCACTCGTGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTGCCGCTGGAGCAGGACGAACGTATCACCGCGATCCTGCCGGTGACCGAGTTT
GAAGAAGGCGTGAAAGTCTTCATGGCGACCGCTAACGGTACTGTGAAGAAAACCGTCCTCACCGAGTTCAACCGTCTGCG
TACCGCCGGTAAAGTGGCGATCAAACTGGTTGAAGGCGATGAGCTGATCGGCGTTGACCTGACCAGCGGCGAAGACGAAG
TAATGCTGTTCTCCGCCGAAGGTAAAGTGGTGCGCTTTAAAGAGTCTTCTGTCCGTGCGATGGGCTGCAACACCACCGGT
GTTCGCGGTATTCGTTTAGGCGAAGGTGATAAAGTCGTCTCTCTGATCGTGCCTCGTGGCGATGGCGCAATCCTCACCGC
AACGCAGAACGGTTATGGTAAACGTACCGCAGTGGCGGAATACCCGACTAAGTCGCGTGCGACGAAAGGGGTTATCTCCA
TCAAGGTTACCGAACGTAACGGTTTAGTTGTTGGCGCGGTACAGGTAGATGACTGCGACCAGATCATGATGATCACCGAT
GCCGGTACGCTGGTACGTACTCGCGTTTCAGAAATCAGCATCGTGGGCCGTAACACCCAGGGCGTGATCCTCATCCGTAC
TGCGGAAGATGAAAACGTAGTGGGTCTGCAACGTGTTGCTGAACCGGTTGACGAGGAAGATCTGGATACCATCGACGGCA
GTGCCGCGGAAGGGGACGATGAAATCGCTCCGGAAGTGGACGTTGACGACGAGCCAGAAGAAGAATAA

>>MEG_3228|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTATTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACTGGTCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGTCATATCTTGGAAGGCTTGACAGTTGCCTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGCGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTAATTCCTGAAGAGCAAGTGGTATTAACGGTTTCGCAAACGGGTTATGCAAAAACTCAACCTCTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCAACCTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAATGTGGGTAAAGTGTACCGTCTGAAAGTATTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAACTTGTTACCTCTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAGCAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACTTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAGGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGCGGTATGCGCGTGAGTTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAACAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGTGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3229|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
TTGAAGGAGGAACTCTTGATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATC
ATTTTTAGATTATGCGATGAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTC
GTATACTATATGGATTAAATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTA
ATGGGTAAATATCACCCTCATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTA
TCCGCTTGTTGATGGCCAAGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTA
TGACTAAAATCACACTTGAACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAA
AGAGAGCCGTCAGTCTTACCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAAC
GAATATTCCACCACATAACTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTG
AGTTAATGGAGGATATTGAAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATAT
GAAACAGGTCGTGGTTCAATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGT
CACTGAAATTCCTTTCCAAGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACG
GTATCACTGATTTACGTGATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCT
AGTGTCATTTTAAATAACTTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGG
TAGACCGAAGCTTATTAATTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGC
AATACAACTTACGTAAAGCTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATT
ATTTCAACGATTCGTGAGTCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACA
AGCTCAAGCTATTTTAGACATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGT
TATTAAATTATATTAGTGAATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACT
GAAATTAGAGATCGTTTCGGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTT
AATTCCAGAAGAACAAATAGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTC
AAAACCGTGGTGGTCGTGGTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACA
CATGACCATGTATTGTTCTTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACA
GTCTAAAGGTATTCCTGTAGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACC
TTGAAAGTGAAGACAACTTCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGA
ATAAATAGAAATGGTAAGATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGA
AGATATCTTGATTGGTACATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAA
CGGGTGTGAAAGGTATTACACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAA
GTATTAGTAGTTACTGAAAATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGG
TATTAAAACAGCTACGATTACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGA
TTGTTACTAATGCAGGTGTCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGC
TTAATTCGCTTAGGTGATGATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGA
TGAGCAATCTACTTCAACTGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAA
ATGCAATTCATACTGAAGTGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGAT
CGTGTTGAAGAAGATATACAACAATCATCAGATGAAGAATAA

>>MEG_3230|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTATTAGCCAATGGTGCATCAGGTATCGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAGCAATCTTAGCTGATGAAGAAGTGTTATTACAGTTAGTTAGAGATGAATTGACTGAAATTAGAGATCGTTTC
GGTGATGATCGTCGTACAGAAATTCAATTAGGTGGATTTGAAAACTTAGAGGACGAAGACTTAATTCCAGAAGAACAAAT
AGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTACGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGCTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGAATAA

>>MEG_3231|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGATTCCTTCGCCAAGGAGACGCTTCCGGTATCGCTGGAAGAAGAGATGCGCCGTAGCTATCTTGATTACGCGATGAG
CGTGATCGTGGGGCGCGCGCTGCCAGACGTGCGTGACGGTCTCAAGCCTGTGCATCGCCGCGTGCTGTACGCGATGCACG
AACTGAACAACGATTGGAACCGTGCCTATAAGAAGTCCGCGCGTATCGTCGGGGACGTCATCGGTAAGTACCACCCGCAC
GGCGACCAGTCGGTATACGACACCATCGTCCGCATGGCGCAGGACTTCTCCATGCGCTACATGCTGGTCGACGGCCAGGG
