Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

MEXS

The mexRS genes encode a two-component regulator system of the MarR family that affect expression of the mexAB multi-drug efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3931|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXS|RequiresSNPConfirmation
ATGTCCCGAGTGATCCGTTTTCATCAGTTTGGCCCGCCAGAGGTCCTCAAATGCGAAGAGCTGCCGACCCCGGCGCCGGC
CGCAGGGGAAGTCCTGGTGCGTGTCCAGGCGATCGGCGTGAGCTGGAAGGATGTGCTCTGGCGTCAGAACCTGGCCCCGG
AGCAGGCTGCGCTGCCGTCCGGTCTCGGCTTCGAACTGGCCGGCGAGGTGCTGGCGGTCGGCGCCGGCGTCGGCGACCTG
CCGCTGGGTTCCCGCGTGGCCAGTTTCCCCGCCCATACCCCCGATCATTATCCGGCCTATGGCGACGTGGTGCTGATGCC
GCGCGCGGCCCTGGCGGTCTACCCCGAGGTACTCACCCCGGTGGAGGCCAGCGTCTACTACACCGGCCTGCTGGTGGCCT
ATTTCGGCCTGGTCGACCTGGCCGGGTTGAAGGCCGGGCAGACCGTGCTGATCACCGAGGCGGCGCGCATGTACGGGCCG
GTCTCGATCCAGTTGGCCAAGGCTCTCGGCGCGCGGGTGATCGCTTCCACCAAGTCCGCCGAGGAGCGCGAGTTCCTCCG
CGAGCAGGGCGCCGACAAGGTGGTGGTGACCGACGAGCAGGACCTGGTCCTGGAAGTCGAGCGCTTCACCGAGGGCAAGG
GCGTCAATGTCATCCTCGACGAATTGGGCGGTCCGCAGATGACCCTGCTCGGCGATGTCTCCGCCACCCGCGGCAAGCTG
GTGCTGTATGGCTGCAACGGCGGCAACGAGTCGGCGTTCCCGGCCTGCGCCGCGTTCAAGAAGCACCTGCAGTTCTACCG
CCACTGCCTGATGGATTTCACCGGTCATCCGGAGATGGGCCTGGAACGCAACGACGAGTCGGTGAGCAAGGCCCTCGCGC
ACATCGAGCAACTGACCCGCGATCGCCTGCTCAAACCGGTGGTCGACCGGGTATTCGAGTTCGACCAGGTGGTCGAGGCG
CACCGCTACATGGAAACCTGTCCAAAGCGCGGCCGGGTGGTGATCCACGTCGCCGATTGA