Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

ACRB

The acrAB efflux system is a common multi-drug efflux system under regulation of AcrRS, MarAR, SoxS, Rob, and SdiA.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_401|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|ACRB
ATGCCTAATTTCTTTATCGATCGCCCGATTTTTGCGTGGGTGATCGCCATTATCATCATGTTGGCAGGGGGGCTGGCGAT
CCTCAAACTGCCGGTGGCGCAATATCCTACGATTGCACCGCCGGCAGTAACGATCTCCGCCTCCTACCCCGGCGCTGATG
CGAAAACAGTGCAGGACACGGTGACACAGGTTATCGAACAGAATATGAACGGTATCGATAACCTGATGTACATGTCCTCT
AACAGTGACTCCACGGGTACCGTGCAGATCACCCTGACCTTTGAGTCTGGTACTGATGCGGATATCGCGCAGGTTCAGGT
GCAGAACAAACTGCAGCTGGCGATGCCGTTGCTGCCGCAAGAAGTTCAGCAGCAAGGGGTGAGCGTTGAGAAATCATCCA
GCAGCTTCCTGATGGTTGTCGGCGTTATCAACACCGATGGCACCATGACGCAGGAGGATATCTCCGACTACGTGGCGGCG
AATATGAAAGATGCCATCAGCCGTACGTCGGGCGTGGGTGATGTTCAGTTGTTCGGTTCACAGTACGCGATGCGTATCTG
GATGAACCCGAATGAGCTGAACAAATTCCAGCTAACGCCGGTTGATGTCATTACCGCCATCAAAGCGCAGAACGCCCAGG
TTGCGGCGGGTCAGCTCGGTGGTACGCCGCCGGTGAAAGGCCAACAGCTTAACGCCTCTATTATTGCTCAGACGCGTCTG
ACCTCTACTGAAGAGTTCGGCAAAATCCTGCTGAAAGTGAATCAGGATGGTTCCCGCGTGCTGCTGCGTGACGTCGCGAA
GATTGAGCTGGGTGGTGAGAACTACGACATCATCGCAGAGTTTAACGGCCAACCGGCTTCCGGTCTGGGGATCAAGCTGG
CGACCGGTGCAAACGCGCTGGATACCGCTGCGGCAATCCGTGCTGAACTGGCGAAGATGGAACCGTTCTTCCCGTCGGGT
CTGAAAATTGTTTACCCATACGACACCACGCCGTTCGTGAAAATCTCTATTCACGAAGTGGTTAAAACGCTGGTCGAAGC
GATCATCCTCGTGTTCCTGGTTATGTATCTGTTCCTGCAGAACTTCCGCGCGACGTTGATTCCGACCATTGCCGTACCGG
TGGTATTGCTCGGGACCTTTGCCGTCCTTGCCGCCTTTGGCTTCTCGATAAACACGCTAACAATGTTCGGGATGGTGCTC
GCCATCGGCCTGTTGGTGGATGACGCCATCGTTGTGGTAGAAAACGTTGAGCGTGTTATGGCGGAAGAAGGTTTGCCGCC
AAAAGAAGCTACCCGTAAGTCGATGGGGCAGATTCAGGGCGCTCTGGTCGGTATCGCGATGGTACTGTCGGCGGTATTCG
TACCGATGGCCTTCTTTGGCGGTTCTACTGGTGCTATCTATCGTCAGTTCTCTATTACCATTGTTTCAGCAATGGCGCTG
TCGGTACTGGTGGCGTTGATCCTGACTCCAGCTCTTTGTGCCACCATGCTGAAACCGATTGCCAAAGGCGATCACGGGGA
AGGTAAAAAAGGCTTCTTCGGCTGGTTTAACCGCATGTTCGAGAAGAGCACGCACCACTACACCGACAGCGTAGGCGGTA
TTCTGCGCAGTACGGGGCGTTACCTGGTGCTGTATCTGATCATCGTGGTCGGCATGGCCTATCTGTTCGTGCGTCTGCCA
AGCTCCTTCTTGCCAGATGAGGACCAGGGCGTGTTTATGACCATGGTTCAGCTGCCAGCAGGTGCAACGCAGGAACGTAC
ACAGAAAGTGCTCAATGAGGTAACGCATTACTATCTGACCAAAGAAAAGAACAACGTTGAGTCGGTGTTCGCCGTTAACG
GCTTCGGCTTTGCGGGACGTGGTCAGAATACCGGTATTGCGTTCGTTTCCTTGAAGGACTGGGCCGATCGTCCGGGCGAA
GAAAACAAAGTTGAAGCGATTACCATGCGTGCAACACGCGCTTTCTCGCAAATCAAAGATGCGATGGTTTTCGCCTTTAA
CCTGCCCGCAATCGTGGAACTGGGTACTGCAACCGGCTTTGACTTTGAGCTGATTGACCAGGCTGGCCTTGGTCACGAAA
AACTGACTCAGGCGCGTAACCAGTTGCTTGCAGAAGCAGCGAAGCACCCTGATATGTTGACCAGCGTACGTCCAAACGGT
CTGGAAGATACCCCGCAGTTTAAGATTGATATCGACCAGGAAAAAGCGCAGGCGCTGGGTGTTTCTATCAACGACATTAA
CACCACTCTGGGCGCTGCATGGGGCGGCAGCTATGTGAACGACTTTATCGACCGCGGTCGTGTGAAGAAAGTTTATGTCA
TGTCAGAAGCGAAATACCGTATGCTGCCGGATGATATCGGCGACTGGTATGTTCGTGCTGCTGATGGTCAGATGGTGCCA
TTCTCGGCGTTCTCCTCTTCTCGTTGGGAGTACGGTTCGCCGCGTCTGGAACGTTACAACGGCCTGCCATCCATGGAAAT
CTTAGGCCAGGCGGCACCGGGTAAAAGTACCGGTGAAGCAATGGAGCTGATGGAACAACTGGCGAGCAAACTGCCTACCG
GTGTTGGCTATGACTGGACGGGGATGTCCTATCAGGAACGTCTCTCCGGCAACCAGGCACCTTCACTGTACGCGATTTCG
TTGATTGTCGTGTTCCTGTGTCTGGCGGCGCTGTACGAGAGCTGGTCGATTCCGTTCTCCGTTATGCTGGTCGTTCCGCT
GGGGGTTATCGGTGCGTTGCTGGCTGCCACCTTCCGTGGCCTGACCAATGACGTTTACTTCCAGGTAGGCCTGCTCACAA
CCATTGGGTTGTCGGCGAAGAACGCGATCCTTATCGTCGAATTCGCCAAAGACTTGATGGATAAAGAAGGTAAAGGTCTG
ATTGAAGCGACGCTTGATGCGGTGCGGATGCGTTTACGTCCGATCCTGATGACCTCGCTGGCGTTTATCCTCGGCGTTAT
GCCGCTGGTTATCAGTACTGGTGCTGGTTCCGGCGCGCAGAACGCAGTAGGTACCGGTGTAATGGGCGGGATGGTGACCG
CAACGGTACTGGCAATCTTCTTCGTTCCGGTATTCTTTGTGGTGGTTCGCCGCCGCTTTAGCCGCAAGAATGAAGATATC
GAGCACAGCCATACTGTCGATCATCATTGA