CAACTTCGGCTCCATCGACGGCGACAACGCCGCGGCGATGCGCTACACCGAAATCCGCCTGGCCAAGATCGCGCACGAGT
TGCTGGCCGATATCGACCAGGAAACGGTCGACTTCGGGCCCAACTACGACGGCAGCGAACAGGAGCCCCTGCTGCTGCCT
TCGCGCCTGCCCAACCTGCTGGTCAACGGCAGCTCGGGTATCGCCGTGGGCATGGCCACCAACATTCCCCCGCACAACCT
GCAGGAAGTGGTCGACGGCTGCCTGTATTGCCTGCGCAATCCGGAATGCTCGATCGACGAGCTGATCGAACTGATCCCGG
CGCCGGACTTTCCCACGGGCGGGGTGATCTACGGCATCACGGGCGTTCGCGAGGGGTACCGCACCGGGCGCGGCCGCGTC
ATCATGCGCGCCAAGACCCACTTCGAGGACATGGAGAAGGGCAACCGCCAGGCCATCGTGGTCGACGCGATTCCCTACCA
GGTCAACAAGAAGACCCTGCAGGAGCGCATCGCCGAGCTGGTCAACGACAAGAAGATCGAGGGCATTTCGGACATCCGCG
ACGAGTCGGACAAGGACGGCATGCGCCTGGTCATCGAGCTCAAGCGCGGCGAAGTGCCCGAGGTGGTGCTGAACAACCTG
TACAAGAATACGCAGCTGCAGGACACCTTCGGCATGAACCTGGTGGCGCTGGTCGACGGCCAGCCGCGCCTGCTGAACCT
CAAGCAGCTGATCGAGTACTTCCTGCAGCATCGCCGCGAAGTGGTGACGCGCCGCACCGTGTTCCAGCTGCGCAAGGCGC
GCGAACGCGGCCACGTGCTGGAAGGCCTGGCGGTGGCGCTGGCCAACATCGACGACTTCATCGCCATCATCAAGGCGGCG
CCCACCCCGCCGGTGGCGCGCCAGGAATTGATGGCGCGTTCCTGGGATTCGTCGCTGGTGCGTGAAATGCTGGCCCGCGT
CGACGGCGACGCCGCCGGCGGCGTCGCGGCGTTCCGCCCCGACGACCTGGCGCCCGAGTACGGCCTGCAGGGCGATGGCA
ACTACCGGCTGAGCGAGACCCAGGCGCAGGAAATCCTCAACATGCGCCTGCAACGCCTGACCGGCCTGGAGCAGGACAAG
ATCATCGGCGAGTACAAGGACGTGATGGCCACCATCGCCGACCTGCTCGACATCCTGGCCCGTCCGGATCGCATCACCAC
GATCATCAGCGAAGAGCTGCAGGCCATCAAGGCCGAGTTCTCGACCTCGGCCAAGGATACGCGCCGCGCCGAAATCGAAG
TCAACGCCACCGAGCTGGATACCGAAGACCTGATCACGCCGATGGACATGGTGGTCACCCTGTCGCATGGCGGATACATC
AAGAGCCAGCCGCTGTCCGAGTACCGTTCGCAAAAGCGCGGCGGACGCGGCAAGCAGGCTACCGCCATGAAGGAGAACGA
CTGGGTCGACCAGCTGTTCATCGCCAATACGCACGACTACCTGCTGTGCTTCTCCAACCGGGGCCGGGTGTACTGGCTGA
AGGTGTGGGAGGTGCCGCAGGGCACGCGCAACTCGCGCGGCAAGCCCATCGTCAACATGTTCCCGCTGGCCGACGGCGAG
AAGGTGACCGTGGTGCTGCCGGTCAAGGAATTCAGCGAAGACCACTACGTCTTCATGGCGACGTCGCGCGGCACGGTCAA
GAAGACCCCGCTGTCCGACTTCTCGAACCCGCGCAAGGCCGGCATCATCGCCGTCGACCTGGATGACGGCGATTACCTGA
TCGGCGCAGACCTGACCGACGGCAAGCACGATGTGATGTTGTTCTCCGACGCCGGCAAGGCGGTGCGCTTCGACGAGAAC
GACGTGCGTCCGATGGGCCGCAATGCGCGCGGCGTGCGCGGCATGATGCTCGAAGAGGGCCAGACCGTCATCGCGCTGCT
GGTGGCCGGCGACGAGACCCAGAGCGTGCTGACCGCCACCGAGAACGGCTACGGCAAGCGCACCCCGATCACCGAGTACA
CCCGCCATGGCCGCGGCACCAAGGGCATGATCGCCATCCAGACCAGCTCGCGCAACGGCCGCGTGGTCGGCGCCGTGCTG
GTGATGCCGTCCGACGAGATCATGCTGATCACCACCGGCGGCGTGCTGGTGCGCACCCGCGTGGCCGAGATCCGCGAGAT
GGGTCGCGCCACGCAGGGCGTCACGCTGATCAGCGTCGATGACGGCAGCAGCCTGTCCGGCGTGCGGCGCGTGGTCGAAA
GCGATGCCGACGCCGATGACGAGGATGGCGGCGAAGAGGGCGGCGAAGAGGGCGGCGACCAAGGCGGCGACGATACCGGC
GCCCAGGGCAAGGATTCTGAACCGACTGAACCTACGGAGTAA

>>MEG_3232|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGTATCGGAAATCCGACCGATTGCCATTGAGGACGAACTCAAGCATTCATATTTAGATTACGCGATGAGTGTAAT
TGTATCTCGTGCATTGCCGGATGTGAGAGACGGTCTTAAACCTGTTCACCGTCGTGTGCTTTATGCCATGCACGAATTGG
GCAATGACTATAACAAAGCCTACAAGAAATCTGCTCGTGTCGTTGGGGACGTAATCGGTAAATATCACCCGCATGGTGAC
