MEGAResFrom MEG, the Microbial Ecology Group

FACT

The facT gene encodes a confirmed efflux pump that acts on factumycin.

References

Sequences

Download Sequences

>CARD|phgb|JQ768046|7760-9440|ARO:3001313|facT|Elfamycins|Elfamycin_efflux_pumps|FACT
ATGAACAAGGCAGGGCAGGCAGAAAAGCCGGCGGCAGCCGGCCCACCTGCCACTCCCGAGACGCCCGAGCCCGACCCGAA
GCGGTGGCTCGCGCTGACAGTCCTGCTGGTCGCCACCTTCATGGACCTGCTCGACGCGAACATCATCACCGTGGCCATCC
CGAGCATCCAACGCGACCTCGGCGCCTCGACCTTCGCCATCCAGGCGATGACGGCCGGCTACACCCTGAGCTTCGCGGTC
CTGCTGATCACCGGCGGCCGGCTCGGCGACATCTTCGGCCGCAAGCGCATGTTCCTCGTCGGCGTCGGCGGCTTCGTCCT
CGCGTCCGCGATGTGCGCCGCCGCGCCGAGCACCGACTTACTCGTCGTCGCCCGCGCGCTCCAGGGCCTCACCGCCGCCG
TCATGGTGCCCCAGGTGCTCGCGCTCATCCACGTCTCCTTCGCGCCCCAGGAGATCGGCCGCGTCGTCAGCCTGTACGCG
AGCATGGTCGGTCTGGCCATCGTCTCCGGGCCCCTCATCGGCGGTGCGCTGATCAGCTGGAACCCGCTGGACCTCGGCTG
GCGCAGCATCTTCGTGGTGAACCTGCCGGTCGGCGTGCTCGCCCTGGTCGGCGCCGCGAAGTGGATGCGGGAGTCGAGCT
CCCCCCATGCGAAGCGCCTGGACATCGCCGGCATGCTGCTGATCGTGCTCGGCCTGCTGCTGCTCATGGTGCCGCTGACC
CTCGGCCGCGAGCTCGACTGGCCGGTGTGGAGCATCGTCTCGCTCGTCGCCGCCGCCCCCGTCCTCGTGCTGTTCGTCGT
CTACGAGCGCCACAAGACCGCCAAGGACGGCTCGCCCCTGGTGACGCTGTCCCTGTTCAAGGTCCGCGCGTTCGGCGCCG
GCATCGGCGTCCAGCTCCTCTTCAGCGCCATCCCCGCGGGCTTCTTCCTCAGCTGGACCCTCTACCTCCAGGCCGGCCTC
GGCTGGTCGGCCCTGCACACGGGCCTGACCGCCATCCCGTTCTCCCTGTGCGTCCCGATCGTCGGCGGTCTCGCCGTCCG
CAGGCTCTCGCCGCTCTACGGCCGCTACTGCCTGCTCGCCGGTGCCGTCCTGATGCTCGCGGGCATCCTCTCCTACGCCT
GGGCGGCCGACCGCTTCGGCACGGACATCACCTCCTGGCACGCGATCCCGTCCATGCTCCTGATCGGCTCCGGCATGGGC
ATGCTGATGCCCCCGCTGACGGCGCTGGTGCTCAGGGAGGTCCAGCCGCAGGAGGCCGGCGCCGCCTCCGGCATCATCAA
CGCCACCGGCCAGCTCGGTGCCGCGCTCGGCGTGGCGGTCATCGGCAGCCTCTTCTTCGCGGCCCTCGCCGGCAACGCCG
GGCCGCAGGCCGAACGCGTCGCCCCCACCGTGCAGTCGGTCTCACCCCGGCAGGCCTCCGACCTCCGGGACTGCGCGACC
GAGGCGCTGGGCCAGGACGACCTGGCCAAGGTCCCGGACATCTGCTCCACCCTGGTGCAGGGCGCCGACGACGGCACCCG
GGATACGATCAATGGCGCGCTCGGCGAGATCCGCGCGAAGACGTTCGTGTCCACCTACAGCGAGACGCTGTACTGGGCGG
CCGGTGGCCTCGTCCCGGTCACCGCCCTCGTCCTGCTCCTGCCGCACCACCGCGTCCGGCGGGAGGAACCGGCCCAGTGA
G