MEGAResFrom MEG, the Microbial Ecology Group

MARR

The marR gene encodes a MarR family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3663|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MARR
GTGAAAAGTACCAGCGATCTGTTCAATGAAATTATTCCATTGGGTCGCTTAATCCATATGGTTAATCAGAAGAAAGATCG
CCTGCTTAACGAGTATCTGTCTCCGCTGGATATTACCGCGGCACAGTTTAAGGTGCTCTGCTCTATCCGCTGCGCGGCGT
GTATTACTCCGGTTGAACTGAAAAAGGTATTGTCGGTCGACCTGGGAGCACTGACCCGTATGCTGGATCGCCTGGTCTGT
AAAGGCTGGGTGGAAAGGTTGCCGAACCCGAATGACAAGCGCGGCGTACTGGTAAAACTTACCACCGGCGGCGCGGCAAT
ATGTGAACAATGCCATCAATTAGTTGGCCAGGACCTGCACCAAGAATTAACAAAAAACCTGACGGCGGACGAAGTGGCAA
CACTTGAGTATTTGCTTAAGAAAGTCCTGCCGTAA