TTAGCTGTTTATGAAACCATTGTTCGTATGGCTCAAGACTTTAGCTTACGTTATTTATTGGTTGATGGTCAGGGTAACTT
CGGTTCGATCGATGGTGATAGCGCTGCGGCAATGCGTTATACCGAAGTCCGTATGACTAAGCTGGCACATGAGCTTCTTG
CAGATTTAGAAAAAGACACAGTTGACTGGGAAGATAACTACGACGGTTCGGAACGTATCCCTGAAGTACTTCCGACACGT
GTTCCAAACTTGTTAATTAACGGTGCTGCTGGTATTGCTGTAGGTATGGCAACTAACATGGCACCACACAACATGACAGA
AGTTGTGAATGCTTGTTTGGCTTATGCTGACAATCCGAATATCTCGATTGAAGGATTGATGGAATACATTACCGGCCCTG
ACTTCCCTACAGGCGGTATTATTTACGGTAAATCAGGTATTGTTGATGCCTACCGTACCGGTAAAGGTCGTTTACACATT
CGTGGTAAATACCATTTCGAAGAAGATGAAAAGACAGGTCGTACAACCATCGTCTTTACTGAAATTCCATATCAAGTAAA
CAAAGCAAGAGTTATTGAACGTATTGCCGAGTTAGTAAAAGAGAAAAAGCTTGAAGGTATTTCAGAACTTCGTGATGAGT
CTGATAAAGAAGGTATGCGTATTGCAATTGACTTGAAACGCGGTGAAAACGCAGAAGTCGTTGTAAATAACTTATTCTTA
AATACCCAGCTTGAAAACTCATTCAGCATCAACATGGTTTGTCTAGACAATGGACAACCAAAATTGATGAATCTAAAAGA
TATTATTGCGGCATTTATTCGTCACCGCCAAGAAGTTGTGACACGCCGTACCATGTTCGAATTACGTAAAGCACGTGAAC
GTGGGCATATCTTGGAAGGCTTGACAGTTGCTTTAGCCAATATTGATGAAATTATTGAAACCATCAAAACTTCTGCAAAC
CCTGCTGAAGCGCGTGAGCGTTTACTTGCGGGTGAGTGGGCAGGTGGTGGCGTTGTTGCACTACTTGAAAAAGCTGGTGC
AATTTCTGTTCGCCCAGATGAAATTGAAGGTGAAGATCCAAATCGTCCATTTGGTTTAAGTGATTCAATTTATCGTCTGT
CACCAACACAAGTAGGCGCAATTTTAGAATTACGTTTACACCGTTTAACTGGTCTTGAACAAGACAAGTTACATGCGGAA
TATACTGAAATTTTAGGTCAAATTGCTGAACTTACTGCAATTTTAAATGACTTTAACTTGTTAATGGGTGTTATTCGCGA
AGAGTTGGCACAAGTTTTACAACAATATGGTGATGCACGTCGTACCGAAATTGTTGAATCTCGTGTGGATTTCTGCCGTG
AAGATTTGATTCCTGAAGAGCAAGTGGTATTAACTGTTTCACAAACGGGTTATGCAAAAACTCAACCACTTTCAGACTAT
CAGGCACAGCGCCGTGGTGGACGTGGTAAGTCTGCGACTTCAATGAAAGATGATGACTTTATTCAACATCTGATTGTGGC
ATCGAACCATGCGACCGTACTTTGCTTTACCAACGTGGGTAAAGTGTACCGTCTGAAAGTTTTTGAAGTTCCTCAAGCAT
CACGTGGGGCAAAAGGCCGTCCAATCGTGAATTTGTTACCACTAGATGCAACAGAAACCGTAACCGCAATCTTGCCGTTA
ACCGAGTTCCCGGAAAACCACTATGTGTTTATGGCGACAGCTTCTGGTACGGTTAAGCGTGTTGAGTTAGAACAATTTGC
AAACATTCGTTCAAATGGTCTACGTGCTATTGAACTTAATGAAGAAGATACCTTAATTGGTGTTGCGATTACTGATGGTA
ATCAGCAAATCATGTTGTTCTCTAACGAAGGTAAAGCAATTCGTTTTGCTGAAACTGACGTACGTGCAATGGGTCGTACA
GCGAAAGGTGTACGTGGTATGCGTGTAAGCTTTGCAAGCAGCACCTTAAGTGAAGAAGATGCAGATGTTGAAAATGATGA
TTCAGATGATAATGATGATTCAGCAGATTCAAGTCTAGTAAGTCGCATCGTATCGCTTGTTGTTGTACCTGAGACAGGCG
AAGTACTGTGCGCGAGTGCCAACGGTTATGGTAAACGTACTCCAGTAAATGACTTCCCGACCAAGAAACGTGGTGGTAAG
GGTGTTATTGCGATCAAGACAAGTGAACGTAACGGTGAGCTAGTTGGTGCAGTTTCTATTGATGAAACCAAAGAGTTATT
ATTAATTTCTGATGGTGGTACGCTTGTTCGTACGCGTGCTGCAGAAGTTGCAATGACAGGCCGTAATGCTCAAGGTGTTC
GTCTGATCCGTTTAAGCGAAGAAGAAACGCTCGTTGGCGTAGTTTCAATTGAAGCTGTAGAAGACGAAGAAGAACTTCTT
GAAGGTGAAGTAGATACGACTGAAACTGATAGCGAAGAAGCTGTATCTAATAATGAAGATACTTCTGAAGAGTAA

>>MEG_3233|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTTATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>>MEG_3234|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGCGACCTTGCGAGAGAAATTACACCGGTCAACATTGAGGAGGAGCTGAAGAGCTCCTATCTGGATTATGCGATGTC
