MEGAResFrom MEG, the Microbial Ecology Group

MDTN

The mdtN gene encodes a multi-drug efflux pump in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC90435/

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_3763|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MDTN
ATGGAAAGTACGCCGAAAAAAGCTCCTCGCAGTAAATTCCCTGCTCTGTTAGTGGTTGCGTTGGCGCTGGTTGCCCTTGT
TTTCGTTATCTGGCGCGTAGACAGTGCGCCATCAACTAATGACGCTTACGCGTCAGCAGATACCATTGATGTGGTACCGG
AAGTCAGCGGCCGCATTGTAGAACTGGCGGTCACCGACAACCAGGCAGTCAAACAGGGCGATTTGCTGTTCCGCATCGAC
CCGCGCCCGTACGAAGCCAATCTGGCGAAAGCTGAAGCCTCCCTCGCGGCGCTGGATAAGCAAATTATGCTCACCCAGCG
TAGCGTTGACGCGCAACAGTTTGGTGCCGACTCGGTTAATGCCACGGTAGAAAAAGCCCGTGCCGCCGCGAAACAGGCCA
CAGATACATTACGCCGCACCGAGCCATTACTGAAAGAAGGTTTTGTCTCAGCGGAAGATGTTGACCGTGCAAGAACGGCG
CAGCGCGCCGCAGAAGCGGATCTTAATGCCGTATTGTTACAGGCGCAGTCAGCCGCCAGCGCCGTCAGCGGCGTGGATGC
ATTAGTTGCCCAGCGTGCGGCGGTCGAAGCGGATATTGCCCTGACCAAACTGCATCTGGAAATGGCGACCGTTCGCGCGC
CGTTTGATGGCCGGGTCATTTCCCTCAAAACCTCCGTCGGGCAATTTGCTTCTGCCATGCGCCCTATTTTTACCCTAATC
GACACTCGTCACTGGTATGTGATCGCCAACTTCCGCGAAACCGATCTGAAAAATATTCGCTCAGGTACACCCGCAACGAT
TCGCCTGATGAGTGACAGCGGCAAAACCTTCGAGGGTAAAGTGGATTCGATTGGCTACGGCGTGCTACCGGATGACGGCG
GCCTGGTGCTGGGCGGCCTGCCGAAAGTGTCTCGTTCTATTAACTGGGTCCGCGTTGCCCAGCGTTTTCCGGTCAAAATC
ATGGTCGATAAACCTGACCCGGAAATGTTCCGCATCGGCGCTTCGGCAGTCGCTAATCTTGAGCCGCAATAA