MEGAResFrom MEG, the Microbial Ecology Group

MARA

The marA gene encodes an araC family transcriptional regulator in Escherichia coli.

References

  • http://www.jbc.org/content/277/43/40169.full

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3661|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MARA
ATGTCCAGACGCAATACTGACGCTATTACCATTCATAGCATTTTGGACTGGATCGAGGACAACCTGGAATCGCCACTGTC
ACTGGAGAAAGTGTCAGAGCGTTCGGGTTACTCCAAATGGCACCTGCAACGGATGTTTAAAAAAGAAACCGGTCATTCAT
TAGGCCAATACATCCGCAGCCGTAAGATGACGGAAATCGCGCAAAAGCTGAAGGAAAGTAACGAGCCGATACTCTATCTG
GCAGAACGATATGGCTTCGAGTCGCAACAAACTCTGACCCGAACCTTCAAAAATTACTTTGATGTTCCGCCGCATAAATA
CCGGATGACCAATATGCAGGGCGAATCGCGCTTTTTACATCCATTAAATCATTACAACAGCTAG

>>MEG_3662|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|MARA
ATGACGATGTCCAGACGCAATACTGACGCTATTACCATTCATAGCATTTTGGACTGGATCGAGGACAACCTGGAATCGCC
ACTGTCACTGGAGAAAGTGTCAGAGCGTTCGGGTTACTCCAAATGGCACCTGCAACGGATGTTTAAAAAAGAAACCGGTC
ATTCATTAGGCCAATACATCCGCAGCCGTAAGATGACGGAAATCGCGCAAAAGCTGAAGGAAAGTAACGAGCCGATACTC
TATCTGGCAGAACGATATGGCTTCGAGTCGCAACAAACTCTGACCCGAACCTTCAAAAATTACTTTGATGTTCCGCCGCA
TAAATACCGGATGACCAATATGCAGGGCGAATCGCGCTTTTTACATCCATTAAATCATTACAACAGCTAG