GGTCATTGTTGGCCGTGCGCTGCCGGATGTCCGAGATGGCCTGAAGCCGGTACACCGTCGCGTACTTTACGCCATGAACG
TATTGGGCAATGACTGGAACAAAGCCTATAAAAAATCTGCCCGTGTCGTTGGTGACGTAATCGGTAAATACCATCCCCAC
GGCGATTCCGCAGTGTATGACACCATCGTTCGTATGGCGCAGCCATTCTCGCTGCGTTACATGCTGGTGGATGGTCAGGG
TAACTTCGGTTCTATTGACGGCGACTCCGCGGCGGCAATGCGTTATACGGAGATCCGTCTGGCGAAAATCGCCCACGAAC
TGATGGCCGATCTCGAAAAAGAGACGGTGGATTTCGTGGATAACTATGACGGTACGGAAAAAATTCCGGACGTCATGCCG
ACCAAAATTCCGAATCTGCTGGTGAACGGTTCTTCCGGTATCGCAGTAGGTATGGCGACGAATATCCCGCCGCACAACCT
GACGGAAGTGATTAACGGCTGCCTGGCGTATATCGACAACGAAGACATCAGCATTGAAGGGCTGATGGAACATATTCCGG
GGCCGGACTTCCCGACCGCCGCGATCATCAACGGTCGTCGTGGTATCGAAGAAGCCTACCGCACCGGTCGTGGCAAAGTG
TACATTCGCGCCCGCGCGGAAGTTGAAGCTGACGCCAAAACGGGCCGTGAAACCATCATCGTCCATGAAATTCCCTATCA
GGTGAACAAAGCGCGCCTGATCGAGAAAATCGCCGAGCTGGTGAAAGATAAACGCGTGGAAGGCATCAGCGCGCTGCGTG
ACGAATCCGACAAAGACGGGATGCGCATCGTGATTGAAGTGAAACGCGATGCGGTGGGCGAGGTGGTGCTTAATAATCTC
TACTCCCAGACCCAGCTACAGGTTTCCTTCGGTATTAACATGGTGGCGCTGCATCACGGCCAGCCGAAGATCATGAACCT
GAAAGATATCATTTCAGCGTTCGTGCGCCACCGCCGTGAAGTGGTGACGCGTCGGACTATTTTTGAACTGCGTAAAGCCC
GTGACCGTGCGCATATCCTTGAAGCTCTGGCGATTGCGCTGGCCAACATCGACCCGATTATCGAACTGATTCGCCGCGCG
CCAACGCCGGCGGAAGCAAAAGCGGCGCTGATTTCGCGTCCGTGGGATCTGGGCAACGTTGCTGCGATGCTGGAGCGCGC
TGGTGATGACGCCGCGCGTCCGGAATGGCTGGAGCCAGAATTTGGCGTGCGTGACGGTCAGTACTACCTGACTGAACAGC
AGGCGCAGGCGATTCTGGATCTGCGTTTGCAGAAACTGACCGGCCTGGAGCATGAAAAACTGCTCGACGAATACAAAGAG
CTGCTGGAGCAGATTGCTGAATTGCTGCACATTCTGGGCAGCGCCGATCGCCTGATGGAAGTGATCCGCGAAGAGATGGA
GTTAATTCGCGATCAGTTCGGCGATGAGCGTCGTACCGAAATCACCGCCAACAGCGCCGATATTAATATCGAAGATCTGA
TTAGCCAGGAAGATGTTGTCGTGACGCTGTCTCACCAGGGTTACGTCAAATATCAACCGCTGACAGATTACGAAGCGCAA
CGTCGTGGTGGGAAAGGTAAATCTGCCGCGCGTATTAAAGAAGAAGACTTTATCGACCGCCTGCTGGTGGCTAACACCCA
TGACACCATCCTCTGCTTCTCCAGCCGGGGCCGTCTGTACTGGATGAAGGTCTATCAGCTGCCGGAAGCCAGCCGCGGCG
CGCGCGGTCGTCCGATCGTCAACCTGCTGCCGCTGGAAGCCAACGAACGTATCACCGCGATTCTGCCGGTTCGTGAGTAT
GAAGAAGGCGTCAACGTCTTTATGGCGACCGCCAGCGGTACCGTGAAGAAAACGGCGCTGACCGAATTCAGCCGTCCGCG
TTCCGCCGGTATTATCGCGGTGAACCTCAACGACGGCGACGAGCTGATTGGCGTTGACCTGACTTCTGGTTCTGACGAAG
TCATGCTGTTCTCGGCCGCGGGTAAAGTGGTGCGCTTCAAAGAAGACGCCGTCCGTGCGATGGGGCGTACCGCGACCGGT
GTGCGCGGTATTAAGCTGGCGGGAGACGATAAAGTCGTCTCTCTGATCATCCCACGCGGCGAAGGCGCTATTCTGACCGT
AACGCAAAACGGCTACGGGAAGCGTACCGCAGCGGACGAGTACCCGACCAAGTCTCGTGCGACGCAGGGCGTTATCTCTA
TCAAAGTGACCGAGCGCAACGGTTCCGTTGTCGGTGCGGTACAGGTAGACGATTGCGACCAGATCATGATGATCACGGAT
GCCGGTACTCTGGTGCGTACCCGTGTGTCCGAGATCAGCGTAGTGGGACGTAATACCCAGGGCGTTATCCTTATCCGCAC
GGCGGAAGATGAAAACGTGGTGGGTCTGCAACGCGTTGCTGAACCGGTAGATGACGAAGAACTCGACGCTATCGACGGCA
GCGTGGCGGAAGGGGATGAGGATATCGCCCCGGAAGCGGAAAGCGATGACGACGTTGCGGATGACGCTGACGAGTAA