>>MEG_402|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|ACRB
ATGAACAAAAACAGAGGGTTAACGCCTCTGGCGGTCGTTCTGATGCTTTCAGGCAGCTTAGCGCTAACAGGATGTGACGA
CAAACCGGCTCAACAAGGAGCTCAGCAGGCGCCAGAAGTAGGCGTTGTGACGCTCAAATCTGAACCTCTACAAATCACCA
CCGAATTACCCGGCCGTACAAATGCTTACCGCATTGCGGAAGTGCGTCCTCAGGTTAGCGGCATTATCCTGAAACGCAAC
TTCACCGAAGGCGGTGATGTGCAGGCCGGTGAGTCTCTGTATCAGATTGATCCCGCAACCTATCAGGCGTCTTATGAAAG
CGCGAAAGGCGATCTGGCTAAAGCGCAGGCCGCGGCTAAAATTGCCCAGCTGACGCTGAACCGCTATCAAAAACTGCTCG
GTACCAAGTACATCAGTCAGCAGGATTACGATACCGCCCTGGCGGATGCCCAGCAGGCTAACGCCGCCGTGGTGGCAGCC
AAAGCGGCCGTCGAAACCGCGCGCATTAACCTGGCCTATACCAAAGTGACCTCCCCTATCAGCGGTCGTATTGGTAAATC
TTCCGTCACGGAAGGGGCTCTGGTGCAAAACGGTCAGACCACTGCGCTGGCGACCGTGCAGCAGCTCGATCCGATCTATG
TTGACGTCACGCAGTCCAGCAATGATTTCCTGCGCCTGAAACAGGAGTTGGCTAACGGCACCCTGAAACAGGAAAACGGC
AAAGCCAAAGTGGAGCTGATTACCAACGACGGTATCAAGTTCCCGCAGGAAGGGACGCTGGAATTCTCTGACGTGACGGT
CGACCAGACCACCGGTTCCATCACCTTACGTGCGATTTTCCCGAACCCTGACAAAAATCTGCTGCCAGGTATGTTCGTTC
GCGCACGTCTGGAAGAAGGAACGAATCCAACCGCCCTTCTGGTTCCACAGCAGGGTGTGACCCGTACGCCACGCGGCGAT
GCGAGCGCACTGGTTGTTGGGGCTGATAACAAAGTCGAAATGCGCAACATCACCGCCACCCAGGCGATTGGGGATAAATG
GCTGGTGACGGAAGGTCTGAAAGATGGCGATCGCGTGATTGTTACTGGTTTGCAAAAAGTTCGTCCTGGCGCGCAGGTTA
AAGCACAGGAAGTGAAATCTGACGATAAACAACAAGCTTCGGCCGCTGGCCAGTCAGAACAAACCAAGTCTTAA