MEGAResFrom MEG, the Microbial Ecology Group

FACT

The facT gene encodes a confirmed efflux pump that acts on factumycin.

References

  • http://www.nature.com/nbt/journal/v31/n10/abs/nbt.2685.html

Sequences

Download Sequences

>>MEG_2880|Drugs|Elfamycins|Elfamycin_efflux_pumps|FACT
ATGAACAAGGCAGGGCAGGCAGAAAAGCCGGCGGCAGCCGGCCCACCTGCCACTCCCGAGACGCCCGAGCCCGACCCGAA
GCGGTGGCTCGCGCTGACAGTCCTGCTGGTCGCCACCTTCATGGACCTGCTCGACGCGAACATCATCACCGTGGCCATCC
CGAGCATCCAACGCGACCTCGGCGCCTCGACCTTCGCCATCCAGGCGATGACGGCCGGCTACACCCTGAGCTTCGCGGTC
CTGCTGATCACCGGCGGCCGGCTCGGCGACATCTTCGGCCGCAAGCGCATGTTCCTCGTCGGCGTCGGCGGCTTCGTCCT
CGCGTCCGCGATGTGCGCCGCCGCGCCGAGCACCGACTTACTCGTCGTCGCCCGCGCGCTCCAGGGCCTCACCGCCGCCG
TCATGGTGCCCCAGGTGCTCGCGCTCATCCACGTCTCCTTCGCGCCCCAGGAGATCGGCCGCGTCGTCAGCCTGTACGCG
AGCATGGTCGGTCTGGCCATCGTCTCCGGGCCCCTCATCGGCGGTGCGCTGATCAGCTGGAACCCGCTGGACCTCGGCTG
GCGCAGCATCTTCGTGGTGAACCTGCCGGTCGGCGTGCTCGCCCTGGTCGGCGCCGCGAAGTGGATGCGGGAGTCGAGCT
CCCCCCATGCGAAGCGCCTGGACATCGCCGGCATGCTGCTGATCGTGCTCGGCCTGCTGCTGCTCATGGTGCCGCTGACC
CTCGGCCGCGAGCTCGACTGGCCGGTGTGGAGCATCGTCTCGCTCGTCGCCGCCGCCCCCGTCCTCGTGCTGTTCGTCGT
CTACGAGCGCCACAAGACCGCCAAGGACGGCTCGCCCCTGGTGACGCTGTCCCTGTTCAAGGTCCGCGCGTTCGGCGCCG
GCATCGGCGTCCAGCTCCTCTTCAGCGCCATCCCCGCGGGCTTCTTCCTCAGCTGGACCCTCTACCTCCAGGCCGGCCTC
GGCTGGTCGGCCCTGCACACGGGCCTGACCGCCATCCCGTTCTCCCTGTGCGTCCCGATCGTCGGCGGTCTCGCCGTCCG
CAGGCTCTCGCCGCTCTACGGCCGCTACTGCCTGCTCGCCGGTGCCGTCCTGATGCTCGCGGGCATCCTCTCCTACGCCT
GGGCGGCCGACCGCTTCGGCACGGACATCACCTCCTGGCACGCGATCCCGTCCATGCTCCTGATCGGCTCCGGCATGGGC
ATGCTGATGCCCCCGCTGACGGCGCTGGTGCTCAGGGAGGTCCAGCCGCAGGAGGCCGGCGCCGCCTCCGGCATCATCAA
CGCCACCGGCCAGCTCGGTGCCGCGCTCGGCGTGGCGGTCATCGGCAGCCTCTTCTTCGCGGCCCTCGCCGGCAACGCCG
GGCCGCAGGCCGAACGCGTCGCCCCCACCGTGCAGTCGGTCTCACCCCGGCAGGCCTCCGACCTCCGGGACTGCGCGACC
GAGGCGCTGGGCCAGGACGACCTGGCCAAGGTCCCGGACATCTGCTCCACCCTGGTGCAGGGCGCCGACGACGGCACCCG
GGATACGATCAATGGCGCGCTCGGCGAGATCCGCGCGAAGACGTTCGTGTCCACCTACAGCGAGACGCTGTACTGGGCGG
CCGGTGGCCTCGTCCCGGTCACCGCCCTCGTCCTGCTCCTGCCGCACCACCGCGTCCGGCGGGAGGAACCGGCCCAGTGA