>>MEG_3235|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGAGTGAACAAAACACACCACAAGTTCGTGAAATAAATATCAGTCAGGAAATGCGTACGTCCTTCTTGGATTATGCAAT
GAGCGTTATCGTGTCCCGTGCTCTTCCGGATGTTCGTGACGGTTTAAAACCGGTTCATAGACGGATTTTGTATGCAATGA
ATGATTTAGGCATGACAAGTGACAAGCCTTATAAAAAATCCGCGCGTATCGTTGGAGAAGTTATCGGGAAATACCACCCG
CACGGTGATTCAGCGGTATATGAATCCATGGTCAGAATGGCTCAGGATTTCAACTACCGTTATATGCTCGTTGACGGTCA
CGGAAACTTCGGTTCTGTTGACGGAGACTCAGCGGCGGCCATGCGTTATACAGAAGCACGAATGTCTAAAATCTCAATGG
AGATTCTTCGCGACATCACAAAAGACACAATCGATTACCAGGATAACTATGACGGGTCAGAAAGAGAACCTGTCGTTATG
CCTTCAAGGTTCCCGAATCTGCTCGTGAACGGTGCTGCCGGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCACCA
GCTGGGAGAAATCATTGACGGTGTACTTGCTGTTAGTGAGAATCCGGACATTACAATTCCAGAGCTTATGGAAGTCATTC
CAGGGCCTGATTTCCCGACCGCGGGTCAAATCTTGGGACGCAGCGGTATCCGGAAAGCATACGAATCAGGCCGAGGCTCT
ATCACGATCCGGGCAAAAGCTGAGATCGAACAAACATCTTCGGGTAAAGAAAGAATTATCGTTACAGAGTTACCTTACCA
AGTAAATAAGGCGAAATTAATTGAGAAAATTGCTGATCTCGTAAGGGACAAAAAGATAGAGGGTATCACAGATCTGCGTG
ATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGAAATCAGACGCGATGCCAATGCGAATGTTATCTTAAACAATCTG
TACAAACAAACTGCTCTACAAACATCTTTTGGCATCAACCTGCTTGCGCTTGTTGATGGCCAGCCGAAAGTTTTAACTCT
TAAGCAATGCCTGGAGCATTACCTTGACCATCAAAAAGTTGTCATTAGACGCCGTACTGCTTATGAATTGCGTAAAGCAG
AAGCGAGAGCTCATATCTTGGAAGGATTGAGAGTTGCACTGGATCATCTCGATGCAGTTATCTCCCTTATCCGTAATTCT
CAAACGGCTGAAATTGCGAGAACAGGTTTAATTGAACAATTCTCACTGACAGAGAAGCAAGCACAAGCGATCCTTGACAT
GAGGCTCCAGCGTTTAACGGGACTGGAACGTGAAAAGATCGAAGAAGAATACCAGTCTCTTGTTAAATTAATTGCAGAGC
TAAAAGACATCTTGGCAAATGAATATAAAGTGCTTGAGATCATTCGTGAAGAACTCACGGAAATCAAAGAGCGTTTTAAC
GATGAAAGACGTACTGAGATCGTCACTTCTGGACTGGAGACAATTGAAGATGAAGATCTCATCGAGAGAGAAAATATCGT
AGTTACTCTGACGCACAACGGATACGTCAAACGTCTTCCTGCATCAACTTACCGCAGTCAAAAACGGGGCGGAAAAGGTG
TACAAGGTATGGGAACAAACGAAGATGATTTCGTTGAACATTTGATCTCTACGTCAACTCATGACACGATTCTCTTCTTC
TCGAACAAGGGGAAAGTGTATCGTGCAAAAGGGTATGAAATCCCTGAATACGGCAGAACGGCAAAAGGAATCCCGATTAT
TAACCTGCTGGAGGTAGAAAAGGGTGAGTGGATCAACGCGATTATTCCAGTCACGGAATTCAATGCGGAGCTTTACCTCT
TCTTCACTACAAAGCATGGGGTTTCAAAACGAACATCGCTATCTCAATTCGCTAATATCCGCAACAATGGTCTAATTGCT
CTGAGTCTTCGTGAAGATGATGAACTGATGGGTGTACGTCTGACTGACGGCACAAAACAAATCATCATTGGAACGAAAAA
CGGTTTACTGATTCGTTTCCCTGAAACAGATGTCCGAGAGATGGGAAGAACTGCGGCGGGCGTAAAAGGCATCACCCTGA
CGGATGACGACGTTGTTGTCGGCATGGAGATTTTAGAGGAAGAATCACACGTCCTTATCGTAACTGAAAAAGGGTACGGA
AAACGAACTCCTGCTGAAGAGTACAGAACCCAAAGCCGGGGCGGAAAAGGACTCAAAACAGCGAAAATCACCGAGAACAA
CGGCCAACTAGTAGCAGTGAAAGCTACTAAAGGTGAAGAGGATCTAATGATTATTACAGCTAGCGGCGTACTCATCAGAA
TGGACATCAATGATATCTCCATCACCGGACGTGTCACTCAAGGTGTGCGTCTCATCAGAATGGCAGAAGAAGAGCATGTT
GCTACAGTAGCTTTAGTTGAGAAAAACGAAGAAGATGAGAATGAAGAAGAACAAGAAGAAGTGTGA

>>MEG_3236|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGGCTGAATTACCTCAATCAAGAATAAATGAACGAAATATTACCAGTGAAATGCGTGAATCATTTTTAGATTATGCGAT
