MEGAResFrom MEG, the Microbial Ecology Group

MEXT

The mexT gene encodes a transcriptional regulator that affects expression of the MexEF efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3932|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXT|RequiresSNPConfirmation
ATGAACCGAAACGACCTGCGCCGCGTCGATCTGAACCTGCTGATCGTGTTCGAGACCCTGATGCACGAACGCAGCCTGAC
CCGCGCCGCAGAGAAACTGTTCCTCGGCCAGCCGGCCATCAGCGCCGCGCTGTCGCGCCTGCGCACGCTGTTCGACGACC
CGCTGTTCGTCCGTACCGGACGCAGCATGGAGCCCACCGCGCGAGCCCAGGAAATCTTCGCCCACCTGTCGCCGGCGCTG
GATTCCATCTCCACCGCCATGAGTCGCGCCAGCGAGTTCGATCCGGCGACCAGCACCGCGGTGTTCCGCATCGGCCTTTC
CGACGACGTCGAGTTCGGCCTGTTGCCGCCCCTGCTCCGCCGCCTGCGCGCGGAGGCGCCGGGGATCGTCCTCGTCGTGC
GCCGCGCCAACTATCTATTGATGCCGAACCTGCTGGCCTCGGGGGAGATCTCGGTGGGCGTCAGCTACACCGACGAACTG
CCGGCCAACGCCAAGCGCAAGACCGTGCGCCGCAGCAAGCCGAAGATCCTCCGCGCCGACTCCGCGCCCGGCCAGCTGAC
CCTCGACGACTATTGCGCGCGACCGCACGCGCTGGTGTCCTTCGCCGGCGACCTCAGCGGCTTCGTCGACGAGGAGCTGG
AAAAATTCGGCCGCAAGCGCAAGGTGGTCCTGGCGGTGCCGCAGTTCAACGGCCTCGGCACCCTCCTGGCCGGCACCGAC
ATCATCGCCACCGTGCCCGACTACGCCGCCCAGGCGCTGATCGCCGCCGGCGGCCTACGCGCCGAGGACCCACCGTTCGA
GACCCGGGCCTTCGAACTGTCGATGGCTTGGCGCGGCGCCCAGGACAACGATCCGGCCGAACGCTGGCTGCGCTCGCGGA
TCAGCATGTTCATCGGCGATCCGGACAGTCTCTGA

>>MEG_3933|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXT|RequiresSNPConfirmation
ATGCCTGTCAGTGATCCTATGCCCCTCCGGCACCTCGCCAGGCCCCGCCCCGTCTCGCACGCAAGGCTTGACGGCGAGCC
CCCGCGGTTGCAGCCTCTAGCCCCTGGAAACGAGGAACGCCATGAACCGAAACGACCTGCGCCGCGTCGATCTGAACCTG
CTGATCGTGTTCGAGACCCTGATGCACGAACGCAGCGTGACCCGCGCCGCAGAGAAACTGTTCCTCGGCCAGCCGGCCAG
CCGGCCATCAGCGCCGCGCTGTCGCGCCTGCGCACGCTGTTCGACGACCCGCTGTTCGTCCGTACCGGACGCAGCATGGA
GCCCACCGCGCGAGCCCAGGAAATCTTCGCCCACCTGTCGCCGGCGCTGGATTCCATCTCCACCGCCATGAGTCGCGCCA
GCGAGTTCGATCCGGCGACCAGCACCGCGGTGTTCCGCATCGGCCTTTCCGACGACGTCGAGTTCGGCCTGTTGCCGCCC
CTGCTCCGCCGCCTGCGCGCGGAGGCGCCGGGGTTCGTCCTCGTCGTGCGCCGCGCCAACTATCTATTGATGCCGAACCT
GCTGGCCTCGGGGGAGATCTCGGTGGGCGTCAGCTACACCGACGAACTGCCGGCCAACGCCAAGCGCAAGACCGTGCGCC
GCAGCAAGCCGAAGATCCTCCGCGCCGACTCCGCGCCCGGCCAGCTGACCCTCGACGACTATTGCGCGCGACCGCACGCG
CTGGTGTCCTTCGCCGGCGACCTCAGCGGCTTCGTCGACGAGGAGCTGGAAAAATTCGGCCGCAAGCGCAAGGTGGTCCT
GGCGGTGCCGCAGTTCAACGGCCTCGGCACCCTCCTGGCCGGCACCGACATCATCGCCACCGTGCCCGACTACGCCGCCC
AGGCGCTGATCGCCGCCGGCGGCCTACGCGCCGAGGACCCACCGTTCGAGACCCGGGCCTTCGAACTGTCGATGGCTTGG
CGCGGCGCCCAGGACAACGATCCGGCCGAACGCTGGCTGCGCTCGCGGATCAGCATGTTCATCGGCGATCCGGACAGTCT
CTGA

>>MEG_3934|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXT
ATGAATCTGGAGCGGGTAGATCTTAATCTATTAATATATCTTGATGTTCTTCTTCGTGAAAAAAACGTTACTCGCGCAGC
CGAACAGCTTGGTGTTACTCAGCCTGCCATGAGTAATATTTTACGCCGCTTGCGTAATTTATTTAATGACCCTCTCCTGA
TCCGCTCATCTGAAGGGATGACACCGACAGAACGTGCACTTGAATTACAACCGCGTATTCGTGATGCTCTTTCCGACCTT
TCAATGATTTTGGAACCGCGTACCGAATTCCGCCCTTATACCAGTAATCGCGTTTTCCGTATTATGACTTCTGACTATGC
AGAAGCCACCCTAGTCCCTCGTCTTGTTAAAGCCCTCCGCTCAGAAGCACCAAACGTTGTACTCGATTTTCTTACTCCAA
GTGATGTGTCATATAGAGACATGGAACAAGGTAAAGTTGATCTAGCCATTAACCGCTTCAATGAAATCCCGCAAAGCTTC
CATCAAGTTTTGGTTTGGCGTGATAGCTTTAGCTGTATTTTAAATGACAAACACCCTGCTGTGACTCATTTAAATCTAAA
AAGCTATTTAGATGCTCAACATATTTGGGTATCTAAAACGGGTATGGGTGTTGGCTTTGGGGTAAACCCAGATAAACAAG
GTGGCTTGGGCTGGATTGATCAAGCATTAGAACGTATTGGTCAACGCCGCAAAATTTCTGTATTTACGCGTCACTATCAG
ATGCCGGCATTACTTGCTCAAAATGTTGACTTGATCGCTACTCTTCCAACTCGAATGGCACGTTTACAAGCACAAAATCC
AAAATTAGTTATTAAAGATCCACCGTTTTACATTCCTGAGTTTGAACTTAAAATGGCTTGGTGTCCATTATTGCACCATC
ACCCAGCTCATCGCTGGTTACGCCAACTCATTCTATTTGTTGCTCGCCAAATGATCGAAGAGGAAAATCGTGAATTCCTG
ACTAATAATTCACAATTTTCCCACTATTAA