Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

GADX

The gadX gene encodes an araC family transcriptional regulator that affects the expression of the MdtEF multi-drug efflux system in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/18297445

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_3083|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|GADX
ATGCAATCACTACATGGGAATTGTCTAATTGCGTATGCAAGACATAAATATATTCTCACCATGGTTAATGGTGAATATCG
CTATTTTAATGGCGGTGACCTGGTTTTTGCGGATGCAAGCCAAATTCGAGTAGATAAGTGTGTTGAAAATTTTGTATTCG
TGTCAAGGGACACGCTTTCATTATTTCTCCCGATGCTCAAGGAGGAGGCATTAAATCTTCATGCACATAAAAAAGTTTCT
TCATTACTCGTTCATCACTGTAGTAGAGATATTCCTGTTTTTCAGGAAGTTGCGCAACTATCGCAGAATAAGAATCTTCG
CTATGCAGAAATGCTACGTAAAAGAGCATTAATCTTTGCGTTGTTATCTGTTTTTCTTGAGGATGAGCACTTTATACCGC
TGCTTCTGAACGTTTTACAACCGAACATGCGAACACGAGTTTGTACGGTTATCAATAATAATATCGCCCATGAGTGGACA
CTAGCCCGAATCGCCAGCGAGCTGTTGATGAGTCCAAGTCTGTTAAAGAAAAAATTGCGCGAAGAAGAGACATCATATTC
ACAGTTGCTTACTGAGTGTAGAATGCAACGTGCTTTGCAACTTATTGTTATACATGGTTTTTCAATTAAGCGAGTTGCAG
TATCCTGTGGATATCACAGCGTGTCGTATTTCATTTACGTCTTTCGAAATTATTATGGGATGACGCCCACAGAGTATCAG
GAGCGATCGGCGCAGAGATTGTCGAACCGTGACTCGGCGGCAAGTATTGTTGCGCAAGGGAATTTTTACGGCACTGACCG
TTCTGCGGAAGGAATAAGATTATAG