MEGAResFrom MEG, the Microbial Ecology Group

MDTP

The mdtP gene encodes a multi-drug efflux pump.

References

  • #N/A

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_3765|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MDTP
ATGATCAATCGTCAACTTTCACGTCTGCTGTTGTGCAGCATTCTCGGCAGCACGACGCTGATTTCCGGCTGTGCCCTGGT
ACGTAAGGATTCTGCACCTCATCAACAGCTCAAACCGGAACAAATCAAACTGGCCGACGATATTCATCTTGCCAGCTCCG
GCTGGCCGCAGGCGCAGTGGTGGAAACAACTCAATGACCCGCAGCTGGATGCGCTGATCCAACGGACGCTAAGTGGTTCA
CACACCCTCGCCGAAGCGAAACTGCGGGAAGAAAAAGCGCAGTCCCAGGCCGATTTGTTAGATGCCGGTTCACAATTACA
GGTCGCAGCGTTAGGGATGCTCAACCGCCAACGTGTCTCGGCGAACGGCTTTTTAAGCCCTTATTCAATGGATGCGCCAG
CACTGGGTATGGACGGGCCGTACTATACGGAAGCCACAGTAGGTTTGTTTGCCGGACTGGATCTTGATTTGTGGGGTGTG
CATCGCTCAGCGGTTGCCGCCGCCATTGGCGCGCATAATGCCGCGCTGGCAGAAACCGCAGCAGTAGAGCTATCGCTGGC
CACGGGCGTAGCGCAGCTTTATTACAGTATGCAGGCCAGCTATCAGATGCTCGATCTGTTAGAACAAACTCACGATGTGA
TTGATTACGCGGTGAAAGCGCACCAGAGTAAAGTGGCGCACGGTCTGGAAGCGCAAGTGCCTTTCCACGGCGCGCGGGCA
CAGATTCTGGCGGTCGATAAACAAATTGTTGCCGTCAAAGGGCAAATCACCGAAACGCGAGAATCTCTGCGTGCATTGAT
TGGCGCGGGAGCCAGCGATATGCCGGAGATCAGACCGGTGGCATTACCGCAAGTCCAGACCGGCATTCCGGCGACACTCT
CTTATGAGTTGCTCGCCAGACGCCCGGATCTGCAAGCCATGCGCTGGTATGTTCAGGCGTCATTAGATCAGGTGGATTCC
GCGCGGGCGTTGTTCTATCCGAGCTTTGATATCAAAGCGTTTTTCGGTCTGGACTCCATCCATCTGCATACCTTATTCAA
AAAAACCAGTCGCCAGTTCAACTTCATCCCGGGTCTGAAATTGCCGCTGTTTGACGGTGGACGGTTGAATGCCAATCTCG
AAGGCACGCGCGCCGCCAGCAACATGATGATTGAACGTTACAACCAGTCAGTACTGAACGCGGTGCGTGACGTTGCCGTC
AACGGCACGCGTCTGCAAACGCTCAACGACGAGCGAGAAATGCAGGCTGAACGCGTGGAAGCCACGCGCTTTACCCAGCG
CGCTGCCGAGGCCGCCTATCAGCGCGGCTTAACCAGCCGCTTACAGGCCACCGAAGCCCGGTTGCCAGTGCTTGCCGAAG
AGATGTCATTACTGATGCTGGACAGCCGCCGGGTGATCCAAAGCATTCAGTTGATGAAATCGCTGGGCGGCGGGTATCAG
GCAGGTCCCGTCGTCGAGAAAAAATAA