MEGAResFrom MEG, the Microbial Ecology Group

MEXI

The mexG-mexH-mexI-opmD is a 4-member gene group that encodes an efflux system in Pseudomonas aeruginosa.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/18988623

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_3915|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MEXI
ATGACCTTTACCGACCTGTTCGTCCGCCGGCCGGTGCTGGCGCTGGTGGTCAGCACGCTGATCCTGCTGCTCGGCCTGTT
CTCCCTGGGCAAGCTGCCGATCCGCCAGTACCCGCTGCTGGAAAGCTCGACCATCACCGTCACCACCGAGTACCCCGGCG
CCTCCGCCGATCTCATGCAAGGCTTCGTCACCCAGCCGATCGCCCAGGCGGTGTCGTCGGTGGAGGGCATCGACTACCTT
TCCTCGACCTCGGTGCAGGGGCGTAGCGTGGTGACCATCCGCATGCTGCTCAACCGCGATTCGACCCAGGCGATGACCGA
GACCATGGCCAAGGTCAACTCGGTGCGCTACAAGCTGCCCGAGCGTGCCTACGACTCGGTGATCGAACGCTCTTCCGGCG
AGACCACCGCGGTAGCCTACGTCGGCTTTTCCAGCAAGACCCTGCCGATCCCGGCGTTGACCGACTACCTGTCGCGGGTG
GTCGAGCCGATGTTCTCTTCCATCGACGGCGTGGCCAAGGTCCAGACCTTTGGCGGCCAGCGCCTGGCCATGCGCCTCTG
GCTCGACGCCGACCGCCTCGCCGGGCGCGGCCTGACCGCCTCCGACGTGGCCGAGGCGATCCGCCGCAACAACTACCAGG
CGGCGCCGGGGATGGTGAAGGGGCAGTACGTGCTGTCCAACGTGCGGGTCAACACCGACCTGACCAACGTCGACGACTTC
CGCGAGATGGTCATCCGCAACGATGGCAACGGCCTGGTGCGCCTGCGCGACGTCGGTACCGTCGAACTGGGCGCCGCGGC
CACCGAGACCAGCGCACTGATGGACGGCGACCCGGCGGTGCACCTGGGGTTGTTCCCGACGCCCACCGGCAACCCGCTGG
TGATCGTCGACGGCATCCGCAAGCTGCTGCCGGAGATCCAGAAGACCCTGCCGCCGGATGTCCGCGTCGACCTCGCCTAC
GAGACTTCGCGCTTCATCCAGGCCTCCATCGACGAGGTGGTGCGGACCCTGGTGGAAGCGCTGCTGATCGTGGTGCTGGT
GATCTACCTCTGCCTCGGCTCGCTGCGCAGCGTGCTGATCCCGGTGGCGACCATTCCCCTGTCGATGCTCGGCGCCGCCG
CGCTGATGCTGGCCTTCGGCTTCAGCGTCAACCTGCTGACCCTGCTGGCGATGGTGCTGGCCATCGGGCTGGTGGTGGAC
GACGCCATCGTGGTGGTGGAGAACGTCCACCGCCACATCGAGGAAGGCAAGTCGCCGGTGGCGGCGGCGCTGATCGGCGC
CCGCGAAGTGGCCGGCCCGGTGATCGCCATGACCATCACCCTGGCCGCCGTGTACACCCCCATCGGCCTGATGGGCGGCC
TCACCGGCGCGCTGTTCCGCGAGTTCGCCCTGACCCTGGCGGGCGCGGTGATCGTGTCCGGGGTGGTGGCGCTGACCCTG
TCGCCGGTGATGAGTTCGCTGCTGCTCCAGGCGCACCAGAACGAGGGGCGCATGGGCCGCGCCGCCGAGTGGTTCTTCGG
CGGCCTGACGCGGCGCTACGGGCAGGTCCTGGAGTTCTCCCTGGGCCACCGCTGGCTGACCGGCGGCCTGGCATTGCTGG
TGTGCATCAGCCTGCCGCTGCTGTATTCGATGCCCAAGCGCGAACTGGCGCCGACCGAGGACCAGGCCGCGGTGCTCACC
GCGATCAAGGCGCCGCAGCACGCCAACCTCGACTATGTCGAACTGTTCGCGCGCAAGCTCGACCAGGTCTACACCAGCAT
CCCGGAAACCGTGAGCACCTGGATCATCAACGGCACCGACGGACCGGCGGCGAGCTTCGGCGGGATCAACCTGGCGGCCT
GGGAAAAACGCGAGCGCGACGCCTCGGCGATCCAGTCCGAGCTGCAAGGCAAGGTCGGCGATGTCGAGGGCAGCAGCATC
TTCGCCTTCCAGTTGGCCGCCCTGCCCGGCTCCACCGGCGGCCTGCCGGTGCAGATGGTGCTGCGCAGCCCGCAGGACTA
TCCAGTGCTCTACCGGACCATGGAAGAGATCAAGCAGAAGGCCCGACAGAGCGGGCTGTTCGTGGTGGTCGACAGCGACC
TCGACTACAACAACCCGGTGGTCCAGGTCCGCATCGACCGCGCCAAGGCCAACAGCCTGGGCATCCGCATGCAGGACATC
GGCGAGTCGCTGGCGGTGCTGGTGGGCGAGAACTACGTCAACCGCTTCGGCATGGAGGGCCGCTCCTACGACGTGATCCC
ACAGAGCCTGCGCGACCAGCGTTTCACTCCGCAAGCGCTGGCACGACAGTTCGTGCGCACCCAGGACGGCAACCTGGTGC
CGCTGTCGACGGTGGTCCGGGTGGCGCTTCAGGTCGAACCGAACAAGCTGATCCAGTTCGACCAGCAGAACGCCGCGACC
CTCCAGGCGATCCCCGCGCCCGGCGTCTCCATGGGCCAGGCGGTGGCCTTCCTCGACGACGTGGCGCGCGGCCTGCCGGC
CGGCTTCAGCCACGACTGGCAATCCGACTCGCGGCAATACACCCAGGAAGGCAACACCCTGGTGTTCGCCTTCCTCGCCG
CCCTGGTGGTGATCTACCTGGTGCTCGCCGCGCAGTACGAGAGCCTGGCCGACCCGCTGATCATCCTGATCACCGTGCCG
CTGTCGATCTGCGGCGCGCTGCTGCCGCTGGCGCTGGGCTACGCGACGATGAACATCTATACGCAGATCGGCCTGGTCAC
CCTGATCGGCCTGATCAGCAAGCACGGCATCCTCATGGTCGAGTTCGCCAACGAACTGCAACTCCACGAGCGCCTCGACC
GCCGCGCGGCGATCCTGCGCGCCGCGCAGATCCGCCTGCGGCCGGTGCTGATGACCACCGCGGCAATGGTCTTCGGCCTG
GTGCCGCTGCTCTTCGCCAGCGGCGCCGGCGCCGCCAGCCGCTTCGGCCTGGGCGTGGTGATCGTCTCCGGGATGCTGGT
CGGCACCCTCTTCACCCTGTTCGTGCTGCCCACCGTCTATACCCTGCTGGCGCGCAACCACGCGGAAGTCGACAAGAGCC
CGCGCAGCCGGCAACTGGCCGAGGCCGATCTGCTGGTGAACAAGGCATGA