Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

ADEB

The adeABC multi-drug efflux system is under the regulation of AdeRS.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_678|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|ADEB
ATGTCACAATTTTTTATTCGTCGTCCCGTTTTTGCTTGGGTTATTGCGATCTTCATTATTATATTTGGATTGCTGAGCAT
TCCTAAACTGCCAATTGCACGTTTTCCAAGTGTGGCCCCGCCACAGGTGAATATTAGTGCGACTTATCCTGGTGCTACAG
CTAAAACCATTAACGATAGCGTTGTAACCTTAATTGAGCGCGAATTATCGGGTGTAAAAAATCTACTCTACTATAGTGCG
ACAACAGATACCTCCGGTACAGCAGAGATTACGGCTACGTTTAAACCAGGCACAGATGTGGAAATGGCTCAGGTTGACGT
TCAAAATAAAATCAAGGCTGTAGAAGCTCGCTTACCGCAAGTTGTACGTCAGCAAGGTTTACAGGTTGAGGCTTCATCGT
CCGGATTTTTAATGCTGGTCGGGATTAACTCTCCAAATAATCAATATTCCGAAGTTGATTTGAGTGATTATTTGGTTCGA
AATGTTGTAGAAGAGCTAAAACGTGTCGAAGGTGTAGGGAAGGTTCAATCTTTCGGTGCCGAGAAAGCTATGCGTATTTG
GGTCGACCCGAATAAGCTTGTTTCTTACGGTTTATCGATTAGTGATGTGAATAATGCCATTCGTGAAAATAATGTCGAAA
TTGCACCCGGCCGACTTGGTGATTTACCAGCTGAAAAAGGCCAGCTCATTACTATTCCATTGTCTGCTCAAGGGCAATTG
TCTAGTCTCGAGCAATTTAAAAATATTAGCTTAAAAAGTAAAACTAACGGTAGCGTAATTAAGTTATCTGATGTTGCCAA
TGTAGAAATAGGCTCACAGGCATATAACTTTGCCATTTTGGAAAATGGTAAGCCTGCTACCGCGGCAGCAATTCAATTAA
GCCCGGGTGCTAACGCCGTGAAAACTGCCGAAGTTGTTCGAGCAAAAATTGAAGAGTTGAAGCTAAATTTACCGGAAGGC
ATGGAGTTTAGTATTCCTTACGACACCGCGCCGTTTGTCAAAATTTCAATTGAAAAGGTAATTCATACATTACTTGAAGC
CATGGTTCTGGTTTTCATTGTGATGTATCTATTTTTACATAATGTCCGCTATACGCTTATTCCAGCGATTGTGGCGCCTA
TTGCCTTACTCGGTACTTTTACCGTGATGTTGCTTGCCGGCTTTTCAATTAACGTACTCACCATGTTCGGTATGGTGCTT
GCCATCGGGATTATTGTCGACGATGCCATTGTCGTGGTTGAAAACGTCGAAAGGATTATGGCGACAGAAGGATTATCGCC
TAAAGATGCAACCTCTAAAGCAATGAAAGAGATTACCAGCCCGATTATTGGTATTACGCTGGTATTGGCGGCAGTATTTT
TACCTATGGCATTTGCGAGTGGTTCTGTAGGGGTAATCTATAAACAGTTTACCTTGACCATGTCGGTATCTATTTTATTT
TCAGCGCTATTGGCACTTATTTTAACACCGGCACTTTGTGCCACGATTTTAAAACCAATCGATGGGCATCACCAGAAGAA
GGGCTTCTTTGCATGGTTTGACCGTAGTTTCGATAAAGTCACTAAAAAGTATGAATTGATGCTGCTTAAAATCATCAAAC
ATACAGTTCCAATGATGGTGATCTTTTTAGTAATTACCGGTATTACCTTTACCGGAATGAAATATTGGCCAACAGCATTT
ATGCCAGAGGAAGATCAAGGTTGGTTCATGACTTCGTTCCAGCTACCTTCAGATGCAACCGCTGAGCGTACTCGGAATGT
AGTCAATCAATTTGAAAATAATTTGAAAGACAATCCCGATGTAAAAAGTAATACCACCATTTTGGGATGGGGTTTTAGTG
GCGCAGGACAAAATGTAGCTGTGGCTTTTACGACACTTAAAGACTTCAAAGAGCGGACTAGCTCTGCATCTAAGATGACA
AGCGACGTTAATTCTTCTATGGCGAACAGTACGGAAGGCGAGACTATGGCCGTGTTACCACCCGCTATTGATGAGTTAGG
TACTTTTTCAGGTTTCAGTTTACGTTTACAAGACCGCGCTAACTTAGGTATGCCTGCTTTACTGGCTGCTCAAGATGAAC
TTATGGCAATGGCAGCCAAGAATAAAAAGTTCTATATGGTTTGGAATGAAGGGTTGCCACAAGGTGACAATATTTCTTTA
AAAATTGACCGTGAAAAGCTTAGTGCATTTGGTGTTAAGTTTTCTGATGTTTCAGACATCATTTCTACATCAATGGGTTC
AATGTATATCAATGACTTCCCTAATCAAGGACGTATGCAACAAGTCATTGTACAGGTTGAGGCTAAATCACGTATGCAAT
TGAAAGATATCTTGAATCTGAAAGTCATGGGTTCAAGCGGTCAATTAGTCTCGTTATCAGAAGTTGTAACGCCACAATGG
AATAAGGCACCACAACAATATAATCGTTATAACGGACGACCATCTTTGAGTATTGCTGGTATTCCTAACTTCGATACGTC
ATCGGGTGAAGCAATGCGTGAAATGGAACAACTGATTGCGAAATTACCGAAAGGTATTGGCTACGAGTGGACAGGTATTT
CCTTACAGGAAAAGCAGTCTGAATCACAAATGGCCTTTTTACTTGGTTTATCCATGTTAGTTGTCTTCCTTGTCTTGGCT
GCACTCTATGAAAGCTGGGCAATTCCACTTTCTGTGATGCTAGTTGTGCCACTCGGTATTTTTGGAGCAATCATTGCCAT
TATGTCTAGGGGGTTAATGAATGATGTGTTCTTCAAAATCGGGCTAATTACCATTATTGGTCTATCGGCAAAGAATGCGA
TTTTGATTGTTGAATTTGCGAAAATGCTGAAAGAAGAAGGCATGAGTTTGATTGAAGCCACTGTTGCCGCAGCCAAACTT
CGCTTACGGCCAATTCTGATGACATCACTTGCATTTACGTGTGGTGTAATTCCTTTGGTGATTGCCTCAGGTGCAAGTTC
AGAAACTCAACATGCTTTAGGCACAGGGGTTTTTGGCGGCATGATTTCAGCCACCATTCTGGCTATTTTCTTTGTTCCCG
TGTTTTTTATCTTCATTTTGGGTGCAGTAGAAAAGCTATTTTCCTCTAAGAAAAAAATCTCATCTTAA