GAGTGTTATCGTTGCTCGTGCATTGCCAGATGTTCGTGACGGTTTAAAACCAGTACATCGTCGTATACTATATGGATTAA
ATGAACAAGGTATGACACCGGATAAATCATATAAAAAATCAGCACGTATCGTTGGTGACGTAATGGGTAAATATCACCCT
CATGGTGACTCATCTATTTATGAAGCAATGGTACGTATGGCTCAAGATTTCAGTTATCGTTATCCGCTTGTTGATGGCCA
AGGTAACTTTGGTTCAATGGATGGAGATGGCGCAGCAGCAATGCGTTATACTGAAGCGCGTATGACTAAAATCACACTTG
AACTGTTACGTGATATTAATAAAGATACAATAGATTTTATCGATAACTATGATGGTAATGAAAGAGAGCCGTCAGTCTTA
CCTGCTCGATTCCCTAACTTGTTAGCCAATGGAGCATCAGGTATAGCGGTAGGTATGGCAACGAATATTCCACCACATAA
CTTAACAGAATTAATCAATGGTGTACTTAGCTTAAGTAAGAACCCTGATATTTCAATTGCTGAGTTAATGGAGGATATTG
AAGGTCCTGATTTCCCAACTGCTGGACTTATTTTAGGTAAGAGTGGTATTAGACGTGCATATGAAACAGGTCGTGGTTCA
ATTCAAATGCGTTCTCGTGCAGTTATTGAAGAACGTGGAGGCGGACGTCAACGTATTGTTGTCACTGAAATTCCTTTCCA
AGTGAATAAGGCTCGTATGATTGAAAAAATTGCAGAGCTCGTTCGTGACAAGAAAATTGACGGTATCACTGATTTACGTG
ATGAAACAAGTTTACGTACTGGTGTGCGTGTCGTTATTGATGTGCGTAAGGATGCAAATGCTAGTGTCATTTTAAATAAC
TTATACAAACAAACACCTCTTCAAACATCATTTGGTGTGAATATGATTGCACTTGTAAATGGTAGACCGAAGCTTATTAA
TTTAAAAGAAGCGTTGGTACATTATTTAGAGCATCAAAAGACAGTTGTTAGAAGACGTACGCAATACAACTTACGTAAAG
CTAAAGATCGTGCCCACATTTTAGAAGGATTACGTATCGCACTTGACCATATCGATGAAATTATTTCAACGATTCGTGAG
TCAGATACAGATAAAGTTGCAATGGAAAGCTTGCAACAACGCTTCAAACTTTCTGAAAAACAAGCTCAAGCTATTTTAGA
CATGCGTTTAAGACGTCTAACAGGTTTAGAGAGAGACAAAATTGAAGCTGAATATAATGAGTTATTAAATTATATTAGTG
AATTAGAAACAATCTTAGCTGATGAAGAAGTATTACTACAATTAGTTAGAGATGAATTAACAGAAATTCGAGATCGTTTC
GGTGATGATCGTCGTACTGAAATCCAATTAGGTGGATTTGAAGATTTAGAAGATGAAGATCTCATTCCAGAAGAACAAAT
TGTAATTACACTAAGCCATAATAACTACATTAAACGTTTGCCGGTATCTACATATCGTGCTCAAAACCGTGGTGGTCGTG
GTGTTCAAGGTATGAATACATTGGAAGAAGATTTTGTCAGTCAATTGGTAACTTTAAGTACACATGACCATGTATTGTTC
TTTACTAACAAAGGTCGTGTATACAAACTTAAAGGTTATGAAGTGCCTGAGTTATCAAGACAGTCTAAAGGTATTCCTGT
AGTGAATGCTATTGAACTTGAAAATGATGAAGTCATTAGTACAATGATTGCTGTTAAAGACCTTGAAAGTGAAGACAACT
TCTTAGTGTTTGCAACTAAACGTGGTGTCGTTAAACGTTCAGCATTAAGTAACTTCTCAAGAATAAATAGAAATGGTAAG
ATTGCGATTTCGTTCAGAGAAGATGATGAGTTAATTGCAGTTCGCTTAACAAGTGGTCAAGAAGATATCTTGATTGGTAC
ATCACATGCATCATTAATTCGATTCCCTGAATCAACATTACGTCCTTTAGGCCGTACAGCAACGGGTGTGAAAGGTATTA
CACTTCGTGAAGGTGACGAAGTTGTAGGGCTTGATGTAGCTCATGCAAACAGTGTTGATGAAGTATTAGTAGTTACTGAA
AATGGTTATGGTAAACGTACGCCAGTTAATGACTATCGTTTATCAAATCGTGGTGGTAAAGGTATTAAAACAGCTACGAT
TACTGAGCGTAATGGTAATGTTGTATGTATCACTACAGTAACTGGTGAAGAAGATTTAATGATTGTTACTAATGCAGGTG
TCATTATTCGACTAGATGTTGCAGATATTTCTCAAAATGGTCGTGCAGCACAAGGTGTTCGCTTAATTCGCTTAGGTGAT
GATCAATTTGTTTCAACGGTTGCTAAAGTAAAAGAAGATGCAGAAGATGAAACGAATGAAGATGAGCAATCTACTTCAAC
TGTATCTGAAGATGGTACTGAACAACAACGTGAAGCGGTTGTAAATGATGAAACACCAGGAAATGCAATTCATACTGAAG
TGATTGATTCAGAAGAAAATGATGAAGATGGACGTATTGAAGTAAGACAAGATTTCATGGATCGTGTTGAAGAAGATATA
