MEGAResFrom MEG, the Microbial Ecology Group

MEXL

The mexL gene is a repressor of the MexJK multi-drug efflux system in Pseudomonas aeruginosa.

References

  • http://www.dtic.mil/cgi-bin/GetTRDoc?Location=U2&doc=GetTRDoc.pdf&AD=ADA401835

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>MEG_3919|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MEXL
ATGTCAGAATCCACCTCCTCCGTCGGTCCCGGCCGGCCCAAGGACCCGGCCAAACGGGAAGCCATTCTCGAGGCGGCCAA
GCGCCTGTTCCTCTGCAACGGCTACGACGGCAGCAGCATGGAAGCCATCGCCTCGGAAGCCGGCGTTTCCAAGCTCACCG
TCTACAGCCACTTCACCGACAAGGAAACCCTGTTCAGCGAAGCGGTGAAGGCCAAGTGCGCCGAGCAGCTTCCCGCCCTG
TACTTCCAGCTGGCCGAAGGCGCGCCACTGGAAAAGGTCCTGCTGAATATCGCCCGCGGCTTCCACCGGCTGATCAACAG
CCACGAGGCGATCGCCCTGACCCGCCTGATGGCCGCGCAGGCCGGGCAGAACCCCAAGCTTTCCGAGCTGTTCTTCGAGG
CCGGGCCGAAGCAGGTGATCGACGAGATGGAACGCCTCCTCGAGCAGGCCCGCCGCAGCGGCAAGCTGGCGTTCCCGGAC
GCGCGCCACGCCGCCGAACACTTCTTCATGCTGGTCAAGGGCTGCGCCAATTACCGTCTGTTGATCGGCTGCGCCGAACC
GCTGGACGAGGCCGAAGGCGAGCGGCACGTGGAAGAAGTGGTGGCGCTGTTCCTGCGCGCCTTCGCCGCGGGCGGCTGA