CAACAATCATCAGATGAAGATGAAGAATAA

>>MEG_3237|Drugs|Fluoroquinolones|Fluoroquinolone-resistant_DNA_topoisomerases|GYRA|RequiresSNPConfirmation
ATGACAGACACGACGTTGCCGCCTGACGACTCGCTCGACCGGATCGAACCGGTTGACATCCAGCAGGAGATGCAGCGCAG
CTACATCGACTATGCGATGAGCGTGATCGTCGGCCGCGCGCTGCCGGAGGTGCGCGACGGGCTCAAGCCCGTGCATCGCC
GGGTGCTCTATGCAATGTTCGATTCCGGCTTCCGCCCGGACCGCAGCCACGCCAAGTCGGCCCGGTCGGTTGCCGAGACC
ATGGGCAACTACCACCCGCACGGCGACGCGTCGATCTACGACACCCTGGTGCGCATGGCCCAGCCCTGGTCGCTGCGCTA
CCCGCTGGTGGACGGCCAGGGCAACTTCGGCTCGCCAGGCAATGACCCACCGGCGGCGATGAGGTACACCGAAGCCCGGC
TGACCCCGTTGGCGATGGAGATGCTGAGGGAAATCGACGAGGAGACAGTCGATTTCATCCCTAACTACGACGGCCGGGTG
CAAGAGCCGACGGTGCTACCCAGCCGGTTCCCCAACCTGCTGGCCAACGGGTCAGGCGGCATCGCGGTCGGCATGGCAAC
CAATATCCCGCCGCACAACCTGCGTGAGCTGGCCGACGCGGTGTTCTGGGCGCTGGAGAATCACGACGCCGACGAAGAGG
AGACCCTGGCCGCGGTCATGGGGCGGGTTAAAGGCCCGGACTTCCCGACCGCCGGACTGATCGTCGGATCCCAGGGCACC
GCTGATGCCTACAAAACTGGCCGCGGCTCCATTCGAATGCGCGGAGTTGTTGAGGTAGAAGAGGATTCCCGCGGTCGTAC
CTCGCTGGTGATCACCGAGTTGCCGTATCAGGTCAACCACGACAACTTCATCACTTCGATCGCCGAACAGGTCCGAGACG
GCAAGCTGGCCGGCATTTCCAACATTGAGGACCAGTCTAGCGATCGGGTCGGTTTACGCATCGTCATCGAGATCAAGCGC
GATGCGGTGGCCAAGGTGGTGATCAATAACCTTTACAAGCACACCCAGCTGCAGACCAGCTTTGGCGCCAACATGCTAGC
GATCGTCGACGGGGTGCCGCGCACGCTGCGGCTGGACCAGCTGATCCGCTATTACGTTGACCACCAACTCGACGTCATTG
TGCGGCGCACCACCTACCGGCTGCGCAAGGCAAACGAGCGAGCCCACATTCTGCGCGGCCTGGTTAAAGCGCTCGACGCG
CTGGACGAGGTCATTGCACTGATCCGGGCGTCGGAGACCGTCGATATCGCCCGGGCCGGACTGATCGAGCTGCTCGACAT
CGACGAGATCCAGGCCCAGGCAATCCTGGACATGCAGTTGCGGCGCCTGGCCGCACTGGAACGCCAGCGCATCATCGACG
ACCTGGCCAAAATCGAGGCCGAGATCGCCGATCTGGAAGACATCCTGGCAAAACCCGAGCGGCAGCGTGGGATCGTGCGC
GACGAACTCGCCGAAATCGTGGACAGGCACGGCGACGACCGGCGTACCCGGATCATCGCGGCCGACGGAGACGTCAGCGA
CGAGGATTTGATCGCCCGCGAGGACGTCGTTGTCACTATCACCGAAACGGGATACGCCAAGCGCACCAAGACCGATCTGT
ATCGCAGCCAGAAACGCGGCGGCAAGGGCGTGCAGGGTGCGGGGTTGAAGCAGGACGACATCGTCGCGCACTTCTTCGTG
TGCTCCACCCACGATTTGATCCTGTTCTTCACCACCCAGGGACGGGTTTATCGGGCCAAGGCCTACGACTTGCCCGAGGC
CTCCCGGACGGCGCGCGGGCAGCACGTGGCCAACCTGTTAGCCTTCCAGCCCGAGGAACGCATCGCCCAGGTCATCCAGA
TTCGCGGCTACACCGACGCCCCGTACCTGGTGCTGGCCACTCGCAACGGGCTGGTGAAAAAGTCCAAGCTGACCGACTTC
GACTCCAATCGCTCGGGCGGAATCGTGGCGGTCAACCTGCGCGACAACGACGAGCTGGTCGGTGCGGTGCTGTGTTCGGC
CGACGACGACCTGCTGCTGGTCTCGGCCAACGGGCAGTCCATCAGGTTCTCGGCGACCGACGAGGCGCTGCGGCCAATGG
GTCGTGCCACCTCGGGTGTGCAGGGCATGCGGTTCAATATCGACGACCGGCTGCTGTCGCTGAACGTCGTGCGTGAAGGC
ACCTATCTGCTGGTGGCGACGTCAGGGGGCTATGCGAAACGTACCGCGATCGAGGAATACCCGGTACAGGGCCGCGGCGG
TAAAGGTGTGCTGACGGTCATGTACGACCGCCGGCGCGGCAGGTTGGTTGGGGCGTTGATTGTCGACGACGACAGCGAGC
TGTATGCCGTCACTTCCGGCGGTGGCGTGATCCGCACCGCGGCACGCCAGGTTCGCAAGGCGGGACGGCAGACCAAGGGT
GTTCGGTTGATGAATCTGGGCGAGGGCGACACACTGTTGGCCATCGCGCGCAACGCCGAAGAAAGTGGCGACGATAATGC
CGTGGACGCCAACGGCGCAGACCAGACGGGCAATTAA